ORIGINAL RESEARCH article

Front. Cell Dev. Biol., 19 August 2021

Sec. Signaling

Volume 9 - 2021 | https://doi.org/10.3389/fcell.2021.710967

ZDHHC11 Positively Regulates NF-κB Activation by Enhancing TRAF6 Oligomerization

  • 1. State Key Laboratory of Membrane Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, China

  • 2. Institute of Stem Cells and Regeneration, Chinese Academy of Sciences, Beijing, China

  • 3. School of Life Sciences, University of Chinese Academy of Sciences, Beijing, China

  • 4. Institute of Physical Science and Information Technology, Anhui University, Hefei, China

  • 5. Institute of Biomedical Research, Yunnan University, Kunming, China

Abstract

Tumor necrosis factor receptor-associated factor 6 (TRAF6) is a RING domain ubiquitin ligase that plays an important role in nuclear factor-κB (NF-κB) signaling by regulating activation of the TAK1 and IKK complexes. However, the molecular mechanisms that regulate TRAF6 E3 activity remain unclear. Here, we found that ZDHHC11, a member of the DHHC palmitoyl transferase family, functions as a positive modulator in NF-κB signaling. ZDHHC11 overexpression activated NF-κB, whereas ZDHHC11 deficiency impaired NF-κB activity stimulated by IL-1β, LPS, and DNA virus infection. Furthermore, Zdhhc11 knockout mice had a lower level of serum IL6 upon treatment with LPS and D-galactosamine or HSV-1 infection than control mice. Mechanistically, ZDHHC11 interacted with TRAF6 and then enhanced TRAF6 oligomerization, which increased E3 activity of TRAF6 for synthesis of K63-linked ubiquitination chains. Collectively, our study indicates that ZDHHC11 positively regulates NF-κB signaling by promoting TRAF6 oligomerization and ligase activity, subsequently activating TAK1 and IKK complexes.

Introduction

The nuclear factor-κB (NF-κB) transcription factor not only plays important roles in mediating immune responses, cell proliferation and death, but also is critical for inflammatory responses (). It can be activated by stimulation of various receptors such as Toll-like receptors (TLRs), IL-1 receptor (IL-1R), TNFR1, RIG-I-like receptors, and cGAS (Yoneyama et al., 2004; ; ). IL-1β/IL-1R and LPS/TLR4-mediated NF-κB signaling share a similar signaling pathway. Receptor IL-1R as well as TLR4 recruit the adaptor protein MyD88 after binding to ligand IL-1 or LPS, respectively, then MyD88 forms complex with IL-1R-associated kinases (IRAKs), including IRAK1, IRAK2, and IRAK4, and Tumor necrosis factor receptor-associated factor 6 (TRAF6; ). Once the MyD88 complex is activated, TRAF6 servers as an E3 ubiquitin ligase to catalyze the synthesis of K63-linked polyubiquitin chains conjugated to itself or other proteins or as free ubiquitin chains (). K63-linked polyubiquitin chains bind to TAB2 and NEMO to recruit TAK1-TAB1-TAB2 or TAB3 and the IκB kinase IKKα-IKKβ-NEMO complex, respectively, which facilitates TAK1 and IKK activation (). Activated TAK1 triggers IKK complex activation and then the IKK complex phosphorylates IκB protein that binds to NF-κB in the cytoplasm of resting cells, which results in its ubiquitination and degradation. NF-κB is released from association with IκB, and then translocates to the nucleus to trigger transcription of proinflammatory cytokines such as tumor necrosis factor (TNFα), IL-1β, IL-8, and IL-6 (; ).

Tumor necrosis factor receptor-associated factor 6 belongs to the tumor necrosis factor receptor-associated factor (TRAF) family, and plays important roles in activation of NF-κB signaling by IL-1β and LPS (; ). TRAF6 is also involved in regulating the activation of NF-κB signaling induced by virus infection. Previous studies showed that while TRAF6 plays a redundant role with TRAF2 and TRAF5 in activating NF-κB induced by RNA virus infection (), TRAF6 is critical for the activation of NF-κB induced by DNA virus infection (). In NF-κB signaling, TRAF6 acts as an E3 ubiquitin ligase together with the Ub-conjugating enzyme (E2) complex Ubc13-Uev1A to synthesize polyubiquitin chains linked through Lys-63 (K63) of Ub (). The polyubiquitin chains of K63-linked ubiquitin bind to TAB2 and NEMO, which activates the TAK1 and IKK complex, respectively, , , and . TRAF6 harbors an N-terminal RING finger domain, followed by Zn Finger domains and the C-terminal TRAF domain (Xie, 2013). The N-terminal RING and ZF1 domains constitute the minimal unit to catalyze K63-linked polyubiquitin chain synthesis in vitro, and the C-terminal TRAF-C domain facilitates its oligomerization and association with receptors and adaptor proteins (Ye et al., 2002; ). TRAF6 oligomerization is important for its E3 activity (Yin et al., 2009; ). A previous study has shown that TIFA promotes TRAF6 oligomerization and ubiquitination (). Although previous studies have made significant progress in delineating the functions of TRAF6, the mechanism of TRAF6 regulation remains unclear.

Protein S-palmitoylation is a reversible post-translational modification that is dynamically controlled by palmitoyl acyl transferases and palmitoyl thioesterase (Yount et al., 2013; Zaballa and van der Goot, 2018). Palmitoylated proteins are involved in regulating numerous protein properties including trafficking, localization, stability, activity, and association with other proteins (; ). The majority of protein palmitoylation is catalyzed by the family of palmitoyl acyl transferases that have a zinc finger DHHC (ZDHHC) domain required for palmitoyl transfer activity (). There are 23 members of the diverse DHHC protein family in humans, which include ZDHHC1-ZDHHC24 (ZDHHC10 is omitted) in humans (; ). Previous studies have shown that ZDHHC11 is an ER-associated protein and that its aberrant expression is related to the development of some cancers (Yamamoto et al., 2007; ; ; Wu et al., 2013; ). Recently, ZDHHC11 was found to regulate innate immune responses against DNA virus infection by mediating the MITA–IRF3 association (). However, whether ZDHHC11 is involved in inflammatory pathways remains unclear.

In the present study, we identified ZDHHC11 as a positive modulator in NF-κB signaling, and found that ZDHHC11 was involved in regulating the activity of NF-κB stimulated by IL-1β, LPS, and DNA virus infection. Zdhhc11–/– mice exhibited a lower level of serum IL-6 upon treatment with LPS and D-galactosamine or HSV-1 infection than control mice. Moreover, we demonstrated that ZDHHC11 associated with TRAF6 and then increased TRAF6 oligomerization, which enhanced TRAF6 E3 activity to synthesize K63-linked ubiquitination chains. Taken together, we found that ZDHHC11 increases oligomerization and E3 activity of TRAF6, which leads to activation of TAK1 and IKK, and then positively modulates NF-κB signaling.

Results

ZDHHC11 Positively Regulates IL-1β-Induced NF-κB Activation

To determine whether ZDHHC family members play a role in innate immune signaling, HEK293T cells were cotransfected 16 independent cDNA expression plasmids that encoded members of the ZDHHC family with a luciferase gene under the control of the IFNβ promoter (IFNβ-Luc), which contains NF-κB and IRF3 binding sites. As a result, we found that ZDHHC11 significantly induced IFNβ activity compared with other ZDHHC family members (Supplementary Figure 1). Because IFN-β induction requires the coordinated action of both IRF3 and NF-κB, we next investigated how ZDHHC11 activated the IFNβ promoter. We employed an NF-κB luciferase reporter and IFN-stimulated response element (ISRE) luciferase reporter that is activated by IRF3. Reporter assays showed that ZDHHC11 overexpression activated IFNβ and NF-κB, but not the ISRE reporter, in a dose-dependent manner in HEK293T cells (Figures 1A–C). Consistently, quantitative reverse transcription-PCR (qRT-PCR) assays demonstrated that ZDHHC11 overexpression in HEK293T cells increased the mRNA levels of NF-κB downstream genes TNFα and IL8, but not IRF3-dependent genes, such as IFIT1 (Figures 1D–G). Similarly, ZDHHC11 overexpression increased the mRNA levels of TNFα, IL6, and IL8 in HeLa cells (Supplementary Figures 2A–D). Because activation of NF-κB signaling induces p65 phosphorylation and nuclear translocation, we next examined whether ZDHHC11 overexpression affected these characteristics. Western blotting results showed that ZDHHC11 overexpression increased the level of phosphorylated p65 in a dose-dependent manner (Figure 1H and Supplementary Figure 2E) and p65 nuclear translocation was induced when ZDHHC11 was overexpressed in HEK293T cells (Figure 1I). These data suggest that ZDHHC11 overexpression specifically activates NF-κB signaling.

FIGURE 1

Proinflammatory cytokine interleukin-1β (IL-1β) and TNFα trigger NF-κB activation, next, we tried to determinate whether ZDHHC11 played a role in regulating IL-1β- and TNFα-mediated NF-κB activation. qRT-PCR assays indicated that ZDHHC11 overexpression significantly increased the IL8 mRNA level induced by IL-1β, but not TNFα, in HEK293 C6 cells that ectopically express IL-1R (Figure 1J). These data suggest that ZDHHC11 specifically enhances NF-κB activation triggered by IL-1β.

ZDHHC11 Knockdown Decreases IL-1β-Induced NF-κB Activation

To further determinate the biological functions of endogenous ZDHHC11 in modulating NF-κB activation, we employed two lentivirus-delivered shRNAs that specifically targeted non-overlapping regions of the coding region of human ZDHHC11 and evaluated whether knockdown of ZDHHC11 affected NF-κB signaling in HEK293 C6 cells. As shown in Figures 2A–C, both shRNA-ZDHHC11-1/2 efficiently reduced the level of ZDHHC11 mRNA and knockdown of ZDHHC11 significantly reduced transcriptional levels of IL8 and TNFα after IL-1β stimulation in a time-independent manner compared with control cells. Consistently, the levels of phosphorylated TAK1, IKKα/β, and p65 were decreased in ZDHHC11 knockdown cells after IL-1β stimulation (Figures 2D,E and Supplementary Figure 3A). To determine the specific role of ZDHHC11, we conducted rescue experiments, and observed that restored expression of ZDHHC11 reversed the reduced levels of phosphorylated TAK1 and IL8 mRNA induced by IL-1β stimulation in ZDHHC11 knockdown cells (Figures 2F,G). Additionally, we performed a similar knockdown assay in HeLa cells and obtained similar qRT-PCR results as those in HEK293 C6 cells (Supplementary Figures 3B–D). Western blotting also indicated that knockdown of ZDHHC11 reduced the levels of phosphorylated TAK1, IKKα/β, and IκBα stimulated by IL-1β (Supplementary Figures 3E,F). Taken together, these results support the notion that ZDHHC11 positively modulates the NF-κB signaling.

FIGURE 2

Zdhhc11 Deficiency Reduces NF-κB Activation Stimulated by IL-1β and LPS Treatments as Well as DNA Virus Infection

To further elucidate the physiological roles of ZDHHC11 in NF-κB activation, we employed Zdhhc11-deficient mice from Jackson Lab. We generated mouse embryonic fibroblasts (MEFs) from Zdhhc11+/+ and Zdhhc11–/– 13.5-day-old embryos by breeding heterozygote mutants (Supplementary Figure 4A) and then examined the effect of Zdhhc11 deficiency on NF-κB signaling. qRT-PCR showed that Zdhhc11 knockout significantly reduced the mRNA levels of Il6 and Tnfα after stimulation by IL-1β compared with WT controls (Figures 3A,B). Consistently, an enzyme linked immunosorbent assay (ELISA) showed that IL6 protein induced by IL-1β was lower in Zdhhc11–/– MEFs than in Zdhhc11+/+ control cells (Figure 3C). Additionally, western blotting indicated that Zdhhc11 knockout in MEFs reduced the levels of phosphorylated TAK1, IκBα, and IκBα degradation after IL-1β stimulation (Figure 3D). Next, we determined the effect of Zdhhc11 deficiency on NF-κB signaling in bone marrow-derived macrophages (BMDMs). qRT-PCR assays demonstrated that the mRNA levels of Il6 and Il-1β were significantly attenuated in Zdhhc11–/– BMDMs compared with Zdhhc11+/+ cells after IL-1β stimulation (Supplementary Figures 4B,C). These findings indicate that ZDHHC11 plays a critical role in IL-1β-triggered NF-κB activation in MEFs and macrophages.

FIGURE 3

Considering that both LPS and IL-1β trigger NF-κB activation and share similar intracellular signaling pathways (), we next determined whether ZDHHC11 is involved in LPS-induced NF-κB activation. qRT-PCR assays indicated that the mRNA levels of Il6 and Tnfα after LPS stimulation were significantly lower in Zdhhc11–/– MEFs (Supplementary Figures 4D,E) and BMDMs (Figures 3E,F) compared with their Zdhhc11+/+ counterparts. ELISA results also showed that Zdhhc11 deficiency reduced the production of IL6 and TNFα induced by LPS stimulation in BMDMs (Supplementary Figures 4F,G). Consistently, the levels of phosphorylated TAK1, IKKα/β, and p65 in Zdhhc11–/– BMDMs were lower than those in Zdhhc11+/+ BMDMs (Figure 3G). These findings indicate that ZDHHC11 also plays a critical role in LPS-triggered NF-κB activation.

Next, we examined whether ZDHHC11 was involved in NF-κB activation induced by virus infection. As shown in Figure 3H, Zdhhc11 deficiency in BMDMs decreased the mRNA level of Il6 induced by infection with herpes simplex virus (HSV-1), but it had no effect on the expression of Il6 mRNA stimulated by Sendai virus, a kind of RNA virus. Consistent with the results in BMDMs, mRNA levels of Il6 and Tnfα were also lower in Zdhhc11–/– MEFs than wild-type cells upon HSV-1 infection (Supplementary Figures 4H,I). Additionally, we observed that ZDHHC11 deficiency in MEFs reduced the mRNA levels of Ifnb1 and Ifit1, one IRF3-dependent gene, induced by HSV-1, which was consistent with the previous study showing ZDHHC11 modulates the innate immune response to DNA virus infection (Supplementary Figures 4J,K). Collectively, these data suggest that ZDHHC11 also played a positive role in regulating NF-κB signaling triggered by DNA virus infection.

To determinate whether ZDHHC11 is involved in NF-κB signaling in vivo, we first treated Zdhhc11+/+ and Zdhhc11–/– mice with LPS and D-galactosamine by intraperitoneal injection and then measured IL-6 in their sera by ELISA. As shown in Figure 3I, the level of IL-6 protein in Zdhhc11–/– mice was significantly lower than that in control mice. Next, we infected Zdhhc11+/+ and Zdhhc11–/– mice with HSV-1 by intravenous injection and measured IL-6 in sera. As a result, Zdhhc11 knockout mice also showed a significantly reduced level of IL-6 compared with control mice (Figure 3J). These results provide evidence that ZDHHC11 plays an important role in regulating NF-κB signaling in vivo.

ZDHHC11 Targets TRAF6 to Regulate NF-κB Signaling

Our results described above demonstrated that ZDHHC11 was involved in modulating NF-κB activation stimulated by IL-1β, LPS, and DNA virus infection. Next, we tried to explore the molecular mechanism by which ZDHHC11 regulates NF-κB signaling. To identify ZDHHC11-targeted proteins, we first conducted co-immunoprecipitation (Co-IP) to test whether ZDHHC11 interacted with known components of the NF-κB pathway. We cotransfected ZDHHC11 with TAK1, TRAF6, IKKα, IKKβ, NEMO, and p65 into HEK293T cells and found that overexpressed ZDHHC11 strongly associated with TRAF6 and weakly associated with TAK1 and IKKα, whereas no interaction was detected between ZDHHC11 and IKKβ, NEMO, or p65 (Figure 4A). Because TRAF2, TRAF3, and TRAF5 have similar structures to TRAF6 and all play important roles in NF-κB signaling (; ; ), we next investigated whether ZDHHC11 also associated with these TRAF family members. Co-IP indicated that ZDHHC11 pull-downed TRAF6 but not TRAF2, TRAF3, or TRAF5 (Figure 4B). To further investigate the specificity of the interaction between ZDHHC11 and TRAF6, we evaluated whether Flag-tagged ZDHHC11 interacted with endogenous components of NF-κB pathway. As shown in Figure 4C, ectopic expression of ZDHHC11 was strongly associated with endogenous TRAF6, but not other components. Consistently, ZDHHC11 and TRAF6 were reciprocally co-immunoprecipitated in transfected HEK293T cells (Supplementary Figures 5A,B). These data suggest that ZDHHC11 specifically associated with TRAF6 to regulate NF-κB signaling activity.

FIGURE 4

Next, we determined which domains of ZDHHC11 and TRAF6 were responsible for their interaction. TRAF6 consists of three major domains, an N-terminal RING finger domain, Zn Finger domains, and a C-terminal TRAF domain which is further divided into a TRAF-N domain and a TRAF-C domain (Yin et al., 2009). We generated several TRAF6-truncated mutants and found that TRAF-C domain of TRAF6 was required for its interaction with ZDHHC11 (Figure 4D and Supplementary Figure 5C). ZDHHC11 mapping indicated that the C-terminal region of ZDHHC11 (198–412 aa) was involved in the association between ZDHHC11 and TRAF6 (Figure 4E). These results indicated that the association between ZDHHC11 and TRAF6 depends on a specific domain.

To further determine whether TRAF6 is a target of ZDHHC11 in NF-κB signaling, we cotransfected TRAF6 with ZDHHC11 or the empty vector together with an NF-κB-Luc reporter into HEK293T cells. The reporter assay showed that ZDHHC11 overexpression synergistically enhanced TRAF6-induced NF-κB activation (Figure 4F). Consistently, qRT-PCR showed that ZDHHC11 overexpression significantly augmented IL8 mRNA expression induced by TRAF6, but not TRAF2 (Figure 4G). Additionally, TRAF6 knockdown by siRNA dramatically reduced the activities of IFNβ and NF-κB promoters induced by ZDHHC11 overexpression in HEK293T cells (Figures 4H,I). Taken together, these findings further suggest that TRAF6 is the target of ZDHHC11 in regulation of NF-κB signaling.

ZDHHC11 Enhances TRAF6 E3 Activity by Augmenting TRAF6 Oligomerization

Next, we investigated the molecular mechanisms of ZDHHC11, which regulate NF-κB by targeting TRAF6. Because ZDHHC11 is a member of the DHHC palmitoyl acyltransferase family, we examined whether palmitoyl transferase activity is required for its function in NF-κB signaling. In accordance with other members of the DHHC palmitoyl transferase family, specific aspartate-histidine (DH) and cysteine (C) residues in the DHHC domain of ZDHHC members are critical for its palmitoyl transferase activity. Therefore, we constructed several mutants of ZDHHC11, which included ZDHHC11DH/AA (D152A, H153A), ZDHHC11C/S (C155S), and ZDHHC11ΔDHHC (del 152-155 aa), in which DHHC was deleted and then examined their ability to activate NF-κB signaling. Reporter assays demonstrated that these mutants activated NF-κB signaling at similar levels as wild-type ZDHHC11 (Figure 5A). These results suggest that the palmitoyl transferase activity of ZDHHC11 was not required for its NF-κB activation.

FIGURE 5

Previous studies have demonstrated that TRAF6 oligomerization plays an important role in regulating the activity of NF-κB signaling (; ). Therefore, we next examined whether ZDHHC11 modulates TRAF6 oligomerization. Semi-denaturing detergent agarose gel electrophoresis (SDD-AGE) assays were employed to detect TRAF6 oligomerization. As shown in Figure 5B, ZDHHC11 overexpression significantly enhanced TRAF6 oligomerization. Given that the experiments described above indicated C-terminal region of ZDHHC11 (198–412 aa) was important for the association between ZDHHC11 and TRAF6, we then examined whether C-terminal region of ZDHHC11 affects TRAF6 oligomerization. By performing SDD-AGE analysis with truncation mutants of ZDHHC11, we found that C-terminal region of ZDHHC11 (198–412 aa) could remarkably promoted TRAF6 oligomerization (Supplementary Figure 6). These results suggested that the interaction of ZDHHC11–TRAF6 was important for ZDHHC11 to enhance TRAF6 oligomerization. In addition, we conducted immunostaining and observed more and larger granules of TRAF6 when ZDHHC11 and TRAF6 were cotransfected into HEK293T cells compared with TRAF6 transfected alone (Figure 5C). These data collectively demonstrate that ZDHHC11 enhanced TRAF6 oligomerization.

Given that TRAF6 oligomerization promotes its ubiquitin ligase activity, and that ZDHHC11 enhanced TRAF6 oligomerization, we next examined whether ZDHHC11 modulated TRAF6 E3 activity using an in vitro ubiquitination assay. First, we used the TRAF6-Ubc13/Uev2 system with E1 and wild-type ubiquitin and found that ZDHHC11 significantly increased synthesis of ubiquitination chains (Figure 5D). Because K63-linked polyubiquitination catalyzed by TRAF6 plays an important role in the initiation of TAK1 kinase activity (), we next examined whether ZDHHC11 regulates the synthesis of K63-linked ubiquitination chains. As shown in Figure 5E, the synthesis of K63-linked ubiquitination chains was remarkably enhanced after addition of ZDHHC11 protein to the reaction mixture. Given that TRAF6 also mediates itself polyubiquitination, next we examined whether ZDHHC11 affected the ubiquitination of TRAF6. As shown in Figures 5F–I, ZDHHC11 overexpression increased wild-type and K63-lined ubiquitination of TRAF6 which conversely were reduced by ZDHHC11 knockdown. Given that oligomerization of TRAF6 induces TAK1 activation, next we performed in vitro TAK1 activation assay, and found that ZDHHC11 significantly enhanced TAK1 activation (Figure 5J). Collectively, these data suggest that ZDHHC11 enhances TRAF6 E3 activity by promoting TRAF6 oligomerization and E3 ligase activity, subsequently leading to TAK1 activation.

Discussion

The NF-κB signaling plays an essential role in inflammation and innate immunity. Additionally, increasing evidence has demonstrated that the transcription factors of NF-κB family are crucial for many steps in cancer initiation and progression (; ). Here, we found that ZDHHC11, a member of the DHHC palmitoyl transferase family, positively modulated NF-κB signaling. Mechanistically, we demonstrated that ZDHHC11 enhanced TRAF6 oligomerization, which augmented its E3 ligase activation.

ZDHHC11 is a member of the DHHC palmitoyl transferase family, which has been demonstrated to play important roles in regulating STING-mediated antiviral innate immune responses (). Consistent with this study, we also found that ZDHHC11 positively modulated anti-DNA viral innate immune responses. Interestingly, ZDHHC11 overexpression only activated the NF-κB, but not ISRE, promoter. Thus, we examined whether ZDHHC11 is involved in regulating activation of NF-κB induced by other stimuli such as IL-1β, TNFα, and LPS. qRT-PCR showed that ZDHHC11 overexpression synergistically increased the level of IL-8 mRNA induced by IL-1β, but not TNFα, in HEK293 C6 cells. ZDHHC11 knockout showed that ZDHHC11 was involved in modulating NF-κB activation induced by IL-1β, LPS, and DNA virus infection in MEFs and macrophages. Furthermore, in vivo experiments showed that ZDHHC11 deficiency decreased IL-6 secretion in serum induced by LPS/D-galactosamine treatment and HSV-1 infection. Notably, the palmitoyl transferase activity of ZDHHC11 was not involved in NF-κB activation. Of note, we observed that mRNA levels of ZDHHC11 was not induced by the stimulation of IL-1β, and IL-β stimulation had no effect on the association between ZDHHC11 and TRAF6 (Supplementary Figure 7). It would be interesting to address the issue of what triggers the ZDHHC11-TRAF6 binding in the future study.

Tumor necrosis factor receptor-associated factor 6 acts as an E3 ubiquitin ligase together with Ubc13-Uev1A, which catalyzes K63-linked polyubiquitination and plays a critical role in NF-κB signaling by regulating activation of the TAK1 and IKK complexes (; ). TRAF6 oligomerization is critical for its E3 activity (Yin et al., 2009; ). In this study, Co-IP demonstrated that ZDHHC11 interacted with TRAF6 through the TRAF6-C domain that has been reported to function as a binding platform to regulate TRAF6 association with other proteins. ZDHHC11 overexpression significantly increased the level of IL8 mRNA induced by TRAF6 overexpression, whereas knockdown of TRAF6 significantly decreased NF-κB activation induced by ZDHHC11 overexpression. These results support the notion that ZDHHC11 targets TRAF6 to regulate NF-κB signaling. Furthermore, we found that ZDHHC11 overexpression enhanced TRAF6 oligomerization, which subsequently increased E3 activity. These data suggest that ZDHHC11 positively modulates TRAF6 E3 activity by promoting its oligomerization.

Previous studies have indicated that ZDHHC11 and ZDHHC11B play critical roles in maintaining the oncogenic MYC-miR-150-MYB axis in Burkitt’s lymphoma, and ZDHHC11 may be a biomarker to identify high-risk bladder cancer patients with disease progression (Yamamoto et al., 2007; ). In our study, ZDHHC11 overexpression activated NF-κB signaling and it was involved in regulating NF-κB signaling induced by several stimuli such as Il-1β, LPS, and a DNA virus. Because NF-κB signaling plays a crucial role in cancer initiation and progression, whether the function of ZDHHC11 in cancer development is related to its regulatory role in NF-κB signaling needs to be investigated further.

In summary, we identified ZDHHC11 as a positive modulator of NF-κB signaling. ZDHHC11 interacted with TRAF6 and promoted its oligomerization, which increased E3 activity. Our data provide a new insight into understanding the regulatory mechanism of TRAF6-mediated NF-κB signaling.

Materials and Methods

Ethics Statement

All animal studies were performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. The protocols for animal studies were approved by the Committee on the Ethics of Animal Experiments of the Institute of Zoology, Chinese Academy of Sciences (Approval number: IOZ15001).

Cell Culture and Animals

HEK293T and HeLa cells were bought from the Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China). HEK293 C6 cells that ectopically express IL-1R were kindly provided by Dr. Zongping Xia in Zhengzhou University. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) containing 10% (v/v) fetal bovine serum (Invitrogen) and 1% streptomycin and penicillin. Zdhhc11+/+ and Zdhhc11–/– MEFs were isolated from 13.5-day-old embryos of Zdhhc11+/+ and Zdhhc11–/– mice (The Jackson Laboratory). MEFs were cultured in complete DMEM containing 1 mM sodium pyruvate, 10 μM L-glutamine, 10 μM β-mercaptoethanol, and 1% non-essential amino acids. BMDMs were prepared as described previously (). Genomic DNA was extracted from 2-week-old mouse tails or cells for genotyping, followed by PCR analyses in accordance with the instructions from The Jackson Laboratory. The sequence of primers for genotyping is as follows:

  • #1 (5′–3) CTGCCATACACCTAAATGCCTCAGC;

  • #2 (5′–3) TTTCGGAGCTGAAAAGCCAAGAAGG;

  • #3 (5′–3) ACTTGCTTTAAAAAACCTCCCACA;

  • #4 (5′–3) CCACATACCACACAGACATACACAGC.

Plasmids

Flag-tagged ZDHHC11, TRAF2, TRAF3, TRAF5, TRAF6, TAK1, IKKα, IKKβ, NEMO, P65 and; Myc-tagged ZDHHC11 were cloned into pcDNA3 or pEF vector. ZDHHC11 and TRAF6 mutants were generated by PCR using Pfu DNA polymerase. IFN-β, NF-κB, and ISRE luciferase reporter plasmids have been described previously (Zhao et al., 2012).

Antibodies

Rabbit anti-Flag was purchased from Sigma. Rabbit and mouse anti-Myc antibodies were purchased from MBL. Rabbit anti-p-P65 (Ser536, 3033), anti-TAK1 (5206), anti-p-TAK1 (T184/187, 4508), anti-IKKα (61294), anti-IKKβ (8943), anti-p-IKKα/β (S176/180, 2697), and mouse anti-p-IκBα (Ser32/36, 9246) antibodies were from Cell Signaling Technology. Mouse anti-p65 (SC-8008), anti-TRAF2 (SC-876), anti-ubiquitin (SC-8017), and rabbit anti-IκBα (SC-371) were from Santa Cruz Biotechnology. Rabbit anti-TRAF6 (ab40675) was from Abcam. Mouse anti-GAPDH (KM9002) and anti-Tubulin (KM9007) were from Sungene Biotechnology.

Transfection and Luciferase Assay Reporter

HEK293T cells were cotransfected with the indicated expression plasmids or an empty vector with a Renilla reporter plasmid and luciferase reporter plasmid that encoded IFNβ-Luc, NF-κB-Luc, or ISRE-Luc. The empty control plasmid was added to ensure that each transfection obtains the same amount of total DNA. 24 h after transfection, the cells were lysed for luciferase activity, and transfection efficiency was normalized to Renilla activity ().

Co-IP and Immunoblot Assay

The Co-IP methods have been described previously (Zhao et al., 2012). Briefly, cells were lysed in lysis buffer with protease inhibitor cocktail (Roche) and incubated at 4°C with anti-Flag agarose beads (Sigma) or anti-Myc magnetic beads (Bimake) for 4 h. The complexes were washed 3–4 times and subjected to immunoblot assay. For detecting multiple phosphoproteins, the cells were directly lysed in 1x SDS-PAGE sample loading buffer (50 mM Tris pH 6.8, 1% mercaptoethanol, 2% SDS, 0.01% bromophenol blue, and 10% glycerol). Immunoblotting was conducted using standard procedures.

SDD-AGE Assay

Cells were transfected as indicated and then lysed in lysis buffer (1% NP40, 50 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, and 10% glycerol) with protease inhibitor cocktail (Roche) for 30 min at 4°C. The cell lysates were centrifugated at 10,000 rpm for 10 min. The SDD-AGE assay was performed as described previously (). Briefly, the supernatants were resuspended in 1x sample buffer (0.5x TBE, 2% SDS, 10% glycerol, and 0.01% bromophenol blue), loaded on 1.5% agarose gel and electrophoresis was performed in the running buffer (1x TBE and 0.1% SDS) with a constant voltage of 110 V for 45 min at 4°C, followed by immunoblotting.

Immunofluorescence

HEK293T cells were cultured in gelatin-coated 12-well plates overnight, and then transfected with the indicated plasmids. After 24 h, the cells were washed with phosphate-buffered saline, fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.2% Triton X-100 for 15 min, and then blocked with 5% (w/v) bovine serum albumin for 30 min, followed by incubating with primary and secondary antibodies. Imaging was performed under a Zeiss LSM 710 META laser scanning confocal system and ANDOR CR-DFLY-505 confocal microscope equipped with a sCMOS Zyla 4.2 plus camera.

In vitro Ubiquitination Assays

HEK293T cells were transfected with Flag-ZDHHC11 or Flag-TRAF6 and then cultured for 36 h. The cells were lysed with lysis buffer (0.5% NP40, 20 mM Tris–HCl pH7.5, 150 mM NaCl, 10% glycerol, and 1 mM EDTA) with protease inhibitor cocktail (Roche) and then purified with anti-Flag beads. The proteins were eluted by a Flag peptide after extensive washing with buffer (0.5% NP40, 20 mM Tris–HCl pH 7.5, 500 mM NaCl, 10% glycerol, and 1 mM EDTA). In vitro ubiquitination assays were performed in a reaction mixture containing recombinant E1, Ubc13/Uev2, TRAF6, and ubiquitin (WT or K63-linked) in ATP buffer in the presence or absence ZDHHC11 protein. The reaction was incubated at 30°C for 1 h and terminated by addition of denaturing sample buffer, followed by 95°C heating for 5 min. The samples were resolved on 6–18% or 10% SDS-PAGE gels, followed by immunoblotting with indicated antibodies.

In vitro TAK1 Kinase Activation Assays

HEK293T cells were infected with lentivirus expressing PCDH-Flag-TAK1. At 100 h post-infection, the cells were lysed with lysis buffer (0.5% Tritonx-100, 20 mM Tris–HCl pH7.5, 150 mM NaCl, 10% glycerol, and 1 mM EDTA) with protease inhibitor cocktail (Roche) and then purified with anti-Flag beads. The proteins were eluted by a Flag peptide after washing with buffer (0.5% Tritonx-100, 20 mM Tris–HCl pH 7.5, 150 mM NaCl, 10% glycerol, and 1 mM EDTA). TRAF6 and ZDHHC11 protein were purified as described in ubiquitination assays. In vitro TAK1 kinase activation assays were performed in a reaction mixture containing recombinant E1, Ubc13/Uev2, TRAF6, TAK1 complex and ubiquitin in ATP buffer with or without ZDHHC11 protein. The reaction was incubated at 30°C for 1 h and terminated by addition of denaturing sample buffer, followed by 95°C heating for 5 min. The samples were resolved on 10% SDS-PAGE gels and then analyzed by immunoblotting with the indicated antibodies.

Target Gene Knockdown by RNA Interference and Lentivirus-Mediated shRNA

HEK293T cells were transfected with siRNA that targeted TRAF6 or a non-targeting control (NC) at a final concentration of 30 nM by the standard calcium phosphate transfection method. 24 h after transfection, the cells were transfected with the indicated plasmids using Lipofectamine 3000 (Invitrogen) for 24 h and then harvested for luciferase reporter assays and immunoblot analysis. The sequence for human TRAF6 siRNA were as follows (5′–3′): CUGUGCUGCAUCAAUGGCA.

HEK293 C6 and HeLa cells were infected with lentivirus that targeted two different regions of human ZDHHC11 (shZDHHC11-1 and shZDHHC11-2) or an empty vector for 48 h. The cells were untreated or treated with IL-1β for the indicated times, followed by subsequent experiments. Knockdown efficiency was determined by qRT-PCR. The shRNA sequences against human ZDHHC11 were as follows (5′–3′): shZDHHC11-1: CTCCAATGTCAGACTCATGAA; shZDHHC11-2: CCACCTTTGAGTAT CTCATTA.

qRT-PCR

Total RNA was isolated from cells with TRIZOL reagent (Invitrogen), cDNA was synthesized with a SuperScript III First-Strand cDNA Synthesis kit (Invitrogen). qRT-PCR was performed using SYBR Green Master Mix (Thermo Fisher) and Bio-Rad CFX connect system. Data were normalized to the abundance of GAPDH mRNA, and shown with the relative abundance of mRNA compared with the control group. The primers used were listed as follows (5′–3′):

  • hZDHHC11-S GGTGCAGACCCTGATAGTCG

  • hZDHHC11-AS GCACGTATGGATCTTTCCTCAC

  • hIL8-S ATAAAGACATACTCCAAACCTTTCCAC

  • hIL8-AS AAGCTTTACAATAATTTCTGTGTTGGC

  • hTNFα-S CTGCCCCAATCCCTTTATT

  • hTNFα-AS CCCAATTCTCTTTTTGAGCC

  • hIFIT1-S TACCTGGACAAGGTGGAGAA

  • hIFIT1-AS GTGAGGACATGTTGGCTAGA

  • hGAPDH-S ATGACATCAAGAAGGTGGTG

  • hGAPDH-AS CATACCAGGAAATGAGCTTG

  • mIl6-S TCGGAGGCTTAATTACACATGTTCT

  • mIl6-AS TGCCATTGCACAACTCTTTTCT

  • mTnfα-S TCCCCAAAGGGATGAGAAGTT

  • mTnfα-AS GTTTGCTACGACGTGGGCTAC

  • mGapdh-S AACTTTGGCATTGTGGAAGG

  • mGapdh-AS ACACATTGGGGGTAGGAACA

  • mIfnb1-S ATGGTGGTCCGAGCAGAGAT

  • mIfnb1-AS CCACCACTCATTCTGAGGCA

  • mIl-1β-S AAAGCCTCGTGCTGTCGGACC

  • mIl-1β-AS CAGGGTGGGTGTGCCGTCTT.

In vivo LPS Treatment and Viral Infection and ELISA

Zdhhc11+/+ and Zdhhc11–/– mice were treated with LPS (3 μg/kg) and D-galactosamine (250 mg/kg) via intraperitoneal injection. Sera were collected at 1 and 3 h after injection to measure IL-6 by a mouse IL-6 ELISA kit (BD Biosciences) following with the manufacturer’s instructions. Zdhhc11+/+ and Zdhhc11–/– mice were infected with HSV-1 via tail vein injection at 2 × 107 plaque-forming units (PFU)/mouse. Sera were collected at 4 and 8 h after infection to measure IL-6 production by an ELISA kit.

Statistical Analysis

The data are presented as means ± SD and two-tailed Student’s t-test was used to examine significant differences between values under different experimental conditions. For all tests, p values < 0.05 were considered statistically significant.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics statement

All animal studies were performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. The protocols for animal studies were approved by the Committee on the Ethics of Animal Experiments of the Institute of Zoology, Chinese Academy of Sciences (Approval number: IOZ15001).

Author contributions

EL, DC, and QS designed the experiments and wrote the manuscript. EL, JS, JY, LL, QY, JZe, and JZh performed the experiments. EL and QS performed data analysis. All authors contributed to the article and approved the submitted version.

Funding

This study was supported by Natural Science Foundation of China (Grant 31970895) and the Open Research Program of State Key Laboratory of Membrane Biology.

Acknowledgments

We would like thank Zongping Xia (Zhengzhou University) for kindly providing HEK293 C6 cells and recombinant E1, Ubc13/Uev2 and ubiquitin protein.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2021.710967/full#supplementary-material

Supplementary Figure 1

Identification of ZDHHC11 as a positive regulator in NF-κB signaling.

Supplementary Figure 2

ZDHHC11 overexpression activates NF-κB downstream genes in HeLa cells.

Supplementary Figure 3

ZDHHC11 knockdown reduces NF-κB activation stimulated by IL-1β in HeLa cells.

Supplementary Figure 4

Zdhhc11 deficiency reduces NF-κB activation stimulated by IL-1β, LPS, and DNA virus infection.

Supplementary Figure 5

TRAF6 interacts with ZDHHC11 through its TRAF C domain.

Supplementary Figure 6

C-terminal (198-412aa) region of ZDHHC11 plays an important role in enhancing TRAF6 oligomerization.

Supplementary Figure 7

IL-1β treatment has no effect on the mRNA level of ZDHHC11 and association with TRAF6.

References

Summary

Keywords

ZDHHC11, NF-κB, TRAF6, oligomerization, inflammation

Citation

Liu E, Sun J, Yang J, Li L, Yang Q, Zeng J, Zhang J, Chen D and Sun Q (2021) ZDHHC11 Positively Regulates NF-κB Activation by Enhancing TRAF6 Oligomerization. Front. Cell Dev. Biol. 9:710967. doi: 10.3389/fcell.2021.710967

Received

17 May 2021

Accepted

26 July 2021

Published

19 August 2021

Volume

9 - 2021

Edited by

Soumen Basak, National Institute of Immunology (NII), India

Reviewed by

Payel Roy, La Jolla Institute for Immunology (LJI), United States; Sunil Kumar Raghav, Institute of Life Sciences (ILS), India

Updates

Copyright

*Correspondence: Qinmiao Sun,

These authors have contributed equally to this work

This article was submitted to Signaling, a section of the journal Frontiers in Cell and Developmental Biology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics