ORIGINAL RESEARCH article

Front. Cell Dev. Biol., 25 October 2021

Sec. Signaling

Volume 9 - 2021 | https://doi.org/10.3389/fcell.2021.749607

Loss of Function Glucose-Dependent Insulinotropic Polypeptide Receptor Variants Are Associated With Alterations in BMI, Bone Strength and Cardiovascular Outcomes

  • 1. Department of Biomedical Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark

  • 2. Faculty of Health and Medical Sciences, Novo Nordisk Foundation Center for Basic Metabolic Research, University of Copenhagen, Copenhagen, Denmark

  • 3. Department of Drug Design and Pharmacology, University of Copenhagen, Copenhagen, Denmark

  • 4. Antag Therapeutics ApS, Copenhagen, Denmark

Abstract

Glucose-dependent insulinotropic polypeptide (GIP) and its receptor (GIPR) are involved in multiple physiological systems related to glucose metabolism, bone homeostasis and fat deposition. Recent research has surprisingly indicated that both agonists and antagonists of GIPR may be useful in the treatment of obesity and type 2 diabetes, as both result in weight loss when combined with GLP-1 receptor activation. To understand the receptor signaling related with weight loss, we examined the pharmacological properties of two rare missense GIPR variants, R190Q (rs139215588) and E288G (rs143430880) linked to lower body mass index (BMI) in carriers. At the molecular and cellular level, both variants displayed reduced G protein coupling, impaired arrestin recruitment and internalization, despite maintained high GIP affinity. The physiological phenotyping revealed an overall impaired bone strength, increased systolic blood pressure, altered lipid profile, altered fat distribution combined with increased body impedance in human carriers, thereby substantiating the role of GIP in these physiological processes.

Introduction

Glucose-dependent insulinotropic polypeptide (GIP) is a gut-derived hormone that is secreted from the enteroendocrine K cells in the proximal part of the small intestinal in response to nutrient intake (; ). GIP, along with a related hormone, glucagon-like peptide-1 (GLP-1), constitute the incretin hormones that regulate postprandial glucose tolerance by stimulating insulin release from pancreatic β-cells (). In contrast to GLP-1, GIP has been demonstrated to enhance glucagon secretion in a glucose-dependent manner in healthy individuals, thus at low- and normal blood glucose levels GIP stimulates glucagon secretion from α-cells, but fails to do so at higher blood glucose levels (, ). GIP has also been ascribed a role in mediating fat deposition (). The GIP receptor (GIPR) belongs to the class B1 G protein-coupled receptor (GPCR) superfamily and signals through Gαs/adenylyl cyclase activation, leading to increased cyclic adenosine monophosphate (cAMP) concentrations ().

The GIPR is not only expressed in pancreatic islet cells and adipocytes but has a wide expression profile including, but possibly not limited to, the heart, spleen, lung, central nervous system, and thyroid cells (). Additionally, the GIP system is important for bone metabolism through GIPR expression on osteoblasts and osteoclasts (; Zhong et al., 2007; ) through which GIP inhibits bone resorption as well as promotes bone formation (; Zhong et al., 2007; ; ). Even though it is now getting recognized that GIP/GIPR is involved in bone metabolism, it is largely unknown how genetic alterations, influencing GIPR signaling, affect bone growth and resorption. The potential impact of the GIP-GIPR axis in other organ systems is similarly underinvestigated. A recent review emphasized the potential importance of GIP/GIPR in cardiovascular diseases, although details of the operation of this axis in humans are virtually unknown ().

GIP is associated with the pathophysiology of obesity and type 2 diabetes mellitus (T2D) and have therefore been the focus of therapeutic interest for many years. It is currently debated whether to use GIPR agonists or -antagonists in combination with GLP-1 agonists to treat obesity and T2D, as both combinations show promising results (; ; ). Clearly, there is a need to better understand the biology of the GIPR system to be able to exploit its pharmacological potential.

Genome-wide association studies (GWAS) have revealed that common variants in the GIPR are associated with obesity (; ) and impaired glucose- and bone mineral homeostasis (; ; ). With the exemption of rs1800437 causing the amino acid change E354Q, which leads to long-term functional impairment due to its distinct ligand binding kinetics, signaling and internalization profile (; ; ; ; ), the GIPR variants have not been functionally characterized. In a recent exome-wide association study designed to discover protein-altering variants associated with body mass index (BMI), two rare variants in GIPR were identified (). These missense variants result in amino acid changes, R190Q (rs139215588) and E288G (rs143430880). From gnomAD (), the frequencies of R190Q and E288G in Europeans are 0.00093 and 0.0017, corresponding to ∼1 in 500 and ∼1 in 300 being heterozygous carriers, respectively. For each variant, heterozygote carriers of the rare allele had a ∼0.15 SD lower BMI compared to non-carriers, corresponding to an effect of ∼0.65 kg/m2. Interestingly, one middle-aged woman carried both rare GIPR mutations in heterozygote form and she weighed ∼11 kg less than the average non-carrier of the same height ().

Here we combine molecular pharmacological phenotyping with the physiological consequences of carrying these two rare GIPR variants. First, we investigated experimentally the GIP receptor binding and activation properties of the two variants, and secondly, we linked our findings to human physiology by assessing summary data of previously published studies and online portals.

Materials and Methods

Materials

The human GIPR that was inserted into pcDNA 3.1 plasmid (GenBank accession number: NM_000164) was synthesized and purchased from GenScript (Piscataway, NJ) along with the GIPR mutations: R190Q, E288G and the double mutant R190Q-E288G. For the real-time internalization assay, the N-terminally SNAP-tagged GIPR was synthesized and purchased from Cisbio (Codolet, France) and R190Q and E288G were introduced into the wild-type GIPR by site-directed mutagenesis according to quick-change protocol, using primers:

  • GCGGCCATTCTCAGCCAGGACCGTCTGC (forward for R190Q), GCAGACGGTCCTGGCTGAGAATGGCCGC (reverse for R190Q), CGCAGTGCTGGGGCCGCAACGA AGTCAAGGC (forward for E288G), GCCTTGACTTCG TTGCGGCCCCAGCACTGCG (reverse for E288G).

Human GIP(1-42) was purchased from Caslo ApS (Lyngby, Denmark). HEK293 and COS-7 cells were both purchased from ATTC (Manassas, VA). Cell medium for HEK293 was purchased from Thermo Fisher Scientific (Waltham, MA) and the cell medium for COS-7 cells were prepared in-house. Other chemicals were purchased from standard commercial sources.

Transfection and Tissue Culture

COS-7 cells were cultured at 10% CO2 and 37°C in Dulbecco’s Modified Eagle Medium (DMEM) 1885 supplemented with 10% fetal bovine serum (FBS), 2 mmol/L glutamine, 180 units/mL penicillin and 45 g/mL streptomycin. HEK293 cells were cultured at 10% CO2 and 37°C in DMEM GlutaMAXTM-I supplemented with 10% FBS, 180 units/mL penicillin and 45 g/mL streptomycin. Both cell lines were transfected using the calcium phosphate precipitation method () for binding and cAMP assay. For β-arrestin 2 recruitment assay, the PEI-transfection method was used and the Lipofectamine transfection method was used for the internalization assay.

Transiently transfected COS-7 cells were used in homologous competition binding assay. HEK293 cells were used in cAMP accumulation, β-arrestin 2 recruitment and internalization experiments.

cAMP Experiments

HEK293 cells were transiently transfected with either wild-type GIPR, R190Q, E288G or the double mutation R190;E288G, and the cAMP measurements were done with an enzyme fragment complementation (EFC)-based assay (). In brief, the cells were seeded in white 96-well plates at a density of 35.000 per well 1 day after the transfection. The following day, the cells were washed twice with HEPES-buffered saline (HBS) and incubated with HBS and 1 mM 3-isobutyl-1-methylxanthine (IBMX) for 30 min at 37°C. The cells were then stimulated with increasing concentrations of GIP(1-42) and incubated for additional 30 min at 37°C. The HitHunterTM cAMP XS assay (DiscoverX, Herlev, Denmark) was carried out according to manufacturer’s instructions.

Homologous Competition Binding Assay

Transiently transfected COS-7 cells expressing either wild-type GIPR, R190Q, E288G or R190Q;E288G were seeded in a clear 96-well plate 1 day after transfection. The number of cells added per well was adjusted aiming for 5–10% specific binding of 125I-GIP(1-42). The following day, the cells were assayed by competition binding for 3-h at 4°C using ∼15–40 pM of 125I-GIP(1-42) and increasing concentrations of GIP(1-42) in binding buffer (50 mmol/L HEPES buffer, pH 7.2 supplemented with 0.5% bovine serum albumin (BSA). After incubation, the cells were washed in ice-cold binding buffer and lysed with 200 mmol/L NaOH with 1% SDS for 30 min. The samples were analyzed by the Wallac Wizard 1470 Gamma Counter.

β-Arrestin 2 Recruitment Assay

To measure β-arrestin 2 recruitment, HEK293 cells were transiently transfected with either wild-type GIPR, R190Q, E288G or R190Q;E288G and the donor Rluc8-Arrestin-3-Sp1, the acceptor mem-linker-citrine-SH3 and GPCR kinase 2 (GRK2) to facilitate β-arrestin 2 recruitment. Two days after transfection, the cells were washed with PBS and re-suspended in PBS with 5 mmol/L glucose. Subsequently, 85 μL of the cell suspension solution was transferred to its respective wells on a white 96-well isoplate followed by the addition of PBS with 5 μmol/L coelenterazine-h. After a 10 min incubation of the cells with coelenterazine-h, increasing concentration of endogenous GIP(1-42) were added and luminescence was measured by the Berthold Technologies Mithras Multilabel Reader (Rluc8 at 485 ± 40 nm and YFP at 530 ± 25 nm).

Real-Time Internalization Assay

HEK293 parental cells transiently expressing the SNAP-tag GIPR or the variant, SNAP-tag-R190Q or—E288G were seeded in white 384-well plate after transfection, at a density of 20.000 cells per well. The following day, the medium was removed and fresh medium was added to all wells. The next day, the assay was carried out by labeling all SNAP-tagged cells with 100 nmol/L Taglite SNAP-Lumi4-Tb (donor) in OptiMEM for 60 min at 37°C. Subsequently, the cells were washed 4 × with HBBS supplemented with 1 mM CaCl2, 1 mM MgCl2, 20 mM HEPES and 0.1% BSA (internalization buffer, pH 7.4). 50 μM pre-heated fluorescein-O’-acetic acid (acceptor) was added to all wells, except wells where only donor signal was measured. The 384-plates were incubated at 37°C for 5–10 min prior to ligand addition. Then, the cells were stimulated with increasing doses of GIP(1-42), that was pre-heated at 37°C, and donor signal and internalization rate were measured every 4 min for 90 min at 37°C in PerkinElmerTM Envision 2014 multi-label Reader.

Analysis of Online High Quality Summary Statistics of R190Q and E288G

Frequencies of R190Q and E288G were from gnomAD v2.1.1 (). We examined available summary data from published papers to determine the effect of GIPR R190Q and E288G on relevant phenotypes. Data on bone mineral density (BMD) and bone fracture risk have been contributed by . The p-values P.NI and P.I were used, respectively, as recommended by the authors. The data was downloaded from http://www.gefos.org/?q=content/data-release-2018. The BMD and fracture risk summary data derive from analyses performed in UK Biobank (NBMD = 426,824; fracture risk = 53,184 cases and 373,611 controls). Summary statistical data on body composition, obesity risk, physical activity, and cardiovascular events were derived from GeneATLAS (UK Biobank, N = 452,264) (). These summary data were downloaded from http://geneatlas.roslin.ed.ac.uk/. Summary data on circulating leptin levels (N = 57,232) have been contributed by Yaghootkar et al. (2020) via the NHGRI-EBI GWAS Catalog. The NHGRI-EBI GWAS Catalog is funded by NHGRI Grant Number 2U41HG007823, and delivered by collaboration between the NHGRI, EMBL-EBI and NCBI. Summary statistics were downloaded from the NHGRI-EBI GWAS Catalog () for study GCST90007307 and GCST90007319 (Yaghootkar et al., 2020) on 15/12/2020 and 16/12/2020, respectively. Risk of T2D was assessed by summary statistical data (48,286 cases and 250,671 controls) contributed by , and the data were downloaded from http://diagram-consortium.org/downloads.html. Results included two models either not including BMI as a covariate or adjusted for BMI (BMI adj.). The lipid levels association results were derived from summary data of an exome-wide meta-analysis (N = ∼350,000) contributed by , and we downloaded the data from http://csg.sph.umich.edu/willer/public/lipids2017EastAsian/. Blood pressure and hypertension were investigated based on summary data derived from a meta-analysis of rare variants associated with blood pressure measures in European individuals (N = 1,164,961) performed by . These summary data were downloaded from https://app.box.com/s/1ev9iakptips70k8t4cm8j347if0ef2u. Data on myocardial infarction include summary statistics (N = 42,335 cases and 78,240 controls) contributed by the CARDIoGRAMplusC4D Consortium (). Data on coronary artery disease/myocardial infarction were contributed by the Myocardial Infarction Genetics and CARDIoGRAM Exome investigators and were downloaded from www.CARDIOGRAMPLUSC4D.ORG. Summary statistical data on SOFT coronary artery disease [fatal or non-fatal myocardial infarction, percutaneous transluminal coronary angioplasty or coronary artery bypass grafting, chronic ischemic heart disease, and angina; N = 71,602 cases and 260,875 controls (53,135 cases and 215,611 controls for the exome markers)] are derived from a meta-analysis of three GWAS, namely UK Biobank (interim release), CARDIoGRAMplusC4D 1000 Genomes-based, and the Myocardial Infarction Genetics and CARDIoGRAM Exome (). Data on coronary artery disease/myocardial infarction have been contributed by the CARDIoGRAMplusC4D and UK Biobank CardioMetabolic Consortium CHD working group who used the UK Biobank Resource (application number 9922). Data have been downloaded from www.CARDIOGRAMPLUSC4D.ORG. Supplementary Table 1 provides further details about the different studies and cohorts. A p-value below 0.05 was considered as statistically significant in analyses of specific hypotheses, while a significance threshold of 10–4 was applied on the phenome-wide scan in UK Biobank data.

Results

The Glucose-Dependent Insulinotropic Polypeptide Receptor Variants, R190Q and E288G, Show Markedly Reduced G Protein-Mediated Signaling Despite Maintained Glucose-Dependent Insulinotropic Polypeptide Binding

The residue R190 is placed in the second transmembrane (TM2) domain in position 67 of the GIPR, hence denoted R1902.67 (Wooten nomenclature in superscript; Wootten et al., 2013), near the first extracellular loop (ECL1), whereas E288 residue is located in the second extracellular loop (ECL2) of the receptor (Figure 1A). It has previously been shown that the N-terminal part of GIP, interacts with R1902.67 by forming a hydrogen bond (; Zhao et al., 2021).

FIGURE 1

As Gαs is the main signaling pathway for the GIPR, we assessed the impact of these two mutations either separately or in combination. This was done by measuring intracellular cAMP accumulation in transiently transfected HEK293 cells in response to increasing concentrations of GIP. Both variants displayed reduced signaling capacity compared to wild-type GIPR with a markedly decreased (>250-fold) potency of GIP with EC50-values of 10 nM for R190Q and 3.6 nM for E288Q, compared to the wild-type GIPR with an EC50-value of 4.2 pM (Table 1). R190Q reached a maximal activation (Emax) of 75% of that of wild-type GIPR at 1 μM, whereas E288G reached 90%. The double mutant, R190Q-E288G resulted in a complete loss of activation through Gαs (Figure 1B).

TABLE 1

Binding
cAMP accumulation
β -arrestin 2 recruitment
BmaxpIC50FmutEmaxpEC50FmutEmaxpEC50Fmut

Missense variant% of WT ± SEMpIC50 ± SEM(KD mutation/KD Wild-type)% of WT ± SEMLogEC50 ± SEM(EC50 mutation/EC50 Wild-type)% of WT ± SEMpEC50 ± SEM(EC50 mutation/EC50 Wild-type)
GIPR (WT)1008.6 ± 0.296 ± 1.411 ± 0.198 ± 2.79.1 ± 0.1
R190Q30 ± 118.3 ± 0.21.875 ± 2.88.0 ± 0.1> 2509.0 ± 2.59.1 ± 0.70.9
E288G13 ± 6.18.4 ± 0.31.490 ± 6.28.4 ± 0.2> 2508.6 ± 2.59.6 ± 0.80.3
R190Q;E288G0.70 ± 1.48.4 ± 0.51.5NANANA12 ± 2.88.0 ± 0.612.5

Pharmacological data of GIPR variants, R190Q, E288G and the double mutant.

All data were fitted with three-parameter logistic curve to obtain pEC50 and Emax. pEC50 and pIC50 represent the negative logarithm of agonist concentration in molar that produces half the maximal response/inhibition. Bmax is characterized as the maximum specific binding normalized to wild-type GIPR. Emax is characterized as the maximal response normalized to wild-type GIPR. Fmut is the fold change in potency, EC50 and in affinity, KD mutant, between mutants and wildtype receptor, calculated as EC50 mutant/EC50 wildtype and KD mutant/KD wildtype. Data represent the mean ± SEM of at least three independent experiments performed in duplicate. NA, no activation observed.

To determine whether the reduced cAMP formation was due to impaired agonist binding, we performed homologs competition binding, using 125I-GIP(1-42) as radio-ligand for the wildtype plus all three GIPR variants. Both single mutations displayed reduced binding capacity (Bmax) with 30% of the wild-type GIPR for R190Q, and only 13% for E288G, while the double mutant exhibited minimal binding (< 1%) (Figure 1D). The binding affinities (KD) of GIP were, however, not affected substantially as GIP bound with an affinity (KD) of 5.0 nM and 3.9 nM for R190Q and E288G, respectively, while it bound the wild-type GIPR with an affinity of 2.7 nM (Figure 1C).

The Glucose-Dependent Insulinotropic Polypeptide Receptor Variants Display Impaired β-Arrestin 2 Recruitment and Internalization

Due to the maintained binding affinity but lower number of receptors expressed, we next set out to investigate β-arrestin 2 recruitment given its role in the desensitization and internalization of the GIPR (, ). All three variants displayed reduced ability to recruit β-arrestin 2 with an Emax of 9.0% for R190Q, 8.6% for E288G, and 12% for the double mutant compared to wild-type GIPR. There was, however, no major difference with respect to the potencies of the receptors’ ability to recruit β-arrestin 2; R190Q had an EC50 of 0.76 nM while E288G had an EC50 value of 0.23 nM compared to wild-type GIPR with an EC50 of 0.88 nM. The double mutant, however, displayed an EC50-value of 11 nM (Figure 1E). Thus, the overall maintained potency in β-arrestin 2 recruitment but lower Emax corresponded with the binding profiles of the variants.

We then performed real-time internalization experiments to determine whether the reduced β-arrestin recruitment influenced receptor internalization. Here, we used SNAP-tagged versions of the single mutant GIPR variants expressed transiently in HEK293 cells while the double mutant was omitted due to its low expression. Upon transfection with same amount of DNA of either wild-type SNAP-tagged GIPR or SNAP-tagged GIPR mutants, we observed a significantly lower receptor cell surface expression of 60% of wild-type GIPR for both single mutant variants (Figure 1G). This indicates that the reduced binding capacity of GIP to R190Q and E288G could partly be explained by the lower receptor cell surface expression. Since internalization measurements are dependent on receptor expression (), we next titrated receptor concentrations to obtain similar donor signal (i.e., similar cell surface expression) from the SNAP-tag in the different GIPR variants. For similar expression levels, we observed no internalization of either variant receptors (Figure 1F).

Taken together, the molecular pharmacological phenotype of the GIPR variants comprised diminished signaling through Gαs, reduced β-arrestin 2 recruitment and impaired receptor internalization. The affinity of GIP was maintained for the GIPR variants but with lower binding capacity, which could be explained by the lower receptor cell surface expression.

The Glucose-Dependent Insulinotropic Polypeptide Receptor E288G Variant Reduces Bone Mineral Density

Since R190Q (rs139215588) and E288G (rs143430880) diminished receptor activation, we were interested in linking these functional consequences with phenotypes in humans. At first, we searched for the largest genetic studies to gather available results of the two GIPR variants. The present study therefore includes high quality data for R190Q and E288G from these genetic studies, in which we evaluated each GIPR variant separately.

We started our physiological investigation by examining bone mineral density (BMD) and fracture risk in carriers of R190Q and E288G using summary data from a study in UK Biobank with a total sample size of 426,824 individuals (). Interestingly, E288G was associated with lower BMD (Beta –0.056 SD, p-value = 0.002) and R190Q showed similar effect size (–0.057 SD), but this was not statistically significant (Figure 2). None of the two GIPR variants seemed to be associated with an overall risk of bone fracture (Table 2).

FIGURE 2

TABLE 2

TraitR190Q (rs139215588)
E288G (rs143430880)
References
EAFOR95% CIPNEAFOR95% CIPN
Fracture risk0.00141.0010.80–1.250.99426,7950.00190.9950.86–1.150.94426,795
T2D0.00151.190.84–1.690.56298,9570.00170.820.65–1.040.17298,957
T2D, BMI adj.0.00151.300.93–1.810.28298,9570.00170.760.60–0.960.04298,957

EAFZ-scorePNEAFZ-scorePN

Hypertension0.00161.780.07614,2500.00871.710.09548,903

Association of GIPR variants, R190Q and E288G with relevant dichotomous phenotypes.

EAF, effect allele frequency; SE, standard error; P, p-value; N, sample size; OR, odds ratio; BMI adj., body mass index adjusted.

Both Body Mass Index-Lowering Glucose-Dependent Insulinotropic Polypeptide Receptor Variants Show Effects of Cardio-Metabolic Importance

Next, we examined the association with several traits of importance for cardio-metabolic health and disease. First, we evaluated the impact of R190Q and E288G on blood pressure in summary data from a newly published paper of rare genetic variations associating with blood pressure measures, which comprised > 800,000 individuals (). Both GIPR variants were associated with higher systolic blood pressure (R190Q: 0.045 SD; E288G: 0.049 SD), although the diastolic blood pressure was not significantly different between carriers and non-carriers (Figure 2). Furthermore, the E288G variant was associated with higher pulse pressure (Figure 2), while neither of the GIPR variants were associated with increased risk of hypertension (Table 2).

We next examined the lipid profile to gain further insight into how R190Q and E288G with impaired GIPR signaling affected lipid homeostasis. Here we used summary statistics from an exome-chip based meta-analysis of ∼350,000 individuals (). Carriers of R190Q did not have altered lipid levels compared to non-carriers, whereas carriers of E288G had lower high-density lipoprotein (HDL) cholesterol levels (beta = –0.10 SD, p-value = 0.02), yet with no changes in low-density lipoprotein (LDL), triglycerides or total cholesterol (Figure 2). Despite the impact on cardiovascular parameters, neither one of the rare GIPR variants, R190Q and E288G, in the present study associated with overall risk of cardiovascular events as major cause of death (Supplementary Table 2) in summary data for the UK Biobank cohort (N = 452,264) ().

Alterations in circulating leptin levels could be a putative mechanism of body weight regulation, and we therefore evaluated whether the two GIPR variants had altered levels from a genetic study of circulating leptin in early adiposity (N = 57,232) (Yaghootkar et al., 2020). Only R190Q was significantly associated with lowered leptin levels, although this association was lost when adjusting for BMI (Figure 2).

We also explored how the GIPR variants affect risk of T2D in summary data from a study of coding variants in T2D (48,286 cases and 250,671 controls) (). In a model not adjusted for BMI, none of the rare GIPR variants were associated with risk of T2D. In contrast, a BMI-adjusted model showed that carriers of E288G had a decreased risk of T2D compared to non-carriers (OR 0.76, p-value = 0.04) (Table 2).

Both Glucose-Dependent Insulinotropic Polypeptide Receptor Variants Associate With Multiple Adiposity-Related Measures

To further assess how the two GIPR variants, R190Q and E288G, impact adiposity, we evaluated adiposity-related traits using UK Biobank results from the GeneATLAS portal (N = 452,264) (). We found the same direction of association with BMI for R190Q and E288G (Figure 3), however, with a somewhat smaller effect size than previously reported (R190Q: –0.088 SD; E288G: –0.093 SD) (). Interestingly, carriers of either of the two GIPR variants had in general lower values of most adiposity-related measures compared to non-carriers; hence carriers had lower weight (R190Q: –0.091 SD; E288G: –0.092 SD), lower hip circumference (R190Q: –0.11 SD; E288G: –0.12 SD), lower waist circumference (R190Q: –0.056 SD; E288G: –0.063 SD), lower fat percentage (R190Q: –0.062 SD; E288G: –0.052 SD), lower fat mass (R190Q: –0.091 SD; E288G: –0.082 SD) and fat-free body mass (R190Q: –0.057 SD; E288G: –0.057 SD) (Figure 3). Furthermore, both variants were associated with a lower basic metabolic rate (R190Q: –0.064 SD; E288G: –0.063 SD). Despite these findings, none of the GIPR variant carriers significantly decreased risk of obesity (data not shown).

FIGURE 3

Finally, we investigated UK Biobank data by a phenome-wide study. Here, all above-mentioned findings at p-value < 10–4 for both GIPR variants were related to adiposity (Supplementary Tables 3, 4).

Discussion

We show that two naturally occurring rare GIPR variants, R190Q and E288G (rs139215588 and rs143430880, respectively), result in impaired GIPR function at the molecular level which in turn seems to impact human physiology and pathophysiology regarding adiposity, bone health and the cardiovascular system (Figure 4).

FIGURE 4

The prevailing model for ligand-binding and receptor activation of class B1 receptors, including the GIPR, is that the extracellular domain (ECD) of the receptor recognizes the C-terminal of the endogenous peptide hormone that in turn allows the N-terminal part of the ligand to position itself into the transmembrane domain (TMD) (). While several structure models exist for the closely related class B1 receptors, GLP-1R and glucagon receptor (Zhang et al., 2017, 2018), the structural data of the full length human GIPR are scarce, and only few studies have been conducted to describe GIPR residues of importance for receptor activation (Yaqub et al., 2010; ). However, the importance of the R190- and E288 residues for GIP binding and GIPR activation was recently discussed in a study that combined MD simulations and mutagenesis experiments (). Here, it was shown that R190 is an important residue for GIPR activation as the N-terminal part of the GIP was described to form a hydrogen bond with this residue. A similar observation was made earlier by Yaqub et al. (2010) who showed a decrease in cAMP signaling upon agonist binding. Moreover, a recent cryo-EM structure by Zhao et al. (2021) of the human GIPR in complex with GIP and a Gs-heterotrimer confirmed the formation of hydrogen bond between GIP and the R190 residue. The E288 residue appears to have a bigger impact on ligand binding (5.4-fold reduction in affinity and a Bmax of 32% compared to wild-type) than on activation, when substituted with an alanine (). This is in line with the results of the present study, as we also saw a limited maximum binding capacity of 13% in E288Q, as we would expect a mutation to glycine (in E288G) to remove all functionality like alanine does (in E288A). In addition, we also observed a > 250-fold reduction in the GIP potency in G protein signaling for E288Q compared to wild-type GIPR, and supra-physiological GIP levels were needed for near maximum receptor activation. Similar impairment in terms of cAMP production was also published very recently (). We, in addition, found that R190Q and E288G displayed a diminished arrestin recruitment that in return resulted in a lack of receptor internalization, consistent with the previously established arrestin dependency for GIPR internalization (). Altogether, the functional data indicate that both GIPR variants disrupt the conformational changes necessary for receptor activation and arrestin recruitment, and also reduce receptor cell surface expression, while still preserving the binding of GIP.

Circulating GIP is a multi-functional incretin hormone that acts on several targets, among which bone metabolism has been the focus of several recent studies. Rodents that lack GIPR have reduced bone size, bone mass, altered bone microarchitecture- and bone turnover (Xie et al., 2005; ; ). Thus, GIP analogs have been shown to improve bone composition and strength in rodents (; ), while a GIPR antagonist impairs bone remodeling in humans (; ). In the present study, E288G carriers had a significantly lower BMD, yet neither of the two GIPR variants showed a significantly increased overall bone fracture risk, possibly due to low statistical power. The common GIPR variant, E354Q (rs1800437), showed similar effects of lowered BMD along with increased risk of non-vertebral fractures (). However, E354Q shows either a similar or slightly enhanced signaling pattern as wild-type GIPR with an increased rate of receptor internalization, possibly due to a longer residence time of GIP for this mutant (; ; ; ). As a result of decreased recycling of the receptor to the cell surface, this ultimately may result in functional impairment of the GIPR variant, E354Q, thus exhibiting the same phenotypic trait as R190Q and E288G.

Previous studies have already established the importance of the GIP-GIPR axis in glucose regulation. For instance, GIPR-deficient mice showed lower glucose-stimulated insulin levels and higher levels of plasma glucose (), a risk factor for T2D (). In the present study, we found that E288G associated with a 24% decreased risk of T2D, whereas did not detect this protective effect (), perhaps due to the lower sample size in the previous study [N ∼50,000 compared to ∼300,000 individuals (Table 2)]. Several GWAS have identified variants positioned in the GIPR locus, including the E354Q GIPR variant, to associate with increased 2-h glucose levels, decreased insulin secretion, insulin resistance and risk of T2D (; ; ; ), further supporting the importance of the GIP-GIPR axis in glucose regulation.

Regarding the impact on the cardiovascular system, it was previously shown that GIP infusions decreased mean arterial blood pressure and increased resting heart rate (Wice et al., 2012). In fact, GIP infusions decreased diastolic blood pressure and increased heart rate during normoglycemia and hypoglycemia (; ), whereas during hyperglycemia, the systolic blood pressure was increased as well (). In our study, carriers of either GIPR variants had a higher systolic blood pressure and pulse pressure. Since a previous study showed no association between the two GIPR variants and systolic blood pressure (), the higher statistical power of the current study (N ∼700,000; Figure 2) compared to the study by (N ∼135,000) may explain this discrepancy. Taken together, our results establish that GIPR signaling is important for the regulation of blood pressure in a manner dependent on the glycemic state.

Dysregulation of circulating lipids is also a risk factor of cardiovascular diseases. High circulating levels of GIP have shown beneficial effects on the lipid profile in humans (), and treatment with GIPR/GLP-1R co-agonists have shown improvement of the lipid profile in patients with T2D (, ). We found that carriers of E288G had significantly decreased HDL cholesterol levels without effect on other parameters of the lipid profile, suggesting that reduced GIPR signaling is involved in part of the cholesterol and lipid metabolism. These results are consistent with a previous study (), and the GIPR E354Q variant also showed a trend toward decreased HDL levels (). Even though carriers of R190Q and E288G have higher blood pressure and decreased HDL levels, they are not at higher risk of a cardiovascular event, and E354Q only nominally associated with cardiovascular disease (). Thus, reduced GIPR signaling does not seem to have fatal effects on the cardiovascular system, however, it is more likely that this study lacks statistical power to detect an effect on a clinical dichotomous phenotype even though association with a quantitative risk factor is detected. Similarly, we observe an association with BMD, yet no association with risk of fractures. Our observation that carriers of either GIPR variants had lower body fat mass and lean body mass than non-carriers corresponds with a previous association with lower BMI (), and was confirmed recently by whole-exome sequencing (). These results suggest that GIPR signaling contributes to regulation of body weight and body composition, and that reduced GIPR signaling is a potentially beneficial strategy against obesity. In support, obese Gipr knockout mice show lower body weight gain compared to wild-type mice, which may be explained by a lower fat mass, lean tissue mass and food intake, and an increased physical activity in these mice (; Zhang et al., 2021). In the present study, we did not see an increased self-reported physical activity among carriers of R190Q or E288G. Furthermore, no increase was observed for the GIPR variant carriers regarding circulating leptin levels. In a previous study, obese Gipr knockout mice maintained leptin sensitivity compared to obese wild-type mice, and their leptin-induced anorectic effect was not inhibited by GIP infusion (). If same scenario applies for humans, inadequate GIPR signaling, as for R190Q and E288G, may have beneficial effects in treatment of obesity. Further investigation in humans is needed to understand how GIPR signaling affects leptin sensitivity and long-term appetite control.

Although our results together with several studies of anti-GIPR antibodies (; ; ; ; ) could indicate that GIPR antagonists could protect from diet-induced obesity and improve glycemic and insulinotropic effects, other studies have shown the same for GIPR agonists (; ; ). It is therefore still uncertain whether an agonist or an antagonist would be superior for the treatment of obesity. It is also worth noticing that the most prominent anti-obesity effect of GIPR agonists as well as antagonist is accomplished in combination with GLP-1R agonists (, ; ; ) indicating an important interplay between the two incretin hormones and their receptors.

Conclusion

In conclusion, our results suggest that reduced GIPR signaling can have both beneficial and disadvantageous effects on human physiology. Long-term use of GIPR antagonists may be of exceptional benefit in lowering adiposity for treatment of obesity and its comorbidities, such as T2D. In contrast, long-term use of a GIPR antagonist may, to some extent, negatively affect bone metabolism and the cardiovascular system, although the effects seem to be rather small. There are various additional GIPR missense variants detected in the human population, which could be explored for their potential impairment and/or altered signaling properties. This may provide a more complete picture of the physiological impact of GIPR signaling and how to best exploit its therapeutic potential.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Author contributions

HK, KS, MR, and NG: study design, manuscript writing—original draft. HK, MR, AS-U, and CK: functional studies. KS and NG: human genetic studies. AH: structural modeling. HK, KS, LG, AH, NG, and MR: manuscript writing—reviewing and editing. All authors revised the manuscript and approved the final version. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by a scholarship to HK from the Danish Diabetes Academy, which was funded by the Novo Nordisk Foundation (Grant No. NNF17SA0031406) and a grant to MR from EFSD/Lilly European Diabetes Research Programme. KS and NG from The Novo Nordisk Foundation Center for Basic Metabolic Research were funded by an unrestricted donation to the University of Copenhagen by the Novo Nordisk Foundation (Grant No. NNF18CC0034900).

Acknowledgments

We thank colleagues, Maibritt Sigvardt Baggesen for their assistance with performing the functional studies and thank all colleagues for their critical reading of the manuscript.

Conflict of interest

MR was co-founder of Antag Therapeutics and Bainan Biotech. AS-U was co-founder and CEO of Antag Therapeutics. LG was co-founder of Antag Therapeutics. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2021.749607/full#supplementary-material

References

  • 1

    AkbariP.GilaniA.SosinaO.KosmickiJ. A.KhrimianL.FangY.-Y.et al (2021). Sequencing of 640,000 exomes identifies GPR75 variants associated with protection from obesity.Science373:eabf8683. 10.1126/science.abf8683

  • 2

    AlmindK.AmbyeL.UrhammerS. A.HansenT.EchwaldS. M.HolstJ. J.et al (1998). Discovery of amino acid variants in the human glucose-dependent insulinotropic polypeptide (GIP) receptor: the impact on the pancreatic beta cell responses and functional expression studies in Chinese hamster fibroblast cells.Diabetologia411194–1198. 10.1007/s001250051051

  • 3

    AsmarM.ArngrimN.SimonsenL.AsmarA.NordbyP.HolstJ. J.et al (2016). The blunted effect of glucose-dependent insulinotropic polypeptide in subcutaneous abdominal adipose tissue in obese subjects is partly reversed by weight loss.Nutr. Diabetes6:e208. 10.1038/nutd.2016.15

  • 4

    BaggioL. L.DruckerD. J. (2007). Biology of incretins: GLP-1 and GIP.Gastroenterology1322131–2157. 10.1053/j.gastro.2007.03.054

  • 5

    BerlierJ. L.KharroubiI.ZhangJ.Dalla ValleA.RiguttoS.MathieuM.et al (2015). Glucose-Dependent insulinotropic peptide prevents serum deprivation-induced apoptosis in human bone marrow-derived mesenchymal stem cells and osteoblastic cells.Stem Cell Rev. Rep.11841–851. 10.1007/s12015-015-9616-6

  • 6

    BoerG. A.KeenanS. N.MiottoP. M.HolstJ. J.WattM. J. (2021). GIP receptor deletion in mice confers resistance to HFD-induced obesity via alterations in energy expenditure and adipose tissue lipid metabolism.Am. J. Physiol. Endocrinol. Metab.320E835–E845. 10.1152/ajpendo.00646.2020

  • 7

    BollagR. J.ZhongQ.PhillipsP.MinL.ZhongL.CameronR.et al (2000). Osteoblast-derived cells express functional glucose-dependent insulinotropic peptide receptors.Endocrinology1411228–1235. 10.1210/endo.141.3.7366

  • 8

    BunielloA.MacArthurJ. A. L.CerezoM.HarrisL. W.HayhurstJ.MalangoneC.et al (2019). The NHGRI-EBI GWAS Catalog of published genome-wide association studies, targeted arrays and summary statistics 2019.Nucleic Acids Res.47D1005–D1012. 10.1093/nar/gky1120

  • 9

    Canela-XandriO.RawlikK.TenesaA. (2018). An atlas of genetic associations in UK Biobank.Nat. Genet.501593–1599. 10.1038/s41588-018-0248-z

  • 10

    ChenJ.ZhengS.HuY.MouX.WangH. (2021). Chronic treatment with anti-GIPR mAb alone and combined with DPP-4 inhibitor correct obesity, dyslipidemia and nephropathy in rodent animals.Life Sci.269:119038. 10.1016/j.lfs.2021.119038

  • 11

    ChristensenM.CalannaS.Sparre-UlrichA. H.KristensenP. L.RosenkildeM. M.FaberJ.et al (2015). Glucose-dependent insulinotropic polypeptide augments glucagon responses to hypoglycemia in type 1 diabetes.Diabetes6472–78. 10.2337/db14-0440

  • 12

    ChristensenM.VedtofteL.HolstJ. J.VilsbøllT.KnopF. K. (2011). Glucose-dependent insulinotropic polypeptide: a bifunctional glucose-dependent regulator of glucagon and insulin secretion in humans.Diabetes603103–3109. 10.2337/db11-0979

  • 13

    CordomíA.IsmailS.MatsoukasM. T.EscrieutC.GherardiM. J.PardoL.et al (2015). Functional elements of the gastric inhibitory polypeptide receptor: comparison between secretin- and rhodopsin-like G protein-coupled receptors.Biochem. Pharmacol.96237–246. 10.1016/j.bcp.2015.05.015

  • 14

    FortinJ. P.SchroederJ. C.ZhuY.BeinbornM.KopinA. S. (2010). Pharmacological characterization of human incretin receptor missense variants.J. Pharmacol. Exp. Ther.332274–280. 10.1124/jpet.109.160531

  • 15

    FosterS. R.Bräuner-OsborneH. (2018). Investigating internalization and intracellular trafficking of GPCRs: new techniques and real-time experimental approaches.Handb. Exp. Pharmacol.24541–61. 10.1007/164_2017_57

  • 16

    FriasJ. P.BastyrE. J.VignatiL.TschöpM. H.SchmittC.OwenK.et al (2017). The sustained effects of a dual GIP/GLP-1 receptor agonist, NNC0090-2746, in patients with Type 2 diabetes.Cell Metab.26343–352.e2. 10.1016/j.cmet.2017.07.011

  • 17

    FriasJ. P.NauckM. A.VanJ.KutnerM. E.CuiX.BensonC.et al (2018). Efficacy and safety of LY3298176, a novel dual GIP and GLP-1 receptor agonist, in patients with type 2 diabetes: a randomised, placebo-controlled and active comparator-controlled phase 2 trial.Lancet (London, England)3922180–2193. 10.1016/S0140-6736(18)32260-8

  • 18

    GabeM. B. N.Sparre-UlrichA. H.PedersenM. F.GasbjergL. S.InoueA.Bräuner-OsborneH.et al (2018). Human GIP(3-30)NH2 inhibits G protein-dependent as well as G protein-independent signaling and is selective for the GIP receptor with high-affinity binding to primate but not rodent GIP receptors.Biochem. Pharmacol.15097–107. 10.1016/j.bcp.2018.01.040

  • 19

    GabeM. B. N.van der VeldenW. J. C.GadgaardS.SmitF. X.HartmannB.Bräuner-OsborneH.et al (2019). Enhanced agonist residence time, internalization rate and signalling of the GIP receptor variant [E354Q] facilitate receptor desensitization and long-term impairment of the GIP system.Basic Clin. Pharmacol. Toxicol.126(Suppl 6)122–132. 10.1111/bcpt.13289

  • 20

    GabeM. B. N.van der VeldenW. J. C.SmitF. X.GasbjergL. S.RosenkildeM. M. (2020). Molecular interactions of full-length and truncated GIP peptides with the GIP receptor – A comprehensive review.Peptides125:170224. 10.1016/j.peptides.2019.170224

  • 21

    GarberA. J. (2000). The importance of early insulin secretion and its impact on glycaemic regulation.Int. J. Obes. Relat. Metab. Disord.24 Suppl 3S32–S37. 10.1038/sj.ijo.0801423

  • 22

    GasbjergL. S.BariE. J.StensenS.HoeB.LanngA. R.MathiesenD. S.et al (2021). Dose-dependent efficacy of the glucose-dependent insulinotropic polypeptide (GIP) receptor antagonist GIP(3-30)NH2 on GIP actions in humans.Diabetes Obes. Metab.2368–74. 10.1111/dom.14186

  • 23

    GasbjergL. S.BergmannN. C.StensenS.ChristensenM. B.RosenkildeM. M.HolstJ. J.et al (2020a). Evaluation of the incretin effect in humans using GIP and GLP-1 receptor antagonists.Peptides125:170183. 10.1016/j.peptides.2019.170183

  • 24

    GasbjergL. S.HartmannB.ChristensenM. B.LanngA. R.VilsbøllT.JørgensenN. R.et al (2020b). GIP’s effect on bone metabolism is reduced by the selective GIP receptor antagonist GIP(3-30)NH2.Bone130:115079. 10.1016/j.bone.2019.115079

  • 25

    Gaudin-AudrainC.IrwinN.MansurS.FlattP. R.ThorensB.BasléM.et al (2013). Glucose-dependent insulinotropic polypeptide receptor deficiency leads to modifications of trabecular bone volume and quality in mice.Bone53221–230. 10.1016/j.bone.2012.11.039

  • 26

    GaultV. A.IrwinN.GreenB. D.McCluskeyJ. T.GreerB.BaileyC. J.et al (2005). Chemical ablation of gastric inhibitory polypeptide receptor action by daily (Pro3)GIP administration improves glucose tolerance and ameliorates insulin resistance and abnormalities of islet structure in obesity-related diabetes.Diabetes542436–2446. 10.2337/diabetes.54.8.2436

  • 27

    HansenL. S.Sparre-UlrichA. H.ChristensenM.KnopF. K.HartmannB.HolstJ. J.et al (2016). N-terminally and C-terminally truncated forms of glucose-dependent insulinotropic polypeptide are high-affinity competitive antagonists of the human GIP receptor.Br. J. Pharmacol.173826–838. 10.1111/bph.13384

  • 28

    HeimbürgerS. M.BergmannN. C.AugustinR.GasbjergL. S.ChristensenM. B.KnopF. K. (2020). Glucose-dependent insulinotropic polypeptide (GIP) and cardiovascular disease.Peptides125:170174. 10.1016/j.peptides.2019.170174

  • 29

    HelstedM. M.GasbjergL. S.LanngA. R.BergmannN. C.StensenS.HartmannB.et al (2020). The role of endogenous GIP and GLP-1 in postprandial bone homeostasis.Bone140:115553. 10.1016/j.bone.2020.115553

  • 30

    HolstJ. J. (2019). The incretin system in healthy humans: the role of GIP and GLP-1.Metabolism9646–55. 10.1016/j.metabol.2019.04.014

  • 31

    HolstJ. J.RosenkildeM. M. (2020). GIP as a therapeutic target in diabetes and obesity: insight from incretin co-agonists.J. Clin. Endocrinol. Metab.105e2710–e2716. 10.1210/clinem/dgaa327

  • 32

    HuC.ZhangR.WangC.WangJ.MaX.HouX.et al (2010). Variants from GIPR, TCF7L2, DGKB, MADD, CRY2, GLIS3, PROX1, SLC30A8 and IGF1 are associated with glucose metabolism in the Chinese.PLoS One5:e15542. 10.1371/journal.pone.0015542

  • 33

    JensenP. C.ThieleS.UlvenT.SchwartzT. W.RosenkildeM. M. (2008). Positive versus negative modulation of different endogenous chemokines for CC-chemokine receptor 1 by small molecule agonists through allosteric versus orthosteric binding.J. Biol. Chem.28323121–23128. 10.1074/jbc.M803458200

  • 34

    KanekoK.FuY.LinH.-Y.CordonierE. L.MoQ.GaoY.et al (2019). Gut-derived GIP activates central Rap1 to impair neural leptin sensitivity during overnutrition.J. Clin. Invest.1293786–3791. 10.1172/JCI126107

  • 35

    KarczewskiK. J.FrancioliL. C.TiaoG.CummingsB. B.AlföldiJ.WangQ.et al (2020). The mutational constraint spectrum quantified from variation in 141,456 humans.Nature581434–443. 10.1038/s41586-020-2308-7

  • 36

    KillionE. A.ChenM.FalseyJ. R.SivitsG.HagerT.AtanganL.et al (2020). Chronic glucose-dependent insulinotropic polypeptide receptor (GIPR) agonism desensitizes adipocyte GIPR activity mimicking functional GIPR antagonism.Nat. Commun.11:4981. 10.1038/s41467-020-18751-8

  • 37

    KillionE. A.WangJ.YieJ.ShiS. D.-H.BatesD.MinX.et al (2018). Anti-obesity effects of GIPR antagonists alone and in combination with GLP-1R agonists in preclinical models.Sci. Transl. Med.10:eaat3392. 10.1126/scitranslmed.aat3392

  • 38

    KubotaA.YamadaY.HayamiT.YasudaK.SomeyaY.IharaY.et al (1996). Identification of two missense mutations in the GIP receptor gene: a functional study and association analysis with NIDDM: no evidence of association with Japanese NIDDM subjects.Diabetes451701–1705. 10.2337/diab.45.12.1701

  • 39

    LuX.PelosoG. M.LiuD. J.WuY.ZhangH.ZhouW.et al (2017). Exome chip meta-analysis identifies novel loci and East Asian-specific coding variants that contribute to lipid levels and coronary artery disease.Nat. Genet.491722–1730. 10.1038/ng.3978

  • 40

    MabilleauG.MieczkowskaA.IrwinN.SimonY.AudranM.FlattP. R.et al (2014). Beneficial effects of a N-terminally modified GIP agonist on tissue-level bone material properties.Bone6361–68. 10.1016/j.bone.2014.02.013

  • 41

    MahajanA.WesselJ.WillemsS. M.ZhaoW.RobertsonN. R.ChuA. Y.et al (2018). Refining the accuracy of validated target identification through coding variant fine-mapping in type 2 diabetes.Nat. Genet.50559–571. 10.1038/s41588-018-0084-1

  • 42

    MieczkowskaA.IrwinN.FlattP. R.ChappardD.MabilleauG. (2013). Glucose-dependent insulinotropic polypeptide (GIP) receptor deletion leads to reduced bone strength and quality.Bone56337–342. 10.1016/j.bone.2013.07.003

  • 43

    MinX.YieJ.WangJ.ChungB. C.HuangC. S.XuH.et al (2020). Molecular mechanism of an antagonistic antibody against glucose-dependent insulinotropic polypeptide receptor.MAbs121–12. 10.1080/19420862.2019.1710047

  • 44

    MiyawakiK.YamadaY.YanoH.NiwaH.BanN.IharaY.et al (1999). Glucose intolerance caused by a defect in the entero-insular axis: a study in gastric inhibitory polypeptide receptor knockout mice.Proc. Natl. Acad. Sci. U.S.A.9614843–14847. 10.1073/pnas.96.26.14843

  • 45

    MohammadS.PatelR. T.BrunoJ.PanhwarM. S.WenJ.McGrawT. E. (2014). A naturally occurring GIP receptor variant undergoes enhanced agonist-induced desensitization, which impairs GIP control of adipose insulin sensitivity.Mol. Cell. Biol.343618–3629. 10.1128/MCB.00256-14

  • 46

    MøllerC. L.VistisenD.FærchK.JohansenN. B.WitteD. R.JonssonA.et al (2016). Glucose-Dependent insulinotropic polypeptide is associated with lower low-density lipoprotein but unhealthy fat distribution, independent of insulin: the ADDITION-PRO study.J. Clin. Endocrinol. Metab.101485–493. 10.1210/jc.2015-3133

  • 47

    MorrisJ. A.KempJ. P.YoultenS. E.LaurentL.LoganJ. G.ChaiR. C.et al (2019). An atlas of genetic influences on osteoporosis in humans and mice.Nat. Genet.51258–266. 10.1038/s41588-018-0302-x

  • 48

    MrozP. A.FinanB.GelfanovV.YangB.TschöpM. H.DiMarchiR. D.et al (2019). Optimized GIP analogs promote body weight lowering in mice through GIPR agonism not antagonism.Mol. Metab.2051–62. 10.1016/j.molmet.2018.12.001

  • 49

    Myocardial Infarction Genetics and CARDIoGRAM Exome Consortia Investigators, StitzielN. O.StirrupsK. E.MascaN. G. D.ErdmannJ.FerrarioP. G.et al (2016). Coding variation in ANGPTL4, LPL, and SVEP1 and the risk of coronary disease.N. Engl. J. Med.3741134–1144. 10.1056/NEJMoa1507652

  • 50

    NelsonC. P.GoelA.ButterworthA. S.KanoniS.WebbT. R.MarouliE.et al (2017). Association analyses based on false discovery rate implicate new loci for coronary artery disease.Nat. Genet.491385–1391. 10.1038/ng.3913

  • 51

    NitzI.FisherE.WeikertC.BurwinkelB.LiY.MöhligM.et al (2007). Association analyses of GIP and GIPR polymorphisms with traits of the metabolic syndrome.Mol. Nutr. Food Res.511046–1052. 10.1002/mnfr.200700048

  • 52

    NørregaardP. K.DeryabinaM. A.Tofteng SheltonP.FogJ. U.DaugaardJ. R.ErikssonP.-O.et al (2018). A novel GIP analogue, ZP4165, enhances glucagon-like peptide-1-induced body weight loss and improves glycaemic control in rodents.Diabetes. Obes. Metab.2060–68. 10.1111/dom.13034

  • 53

    SammsR. J.SloopK. W.GribbleF. M.ReimannF.AdriaenssensA. E. (2021). GIPR function in the central nervous system: implications and novel perspectives for GIP-based therapies in treating metabolic disorders.Diabetes701938–1944. 10.2337/dbi21-0002

  • 54

    SauberJ.GrotheJ.BehmM.ScheragA.GrallertH.IlligT.et al (2010). Association of variants in gastric inhibitory polypeptide receptor gene with impaired glucose homeostasis in obese children and adolescents from Berlin.Eur. J. Endocrinol.163259–264. 10.1530/EJE-10-0444

  • 55

    SaxenaR.HivertM. F.LangenbergC.TanakaT.PankowJ. S.VollenweiderP.et al (2010). Genetic variation in GIPR influences the glucose and insulin responses to an oral glucose challenge.Nat. Genet.42142–148. 10.1038/ng.521

  • 56

    SchwartzT. W.FrimurerT. M. (2017). Structural biology: full monty of family B GPCRs.Nat. Chem. Biol.13819–821. 10.1038/nchembio.2438

  • 57

    Skov-JeppesenK.HeppN.OekeJ.HansenM. S.JafariA.SvaneM. S.et al (2021). The antiresorptive effect of GIP, but not GLP-2, is preserved in patients with hypoparathyroidism—a randomized crossover study.J. Bone Miner. Res.361448–1458. 10.1002/jbmr.4308

  • 58

    Skov-JeppesenK.SvaneM. S.MartinussenC.GabeM. B. N.GasbjergL. S.VeedfaldS.et al (2019). GLP-2 and GIP exert separate effects on bone turnover: a randomized, placebo-controlled, crossover study in healthy young men.Bone125178–185. 10.1016/j.bone.2019.05.014

  • 59

    SmitF. X.van der VeldenW. J. C.KizilkayaH. S.NørskovA.LückmannM.HansenT. N.et al (2021). Investigating GIPR (ant)agonism: a structural analysis of GIP and its receptor.Structure29679–693.e6. 10.1016/j.str.2021.04.001

  • 60

    SonneD. P.RehfeldJ. F.HolstJ. J.VilsbøllT.KnopF. K. (2014). Postprandial gallbladder emptying in patients with type 2 diabetes: potential implications for bile-induced secretion of glucagon-like peptide 1.Eur. J. Endocrinol.171407–419. 10.1530/EJE-14-0309

  • 61

    SpeliotesE. K.WillerC. J.BerndtS. I.MondaK. L.ThorleifssonG.JacksonA. U.et al (2010). Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index.Nat. Genet.42937–948. 10.1038/ng.686

  • 62

    SurendranP.FeofanovaE. V.LahrouchiN.NtallaI.KarthikeyanS.CookJ.et al (2020). Discovery of rare variants associated with blood pressure regulation through meta-analysis of 1.3 million individuals.Nat. Genet.521314–1332. 10.1038/s41588-020-00713-x

  • 63

    SvendsenB.CapozziM. E.NuiJ.HannouS. A.FinanB.NaylorJ.et al (2020). Pharmacological antagonism of the incretin system protects against diet-induced obesity.Mol. Metab.3244–55. 10.1016/j.molmet.2019.11.018

  • 64

    TorekovS. S.HarsløfT.RejnmarkL.EikenP.JensenJ. B.HermanA. P.et al (2014). A functional amino acid substitution in the glucose-dependent insulinotropic polypeptide receptor (GIPR) gene is associated with lower bone mineral density and increased fracture risk.J. Clin. Endocrinol. Metab.99729–733. 10.1210/jc.2013-3766

  • 65

    TsukiyamaK.YamadaY.YamadaC.HaradaN.KawasakiY.OguraM.et al (2006). Gastric inhibitory polypeptide as an endogenous factor promoting new bone formation after food ingestion.Mol. Endocrinol.201644–1651. 10.1210/me.2005-0187

  • 66

    TurcotV.LuY.HighlandH. M.SchurmannC.JusticeA. E.FineR. S.et al (2018). Protein-altering variants associated with body mass index implicate pathways that control energy intake and expenditure in obesity.Nat. Genet.5026–35. 10.1038/s41588-017-0011-x

  • 67

    VogelC. I. G.ScheragA.BrönnerG.NguyenT. T.WangH. J.GrallertH.et al (2009). Gastric inhibitory polypeptide receptor: association analyses for obesity of several polymorphisms in large study groups.BMC Med. Genet.10:19. 10.1186/1471-2350-10-19

  • 68

    VyavahareS. S.MieczkowskaA.FlattP. R.ChappardD.IrwinN.MabilleauG. (2020). GIP analogues augment bone strength by modulating bone composition in diet-induced obesity in mice.Peptides125:170207. 10.1016/j.peptides.2019.170207

  • 69

    WiceB. M.ReedsD. N.TranH. D.CrimminsD. L.PattersonB. W.DunaiJ.et al (2012). Xenin-25 amplifies GIP-mediated insulin secretion in humans with normal and impaired glucose tolerance but not type 2 diabetes.Diabetes611793–1800. 10.2337/db11-1451

  • 70

    WoottenD.SimmsJ.MillerL. J.ChristopoulosA.SextonP. M. (2013). Polar transmembrane interactions drive formation of ligand-specific and signal pathway-biased family B G protein-coupled receptor conformations.Proc. Natl. Acad. Sci. U.S.A1105211–5216. 10.1073/pnas.1221585110

  • 71

    XieD.ChengH.HamrickM.ZhongQ.DingK. H.CorreaD.et al (2005). Glucose-dependent insulinotropic polypeptide receptor knockout mice have altered bone turnover.Bone37759–769. 10.1016/j.bone.2005.06.021

  • 72

    YaghootkarH.ZhangY.SpracklenC. N.KaraderiT.HuangL. O.BradfieldJ.et al (2020). Genetic studies of leptin concentrations implicate leptin in the regulation of early adiposity.Diabetes692806–2818. 10.2337/db20-0070

  • 73

    YaqubT.TikhonovaI. G.LättigJ.MagnanR.LavalM.EscrieutC.et al (2010). Identification of determinants of glucose-dependent insulinotropic polypeptide receptor that interact with N-terminal biologically active region of the natural ligand.Mol. Pharmacol.77547–558. 10.1124/mol.109.060111

  • 74

    ZhangH.QiaoA.YangL.Van EpsN.FrederiksenK. S.YangD.et al (2018). Structure of the glucagon receptor in complex with a glucagon analogue.Nature553106–110. 10.1038/nature25153

  • 75

    ZhangQ.DelessaC. T.AugustinR.BakhtiM.ColldénG.DruckerD. J.et al (2021). The glucose-dependent insulinotropic polypeptide (GIP) regulates body weight and food intake via CNS-GIPR signaling.Cell Metab.33833–844.e5. 10.1016/j.cmet.2021.01.015

  • 76

    ZhangY.SunB.FengD.HuH.ChuM.QuQ.et al (2017). Cryo-EM structure of the activated GLP-1 receptor in complex with a G protein.Nature546248–253. 10.1038/nature22394

  • 77

    ZhaoF.ZhangC.ZhouQ.HangK.ZouX.ChenY.et al (2021). Structural insights into hormone recognition by the human glucose-dependent insulinotropic polypeptide receptor.Elife10:e68719. 10.7554/eLife.68719.sa2

  • 78

    ZhongQ.ItokawaT.SridharS.DingK.-H.XieD.KangB.et al (2007). Effects of glucose-dependent insulinotropic peptide on osteoclast function.Am. J. Physiol. Endocrinol. Metab.292E543–E548. 10.1152/ajpendo.00364.2006

Summary

Keywords

glucose-dependent insulinotropic polypeptide receptor (GIPR), single nucleotide variants (SNVs), altered receptor signaling and internalization, gut-bone axis, bone mineral density, type 2 diabetes and adiposity, blood pressure, lipids

Citation

Kizilkaya HS, Sørensen KV, Kibsgaard CJ, Gasbjerg LS, Hauser AS, Sparre-Ulrich AH, Grarup N and Rosenkilde MM (2021) Loss of Function Glucose-Dependent Insulinotropic Polypeptide Receptor Variants Are Associated With Alterations in BMI, Bone Strength and Cardiovascular Outcomes. Front. Cell Dev. Biol. 9:749607. doi: 10.3389/fcell.2021.749607

Received

29 July 2021

Accepted

16 September 2021

Published

25 October 2021

Volume

9 - 2021

Edited by

Sameer Mohammad, King Abdullah International Medical Research Center (KAIMRC), Saudi Arabia

Reviewed by

Giulia Baldini, University of Arkansas for Medical Sciences, United States; Nigel Irwin, Ulster University, United Kingdom

Updates

Copyright

*Correspondence: Niels Grarup, Mette M. Rosenkilde,

†These authors have contributed equally to this work and share first authorship

‡These authors have contributed equally to this work and share last authorship

This article was submitted to Signaling, a section of the journal Frontiers in Cell and Developmental Biology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics