Abstract
Septins are cytoskeletal proteins that can assemble to form heteromeric filamentous complexes and regulate a range of membrane-associated cellular functions. SEPT7, a member of the septin family, functions as a negative regulator of the plasma membrane–localized store-operated Ca2+ entry (SOCE) channel, Orai in Drosophila neurons, and in human neural progenitor cells. Knockdown of STIM, a Ca2+ sensor in the endoplasmic reticulum (ER) and an integral component of SOCE, leads to flight deficits in Drosophila that can be rescued by partial loss of SEPT7 in neurons. Here, we tested the effect of reducing and removing SEPT7 in mouse Purkinje neurons (PNs) with the loss of STIM1. Mice with the complete knockout of STIM1 in PNs exhibit several age-dependent changes. These include altered gene expression in PNs, which correlates with increased synapses between climbing fiber (CF) axons and Purkinje neuron (PN) dendrites and a reduced ability to learn a motor coordination task. Removal of either one or two copies of the SEPT7 gene in STIM1KO PNs restored the expression of a subset of genes, including several in the category of neuron projection development. Importantly, the rescue of gene expression in these animals is accompanied by normal CF-PN innervation and an improved ability to learn a motor coordination task in aging mice. Thus, the loss of SEPT7 in PNs further modulates cerebellar circuit function in STIM1KO animals. Our findings are relevant in the context of identifying SEPT7 as a putative therapeutic target for various neurodegenerative diseases caused by reduced intracellular Ca2+ signaling.
Introduction
Septins (SEPT) constitute a family of filament-forming GTPases that can assemble into hetero-oligomeric complexes in cells and regulate various cellular functions such as cytokinesis (Kinoshita et al., 1997; Gladfelter et al., 2001; Kinoshita and Noda, 2001), cell polarity determination and maintenance (; ; Irazoqui and Lew, 2004), microtubule and actin dynamics (Kinoshita et al., 1997; ; Surka et al., 2002; Nagata et al., 2003), membrane associations, cell movement (), vesicle trafficking (Hsu et al., 1998), and exocytosis (). There are thirteen septin-encoding genes in mice and humans that can be classified into four different subgroups based primarily on sequence homology. The subgroups are SEPT2 consisting of SEPT1, 2, 4, and 5; SEPT3 consisting of SEPT3, 9, and 12; SEPT6 consisting of SEPT6, 8, 10, 11, and 14; and SEPT7 which is encoded by a single gene (Kartmann & Roth, 2001; Macara et al., 2002; Kinoshita, 2003; Pan et al., 2014; Soroor et al., 2021). Functionally, septins from each subgroup occupy distinct positions in septin heteromers that can in turn assemble to form higher order septin filaments and structures (Sirajuddin et al., 2007; Mendonça et al., 2019; Soroor et al., 2021).
Regulation of cellular Ca2+ signaling by septins was first demonstrated in an siRNA screen in HeLa cells that identified mammalian septins of the SEPT2 class (SEPT2/4/5) as positive regulators of STIM/Orai-mediated store-operated Ca2+ entry (SOCE) (Sharma et al., 2013) and is further supported by recent studies (). Unlike the SEPT2 subclass, a mutant for the single SEPT7 gene in Drosophila was found to function as a negative regulator of SOCE. Heterozygotes of the Drosophila SEPT7 mutant could rescue cellular and systemic phenotypes associated with neuronal knockdown of the SOCE molecules STIM/Orai in adult Drosophila. Subsequent genetic and cellular studies support the idea that SEPT7 function in human stem cell–derived neural precursors and differentiated neurons is similar to Drosophila. In both human neuronal cells and Drosophila neurons, SEPT7 orthologs prevent spontaneous Ca2+ entry through the SOCE channel, Orai (; ).
Altered intracellular Ca2+ signaling has been associated with several neurodegenerative disorders in mouse models and in humans (Street et al., 1997; ; Van De Leemput et al., 2007; Klejman et al., 2009; Sun et al., 2014; Zhou et al., 2016; Klar et al., 2017; ; ). For example, mutations in a gene encoding the ER-Ca2+ release channel IP3R1 in humans are associated with spinocerebellar ataxias 15 and 29 (SCA 15 and 29), leading to cerebellar atrophy with the loss of Purkinje neurons and resulting in impaired coordination of movements (Hasan and Sharma, 2020). Loss of the gene encoding the ER-Ca2+ sensor STIM1 in mouse cerebellar Purkinje neurons affects their intrinsic excitability (Ryu et al., 2017), mGluR1-dependent synaptic transmission along with age-dependent changes that include a reduced ability to learn a motor coordination task (Hartmann et al., 2014), and changes in synaptic connectivity and gene expression (). Interestingly, in a mouse model of familial Alzheimer’s disease, raising SOCE by overexpressing STIM2 rescued loss of mushroom spines in hippocampal neurons (Sun et al., 2014). These findings suggest that restoring intracellular Ca2+ homeostasis by modulating SOCE in the initial stages of neurodegenerative disease conditions could be a therapeutic strategy for the treatment of these neurodegenerative disorders. In this study, we investigated the cellular and behavioral effects of reducing SEPT7 and thus increasing spontaneous Ca2+ entry through SOCE channels, in mice with loss of STIM1 in Purkinje neurons.
Materials and Methods
Animals
All experimental procedures were conducted in accordance with the Institutional Animal Ethics Committee which is approved by the Control and Supervision of Experiments on Animals (CPCSEA), New Delhi, India. All transgenic mice used for the experiments were bred and maintained in the NCBS Animal Facility, Bangalore, India. The conditional Cre-lox system (Nagy, 2000; Kim et al., 2018) was used to generate a double knockout compound mouse strain with deletion of STIM1 and SEPT7 together in Purkinje neurons. Mice were obtained where loxP sites flanked the EF hand of the STIM1 gene encoded by exon 2 (STIM1 flox; Oh-hora et al., 2008) and the GTP-binding P-loop of the SEPT7 gene encoded by exon 4 (SEPT7 flox;Menon et al., 2014). Pcp2 Cre mice [B6.129-Tg (Pcp2-cre) 2Mpin/J-The Jacksons Laboratory, RRID: IMSR_JAX: 004146 ()] that express Cre under the control of the PCP2 promoter, thus allowing Cre-mediated recombination exclusively in the Purkinje neurons, were used for the experiment. Triple transgenic mice, STIM1flox/flox; SEPT7flox/flox; PCP2Cre/+ (STIM1PKO; SEPT7PKO), were generated by crossing the homozygous double transgenic STIM1flox/flox; SEPT7flox/flox with STIM1flox/+; PCP2-Crecre/+ mice. Mice heterozygous for the SEPT7 floxed and homozygous for the STIM1 floxed allele with PCP2 (L7)-Cre are referred to as STIM1PKO; SEPT7PHet (STIM1flox/flox; SEPT7flox/+; PCP2-Crecre/+). Double transgenic mice, STIM1flox/flox; SEPT7flox/+ and STIM1flox/flox; SEPT7flox/flox, were used as controls for heterozygous and homozygous SEPT7 knockout strains, respectively. The offspring obtained were further genotyped by PCR of genomic DNA extracted from tail clippings. Primer pairs used to detect the wild-type STIM1 gene (348 bp) and the floxed STIM1 gene (399 bp) are from Oh-hora et al. (2008) and are given in Table 1. Primers used to detect the presence or absence of Cre are listed in Table 1, and the presence of the Cre transgene was determined by observing a product length of 421 bp (Hartmann et al., 2014). The wild-type SEPT7 gene and the floxed SEPT7 gene were confirmed using the primer pairs shown in Table 1. The product length for the wild-type SEPT7 gene is 151 bp, whereas the product length for the floxed SEPT7 gene is 197 bp (Menon et al., 2014).
TABLE 1
| Gene | Forward (5′>3′) | Reverse (5′>3′) |
|---|---|---|
| Stim1 (DNA) | CGATGGTCTCACGGTCTCTAGTTTC | GGCTCTGCTGACCTGGAACTATAGTG |
| Cre (DNA) | GCCGAAATTGCCAGGATCAG | AGCCACCAGCTTGCATGATC |
| SEPT7 (DNA) | CTTTGCACATATGACTAAGC | GGTATAGGGGACTTTGGGG |
| Pcp2 | CCAGGCCAGAACCCAGAAAG | CCCAGGTCGTTTCTGCATTC |
| Stim1 | ACAACTGGACTGTGGATGAGG | TGGTTACTGCTAGCCTTGGC |
| Gabra6 | TGCTGGAAGGCTATGACAACC | GTCTGGCGGAAGAAAACATCC |
| Pvalb | ATGGGGACGGCAAGATTGG | GCGAGAAGGACTGAGATGGG |
| Calm1 | CGTTCTTCCTTCCTTCGCTCG | TTCCTTGGTTGTGATGGTGCC |
| Dlg4 | ACCAAGATGAAGACACGCCC | TTCCGTTCACATATCCTGGGG |
| Robo2 | CTGCCATCTAGACCTGACTCC | ACGAGATCCTTGACCTTGCC |
| Map4 | AGCCAGGTTGAAGGTATCCC | TGGCTGCTCTGATAATCCGG |
| Gigyf2 | GGACCGCAGTGTTAAAAAGACC | TCTGCTGCCATTCTTCTCCG |
| Atp1a3 | CTGCCGACATGATTCTGCTGG | AGGAAGGGTGTGATCTCAGGG |
| Itpr1 | TGAAGGGGAACAGAACGAGC | AGGCCGATTCTTTGTTTCTGC |
| Orai3 | CCTGTGGCCTGGTTTTTATC | GTGCCCGGTGTTAGAGAATG |
| Casq2 | AGCCCAACGTCATCCCTAAC | AGTCGTCTTCTCCTGTAGTCC |
| S100b | GATGTCTTCCACCAGTACTCCG | AGCGTCTCCATCACTTTGTCC |
| Cacng5 | CTTCCTGTGATGTGAGGGCG | CAAAAGTTGGAGTCGAGCGC |
| Kctd17 | GGCTCCTCCTACAACTATGGG | GGAGGGAGAAAAGGTTAGCGG |
| Vamp1 | CCCGTCTCGTTGCATTCTCC | GTCATGTTGGGAGGAGGACC |
| Syt11 | CAAGAGGAACATTCAGAAGTGC | CCTGAGAGACCGGTGATATCC |
| Setd6 | TGGTTTTGCTGAGCCCTATCC | CCCCTACCATCTCCTGTTTGC |
| Gapdh | CTTTGGCATTGTGGAAGGGC | TGCAGGGATGATGTTCTGGG |
Primers used for genotyping transgenic mice and for quantitative real-time PCR.
Sequences of primers used for standard PCR for genotyping transgenic mice and for quantitative real-time PCR for all sets of genes are listed in the table. Standard PCR is carried out on genomic DNA extracted from tail clippings of transgenic mice. The PCR product length of the wild-type STIM1 gene and the floxed STIM1 gene are 348 bp and 399 bp, respectively (Oh-hora et al., 2008). The presence of Cre is identified by a PCR product length of 421 bp (Hartmann et al., 2014). The wild-type SEPT7 gene and the floxed SEPT7 gene were confirmed by PCR product lengths of 151 bp and 197 bp, respectively (Menon et al., 2014). All primers used for qPCR were designed using primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Pcp2, Purkinje cell protein 2; Stim1, stromal interaction molecule 1; Gabra6, gamma-aminobutyric acid type A receptor subunit alpha 6). Pvalb, parvalbumin; Calm1,calmodulin 1; Dlg4, discs large homolog 4; Robo2, roundabout guidance receptor 2; Map4, microtubule-associated protein 4; Gigyf2, GRB10-interacting GYF protein 2; Atp1a3, Na+/K+-ATPase transporting subunit alpha 3; Itpr1, inositol 1,4,5-trisphosphate receptor 1, Orai3—Orai3; Casq2, calsequestrin 2, S100b—S100B; Cacng5, calcium voltage-gated channel auxiliary subunit gamma 5; Kctd17, potassium channel tetramerization domain containing 17; Vamp1, vesicle-associated membrane protein 1; Syt11, synaptotagmin 11; Setd6, SET domain containing 6; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.
Microdissection and RNA Isolation
Sagittal cerebellar sections of about 250 µm thickness were obtained from mice aged 1 year using a vibratome (Leica, VT1200) and following isoflurane anesthesia and decapitation. The slices were sectioned in ice-cold cutting solution that contains the following reagents (in mM): 87 NaCl, 2.5 KCl, 0.5 CaCl2, 7 MgCl2, 1.25 NaH2PO4, 26 NaHCO3, 75 sucrose, and 10 glucose, bubbled with 95% O2 and 5% CO2. Cerebellar slices were then microdissected into Purkinje neuronal and molecular layer (PNL + ML) that was separated from the granular neuronal layer (GNL) with white matter under an illuminated stereomicroscope (Ryu et al., 2017).
RNA was isolated from PNL with ML and GNL with white matter using TRIzol according to the manufacturer’s protocol. Microdissected tissue was homogenized in 500 μl TRIzol (Invitrogen Cat# 15596026) using a micropestle homogenizer, and the samples were vortexed prior to proceeding with the RNA isolation protocol. Isolated RNA was analyzed by a NanoDrop spectrophotometer (Thermo Scientific) to check for its purity, followed by running it on a 1% Tris–EDTA agarose gel to check its integrity. For cDNA synthesis, approximately 500 ng of total RNA isolated was used per sample. DNase treatment was carried out with a reaction volume of 22.1 µl containing 500 ng of isolated RNA, 1 mM DTT, 0.5 U of DNase I (amplification grade), and 20 U of RNase inhibitor (RNase OUT) which was incubated at 37°C for 30 min, followed by heat inactivation at 70°C for 10 min. DNase-treated samples were further subjected to cDNA synthesis with 200 U of Moloney murine leukemia virus reverse transcriptase, 1 mM deoxyribonucleotide triphosphate, and 50 µM random hexamers in a final volume of 20 µl. The reaction mixture was then incubated at 25°C for 10 min, followed by treatment at 42°C for 60 min, and finally heat inactivation at 70°C for 10 min. All reagents used for this experiment were purchased from Invitrogen (Life Technologies).
Real-Time Quantitative PCRs
Real-time quantitative PCRs (qPCRs) were performed with the KAPA SYBR FAST qPCR kit (Sigma-Aldrich Cat# KK4601) in a total volume of 10 μl on an ABI 7500 Fast machine (Applied Biosystems) which is operated with ABI 7500 software version 2. Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) was used to design primers. Sequences of primers for all set of genes are listed in Table 1. The fold change of gene expression levels in experimental conditions relative to control was normalized according to the 2−ΔΔCt method, where ΔΔCt = [(Ct (target gene)—Ct (GAPDH)] Expt.—[(Ct (target gene)—Ct (GAPDH)] control. GAPDH was used as a housekeeping gene.
Immunohistochemistry
Mice were anesthetized and then transcardially perfused with 1X PBS, followed by perfusion with 4% PFA in 1X PBS. Brains were harvested following perfusion and postfixed with 4% PFA overnight, followed by cryoprotection in 30% sucrose in 1X PBS. The fixed cerebellum was then embedded in 5% low melting agar and sliced using a vibratome into 35-µm-thin sections. The cerebellar sections were washed in 1X PBS, blocked for 1 h at 4°C in 0.1% Triton X-100 and 5% normal goat serum, and stained with antibodies overnight at 4°C against guinea pig anti-VGLUT2 (1:1,000; Synaptic Systems Cat# 135 404, RRID: AB_887884). The sections were then washed in PBS-T (0.1% Triton X-100 in 1X PBS) thrice and incubated with secondary antibody goat anti-guinea pig which is coupled to Alexa Fluor 488 (Invitrogen Cat# A-11073, RRID: AB_2534117) for 1 h at room temperature. The slices were then washed in 1X PBS, mounted in Vectashield medium (Vector Labs, Cat#: H-1000), and imaged using an Olympus confocal microscope FV3000 with FV31S-SW 2.1 viewer software.
Confocal Imaging and Image Analysis
Confocal images were captured using a confocal laser microscope (Olympus FV3000 laser scanning confocal microscope) with a 40X objective (PlanApo, NA 1.0; Olympus oil-immersion). Confocal images were acquired at 1.0-µm-thickness intervals with the frame size of 512 × 512 pixels. For estimation of VGLUT2 puncta along PC dendrites at proximal ends, Imaris software (Bitplane, v 9.1.2) was used (Kaneko et al., 2011). The Filament Tracer software (Auto Depth) of Imaris was used to trace each dendritic filament setting the largest diameter threshold at 3 µm and the smallest diameter at 1.86 µm. To quantify VGLUT2 puncta along Purkinje neuron dendrites, spot detection in Imaris software was used by setting the spot diameter threshold as 2 µm and the total distance close to the filament as 3 µm for proximal dendrites.
Rotarod Test
The rotarod assay was performed by first habituating mice to a rotarod (IITC, model# 775, Series 8 Software) by providing a short training session where they were subjected to a constant speed of 5 rpm for 400 s. The mice were then tested for four trials a day for 5 days consecutively. Each session began from 5 rpm and finally attained 45 rpm, with a ramp speed at 240 s (Hartmann et al., 2014). The velocity of rotation was thus increased, keeping a constant acceleration of 9 rpm/min. The time at which each mouse fell off the rotarod was recorded for each session, and the mean latency on the rod was then calculated for all four trials for each mouse across 5 days of sessions.
Statistical Analysis
Statistical analysis was performed using GraphPad Prism 7.0 or Origin 8.0 software. The statistical methods used in each experiment are mentioned in the figure legends. All bar graphs indicate means and standard error of means, and statistical significance was defined as p < 0.05 (*), highly significant for p < 0.01 (**) and p < 0.001 (***) as determined using paired Student’s t-test or one-way analysis of variance (ANOVA). In case of the rotarod test, two-way ANOVA, followed by Tukey’s multiple comparison test, was adopted for comparisons between groups.
Results
Generation of STIM1-SEPT7 Double Knockout Mice
To understand if negative regulation of store-operated Ca2+ entry (SOCE) by SEPT7 is conserved among murine models and to investigate if motor deficits observed in STIM1 knockout (STIM1PKO) mice (Hartmann et al., 2014; ) could be rescued by altering SEPT7 levels, we generated Purkinje neuron (PN)–specific compound STIM1-SEPT7 double knockout mice strains using the conditional Cre-lox system (Figures 1A,B and methods). Exon 4, which encodes the GTP-binding P-loop of SEPT7, and exon 2, which encodes the EF hand of STIM1, were deleted in the progeny that included a PCP2 (L7)-Cre transgene as judged by the size of DNA fragments from appropriate PCRs from genomic DNA (Figure 1C and methods). Mice homozygous for the SEPT7 floxed and STIM1 floxed allele along with PCP2 (L7)-Cre are referred to as STIM1PKO; SEPT7PKO [STIM1flox/flox; SEPT7flox/flox; PCP2 (L7)-Crecre/+, Figures 1B,C]. Mice heterozygous for the SEPT7 floxed and homozygous for the STIM1 floxed allele with PCP2 (L7)-Cre are referred to as STIM1PKO; SEPT7PHet (STIM1flox/flox; SEPT7flox/+; PCP2-Crecre/+, Figure 1C). STIM1flox/flox; SEPT7flox/flox and STIM1flox/flox; SEPT7flox/+ mouse strains in the absence of PCP2 (L7)-Crecre/+ were used as controls for homozygous and heterozygous SEPT7 knockout strains, respectively.
FIGURE 1
Characterization of SEPT7 and STIM1 Expression Levels in STIM1-SEPT7 Double Knockout Mice
Purkinje neurons present in the molecular layer were separated from the granule cell layer by hand microdissection of isolated cerebella from 1-year-old STIM1-SEPT7 double knockout mice (Figure 2, green bars) and control mice of the appropriate genotypes (Figure 2, blue and pink bars). Enrichment of PNs and their separation from the granule cell layer was estimated by measuring relative gene expression levels of a Purkinje neuronal marker, Purkinje cell protein-2 (PCP2), and a granule cell layer marker GABA(A) receptor α6 subunit (GABRA6) (). Microdissected Purkinje layer samples from control and STIM1-SEPT7 double knockout cerebella showed approximately three- to four-fold enrichment of PCP2 compared to the granule cell layer (Figure 2A) and a 10- to 14-fold lower expression of the granule cell marker GABRA6 (Figure 2B), indicating the minimal presence of granule neurons in the microdissected PN samples. The extent of SEPT7 knockdown in heterozygous and homozygous SEPT7 knockout mouse strains was examined next. A significant reduction in SEPT7 mRNA levels was observed in Purkinje layers isolated from the STIM1PKO; SEPT7PHet and STIM1PKO; SEPT7PKO animals as compared to control mice (Figure 2C). The expression of STIM1 was also tested and found to be significantly reduced as expected in the three genotypes with homozygous STIM1PKO. Thus, both heterozygous and homozygous conditions of SEPT7 knockout in STIM1 knockout backgrounds led to a significant reduction in SEPT7 mRNA expression in PNs.
FIGURE 2
Altered Expression of SEPT7 in STIM1 Knockout Mice Modulates Gene Expression in Purkinje Neurons
Age-dependent changes in gene expression have been reported recently in Purkinje neurons from STIM1PKO mice (). If reduced SEPT7 indeed raises Ca2+ entry in PNs, we hypothesized that gene expression changes that arise directly due to reduced SOCE should revert in PNs of SEPT7PHet; STIM1PKO and SEPT7PKO; STIM1PKO mice with age. This idea was tested by measuring the expression of a subset of genes, belonging to various gene ontology classes (Table 2), which are all significantly downregulated in PNs from 1-year-old STIM1PKO mice but not when tested in mice aged 4 months or less (). Expression levels of genes encoding the Ca2+-binding proteins parvalbumin (Pvalb) and calmodulin 1 (Calm1) were restored in PNs of both STIM1PKO; SEPT7PHet and STIM1PKO; SEPT7PKO mice when tested at 1 year (Figures 3A,B). Similarly, the expression of four genes, Dlg4 (discs large homolog 4), Robo2 (roundabout guidance receptor 2), Map4 (microtubule-associated protein 4), and Gigyf2 (GRB10 interacting GYF protein 2), was restored (Figures 3A,B). All four genes belong to the GO (gene ontology) category of neuron projection development (Table 2). In addition, reducing SEPT7 in STIM1PKO PNs restored the expression of an ion channel gene Atp1a3 encoding a Na+/K+-transporting ATPase subunit alpha 3 (Figures 3A,B). Thus, in 7 out of 16 genes tested (Figure 3 and Supplementary Figure S1), expression was restored significantly to control or near-control levels. The expression of genes like Orai3 (SOCE channel), Cacng5 (voltage-gated Ca2+ channel), Vamp1 (vesicle-associated membrane protein 1), and Syt11 (synaptotagmin 11) went up marginally in PNs from STIM1PKO; SEPT7PKO animals as compared to PNs from STIM1PKO mice (Supplementary Figure S1A). Although, due to technical limitations (), we were unable to measure Ca2+ entry directly in PNs from STIM1-SEPT7 double mutant conditions, these data support the idea that either reduction (SEPT7PHet) or loss of SEPT7 (SEPT7PKO) in PNs allows spontaneous extracellular Ca2+ entry, as observed previously in human stem cell–derived precursors and differentiated neurons (). This putative mode of Ca2+ entry in PNs might partially compensate for loss of STIM1-mediated SOCE and concomitant gene expression changes.
TABLE 2
| GO Term | Pathway | LogP | Genes |
|---|---|---|---|
| GO:0010975 | Regulation of neuron projection development | −4.69 | Dlg4, Robo2, Gigyf2, S100b, Map4, Itpr1, Kctd17 |
| GO:0098984 | Neuron to neuron synapse | -4.60 | Dlg4, Itpr1, Map4, Cacng5, Syt11, Atp1a3, Vamp1 |
| GO:0006898 | Receptor-mediated endocytosis | −4.19 | Atp5b, Dlg4, Cacng5, Syt11 |
| GO:0090316 | Positive regulation of intracellular protein transport | −4.10 | Syt11, Vamp1, Itpr1 |
| GO:0032469 | Endoplasmic reticulum calcium ion homeostasis | −3.02 | Itpr1, Orai3, Dlg4, Casq2, S100b, Atp1a3, Cacng5, Kctd17 |
| GO:0061024 | Membrane organization | −2.48 | Dlg4, Vamp1, Cacng5, Syt11 |
| GO:0098793 | Presynapse | −2.35 | Calm1, Dlg4, Itpr1, Syt11, Atp1a3 |
Table with downregulated genes identified under enriched GO biological and cellular process.
GO classification of biological and cellular processes of selected genes downregulated upon STIM1 knockout in PNs. Enriched categories with associated GO term, log p value, and lists of genes associated with each process and tested here are shown. Metascape was used for gene enrichment using parameters specific for Mus musculus, with a p value cutoff as 0.01 (data from ).
FIGURE 3
Loss of SEPT7 Modulates Synaptic Connectivity Among Climbing Fiber Axons and Purkinje Neuron Dendrites in STIM1 Knockout Purkinje Neurons
Next, we investigated if reducing or abolishing SEPT7 from STIM1PKO Purkinje neurons modulates synaptic connectivity between climbing fibers and Purkinje neurons. Climbing fibers (CFs) are axonal projections from inferior olive neurons. They innervate Purkinje neurons dendrites through glutamatergic synapses that express VGLUT2 (vesicular glutamate transporter type 2; ). Activity from CFs greatly influences individual Purkinje neurons and cerebellar output (Smeets and Verbeek, 2016). Excess CF-PN innervation has been seen in a number of genetic mouse models with impaired Ca2+ signaling and reduced motor coordination (; ; Kano et al., 1995; Kashiwabuchi et al., 1995; Kano et al., 1997; Hashimoto et al., 2001). Moreover, STIM1PKO mice at 1 year exhibit increased CF-PN synapse numbers that correlate with reduced motor coordination (). To evaluate the density and distribution of CF-PN synapses, we quantified VGLUT2 (vesicular glutamate transporter type 2) puncta along the proximal dendrites of PNs (Figure 4). As described previously, a significant increase in VGLUT2 puncta is observed along the proximal dendrites of STIM1PKO PNs as compared with the control genotype of AI14td; PCP2Cre (Figures 4A,B; ). Importantly, the density of VGLUT2 puncta along the PN dendrites of both STIM1PKO; SEPT7PHet and STIM1PKO; SEPT7PKO mice was comparable to that of the control mice. There was no change in the density of VGLUT2 puncta on PN dendrites of either SEPT7PHet or SEPT7PKO mice (Figures 4A,B). Restoration of CF-PN innervation upon reducing SEPT7 in STIM1 knockout Purkinje neurons suggests that Ca2+ homeostasis impacts synaptic plasticity and together the two could alter cerebellar circuit function.
FIGURE 4
Reduced SEPT7 Levels Improve Motor Performance in STIM1 Knockout Mice
A well-established readout of PN and cerebellar function is the ability to learn a motor coordination task such as time spent on a rotarod with increasing rotational speed (Koopmans et al., 2007; Shiotsuki et al., 2010; Stroobants et al., 2013). Loss of STIM1 in PNs reduces the ability to perform this motor learning task (Hartmann et al., 2014). Further impairment is seen with age both in controls and in STIM1PKO animals (). Restored expression of a subset of genes and rescue of CF-PN connectivity motivated us to compare the motor learning deficits of STIM1PKO mice with STIM1PKO; SEPT7PHet and STIM1PKO; SEPT7PKO mice, along with their appropriate genetic controls in the rotarod assay across various ages. Initially, we tested motor learning in mice with either partial or complete loss of SEPT7 in Purkinje neurons (Figure 5). Motor learning deficits were not observed in SEPT7PHet and SEPTPKO mice at 17 weeks, 6 months, or 1 year of age (Figures 5A–F), suggesting the limited function of SEPT7 in adult PNs. Next, we tested motor learning in the double mutant combinations of STIM1PKO; SEPT7PHet and STIM1PKO; SEPT7PKO mice. STIM1flox/flox, SEPT7flox/+, and SEPT7PHet were the controls for STIM1PKO; SEPT7PHet mice, whereas STIM1flox/flox, SEPT7flox/flox, and SEPT7PKO were controls for STIM1PKO; SEPT7PKO mice. The same batch of mice was tested at 17 weeks, 6 months, and 1 year of age. At all ages, tested motor learning in STIM1flox/flox, SEPT7flox/+, and SEPT7PHet mice is significantly better than in STIM1PKO mice (Figure 5A). For example, at 17 weeks, STIM1flox/flox; SEPT7flox/+ control mice improved their latency on the rotarod from 128.8 ± 6.9 s on the 1st day to 226.3 ± 14.7 s on the 5th day (Figure 5A), whereas STIM1PKO mice showed similar performance as that of control mice on day 1 (mean latency of 117.1 ± 5.1 s) but did not improve to the same extent (150.9 ± 5.6 s, Figures 5A,B) as the controls over 5 days of training. Performance of STIM1PKO; SEPT7PHet mice at 17 weeks is not statistically indistinguishable from either controls or STIM1PKO animals (Figure 5A). However, the age performance of STIM1PKO; SEPT7PHet mice improves on the rotarod as evident at 6 months (Figure 5B; Supplementary Figure S2) and 1 year (Figure 5C). A similar age-dependent improvement in motor coordination learning is evident in STIM1PKO; SEPT7PKO homozygotes from 17 weeks to 1 year (Figures 5D–F; Supplementary Figure S2, Supplementary Video S1). However, as compared to STIM1PKO; SEPT7PHet mice (Figure 5C), the STIM1PKO; SEPT7PKO mice (Figure 5F) exhibit an overall reduction in motor learning with age, which is also evident for the control genotypes and is possibly due to the sustained loss of SEPT7 from PNs. Thus, deleting either single or both copies of SEPT7 in PNs of STIM1PKO mice partially rescues their motor learning deficits.
FIGURE 5
Discussion
In this study, we show that partial or complete deletion of SEPT7 from adult murine Purkinje neurons reverses multiple phenotypes associated with PN-specific loss of the ER-Ca2+ sensor and SOCE protein STIM1. The phenotypes reverted include changes in gene expression in part, expression of VGLUT2 puncta that serve as a marker for altered neuronal connectivity between climbing fiber axons and PN dendrites, and the ability to learn a motor coordination task in aging mice. From a previous study, we know that loss of motor coordination is seen as early as 17 weeks of age in STIM1PKO mice, whereas changes in CF-PN synapse numbers and changes in gene expression become evident in mice aged 1 year (). STIM1PKO–SEPTPHet/PKO mice also exhibit early motor learning deficits. Importantly, the progression of these deficits undergoes reversal with age (Figure 5, Supplementary Figure S2, Supplementary Video S1). Taken together, these findings support the idea that reduction/loss of SEPT7 in adult PNs reverts key age-dependent changes in neuronal Ca2+ homeostasis that occurs from loss of STIM1. Consequently, there is reversion of other age-dependent cellular (VGLUT2 puncta) and molecular (gene expression) deficits, and this reversion correlates with better learning of motor coordination with age in STIM1PKO–SEPT7PHet/PKO mice (Figure 6). The reversion of motor coordination deficits observed in mice is in agreement with previous findings in Drosophila where partial genetic depletion of SEPT7 could rescue flight deficits due to STIM knockdown (). Early changes (17 weeks) in mGluR1-dependent Ca2+ transients, of which STIM1 is an integral component, are very likely not restored by loss/reduction of SEPT7. The status of mGluR1-initiated Ca2+ signals in PNs from STIM1PKO–SEPT7PHet/PKO mice needs further investigation.
FIGURE 6
SEPT7 May Function as a Monomer for Regulating Ca2+ Entry at the Plasma Membrane
Most cellular functions of septins are associated with their ability to form filaments and higher order cytoskeletal structures (Marquardt et al., 2019). Recent findings demonstrate that filament formation requires linear hexamers/octamers consisting of SEPT7 at the core, followed by other SEPT subunits in a specific order (Mendonça et al., 2019; Soroor et al., 2021). Differential regulation of SOCE by SEPT2/4 (positive regulators; Sharma et al., 2013;
The mechanism by which SEPT7 regulates Ca2+ entry remains poorly understood. In human stem cell–derived neurons, spontaneous Ca2+ entry by loss of SEPT7 requires the polybasic N-terminal region known to interact with membrane-localized phospholipids such as PIP2 and PIP3 (Zhang et al., 1999;
Among the deficits tested here, we did not find any significant change in SEPT7PKO animals, suggesting that in mature PNs, septin filaments have either no role or a very minor role. Possible effects of SEPT7 on dendritic branching were not investigated though a role for SEPT7 in regulating spine morphogenesis and dendrite development during neuronal maturation has been demonstrated in hippocampal neurons (Tada et al., 2007). SEPT7 monomers are possibly one among several regulators of STIM1-mediated Ca2+ entry, and presumably, their loss can be compensated by other regulators of Ca2+ signaling in PNs.
Gene Expression Changes in Purkinje Neurons With Loss of STIM1, and Restored by SEPT7, Are Associated With Neurodegeneration
Purkinje neurons express a range of Ca2+-binding proteins, Ca2+ channels, Ca2+-dependent kinases, and phosphatases that not only tune PN excitability but also help maintain cellular Ca2+ homeostasis, regulate different Ca2+-dependent processes, and modulate multiple inputs received by PNs (Prestori et al., 2020). Changes in gene expression by loss of STIM1 suggest that the maintenance of Ca2+ homeostasis by STIM1 is required for appropriate age-dependent expression of multiple genes. Restored expression of genes encoding the Ca2+-binding proteins parvalbumin (Pvalb) and calmodulin 1 (Calm1) (Figure 3) is of interest because parvalbumin is expressed abundantly in PNs (
The expression of certain genes classified under the GO category of neuron projection development is also restored in STIM1PKO–SEPTPHet/PKO mice (Figure 3). Dlg4 is a major scaffolding protein in the excitatory postsynaptic density that regulates synaptic strength (Kim et al., 2004;
Climbing Fiber–Purkinje Neuron Synaptic Connectivity and Motor Behavior
Climbing fibers provide one of the major excitatory inputs to Purkinje neurons (Lin et al., 2014). Climbing fiber–Purkinje neuron (CF-PN) synaptic wiring influences processing and integration of information at the PN dendrites essential for proper control of cerebellar motor learning and coordination (Ichikawa et al., 2016). The distribution of CF-PN synapses on Purkinje dendrites is regulated and required for the proper physiological function of Purkinje neurons (Watanabe, 2008). Abnormal CF-PN innervation has been reported in various genetic mouse models with impaired Ca2+ signaling and motor coordination deficits (
In conclusion, our data demonstrate that partial or complete loss of SEPT7 in STIM1 knockout Purkinje neurons could restore age-dependent gene expression changes observed in STIM1PKO PNs. This is accompanied by normal climbing fiber–Purkinje neuron synaptic connectivity and an improved ability to learn and perform motor coordination task in aging mice. These findings suggest that loss of SEPT7 in Purkinje neurons allows spontaneous extracellular Ca2+ entry, as reported previously in Drosophila neurons (
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, and further inquiries can be directed to the corresponding author.
Ethics statement
The animal study was reviewed and approved by the Institutional Animal Ethics Committee which is approved by the Control and Supervision of Experiments on Animals (CPCSEA), New Delhi, India.
Author contributions
SD contributed to conceptualization, developed methodology, performed and analyzed the experiments, assisted with data curation, and wrote the original manuscript. GH contributed to conceptualization, supervision, funding acquisition, and writing and editing of the manuscript.
Funding
This work was funded by Department of Biotechnology, Ministry of Science and Technology, Government of India (BT/PR6371/COE/34/19/2013) and core funds from National Centre for Biological Sciences (NCBS), Tata Institute for Fundamental Research, Bangalore, India. SD was supported by a fellowship from the Indian Council of Medical Research (ICMR). Government of India (ICMR-JRF-2015/LS/133/92183).
Acknowledgments
We are thankful to the National Centre for Biological Sciences (NCBS), Tata Institute for Fundamental Research, and the Department of Biotechnology, government of India, for funding the project. We thank Prof. Anjana Rao from La Jolla Institute for Allergy and Immunology, La Jolla, California, for providing us with Stim1flox/flox mice. We are grateful to Prof. Matthias Gaestel, Institute of Biochemistry, Hannover Medical School, Hanover, Germany, for sending the SEPT7flox/flox mice. We are very thankful to the Animal Facility at the NCBS for maintaining the experimental mice. We thank the NCBS Central Imaging and Flow Facility for the use of confocal microscopes.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2021.794807/full#supplementary-material
Supplementary Figure S1Analysis of gene expression in SEPT7–STIM1 knockout Purkinje neurons (related to Figure 3) (A) Bar graph showing relative fold changes in expression levels of the indicated genes of various control genotypes of STIM1PKO; SEPT7PHet. Red asterisks above each bar represent statistically significant groups compared between STIM1PKO (pink bars) and STIM1flox/flox; SEPTflox/+(light blue bars). (B) Bar graph showing relative gene expression changes of the indicated genes of various control genotypes of STIM1PKO; SEPT7PKO. Red asterisks over each bar represent statistically significant groups compared between STIM1PKO(pink bars) and STIM1flox/flox; SEPTflox/flox(blue bars). Fold changes were normalized to GAPDH. Data are presented as mean ± SEM, *p < 0.05, **p < 0.01; One-way ANOVA with post hoc Tukey’s test. All measurements are taken by qRT-PCR of cDNA prepared from RNA isolated from microdissected Purkinje layers (n = 3 mice for all groups and n = 4 for STIM1PKO; SEPT7PHet, age: 1-year-old mice). Itpr1, inositol 1,4,5-trisphosphate receptor 1, Orai3—Orai3; Casq2, calsequestrin 2, S100b—S100b; Cacng5, calcium voltage-gated channel auxiliary subunit gamma 5; Kctd17, pPotassium channel tetramerization domain containing 17; Vamp1, vesicle-associated membrane protein 1; Syt11, synaptotagmin 11, Setd6, SET domaincontaining 6, Gapdh, glyceraldehyde 3-phosphate dehydrogenase.
Supplementary Figure S2Experimental setup of rotarod assay with mice of various genotypes of SEPT7–STIM1 mutant strain (Related to Figure 5) Snapshots of mice of indicated genotypes on an accelerated rotarod at 0, 45, and 102 s. Lane 1–STIM1flox/flox; SEPT7flox/flox (wild), Lane 2–STIM1PKO, Lane 3–STIM1PKO, Lane 4–STIM1PKO; SEPT7PHet, Lane 5–STIM1PKO; SEPT7PKO. All animals were aged 6 months. Mice that have fallen from the accelerating rod are indicated by red arrows.
Supplementary Video S1Rotarod assay of SEPT7–STIM1 mutant mice strain (related to Figure 5). Video of the rotarod assay with mice of indicated genotypes. Lane 1: STIM1flox/flox; SEPT7flox/flox (wild), Lane 2: STIM1PKO, Lane 3: STIM1PKO, Lane 4: STIM1PKO; SEPT7PHet, Lane 5: STIM1PKO; SEPT7PKO. All mice were 6 months old in this video.
References
1
AlbaA.KanoM.ChenC.StantonM. E.FoxG. D.HerrupK.et al (1994). Deficient Cerebellar Long-Term Depression and Impaired Motor Learning in mGluR1 Mutant Mice. Cell79 (2), 377–388. 10.1016/0092-8674(94)90205-4
2
AndoH.HiroseM.MikoshibaK. (2018). Aberrant IP3 Receptor Activities Revealed by Comprehensive Analysis of Pathological Mutations Causing Spinocerebellar Ataxia 29. Proc. Natl. Acad. Sci. USA115 (48), 12259–12264. 10.1073/pnas.1811129115
3
BarskiJ. J.DethleffsenK.MeyerM. (2000). Cre Recombinase Expression in Cerebellar Purkinje Cells. Genesis28 (34), 93–98. 10.1002/1526-968x(200011/12)28:3/4<93:aid-gene10>3.0.co;2-w
4
BeitesC. L.XieH.BowserR.TrimbleW. S. (1999). The Septin CDCrel-1 Binds Syntaxin and Inhibits Exocytosis. Nat. Neurosci.2 (5), 434–439. 10.1038/8100
5
BezprozvannyI.HaydenM. R. (2004). Deranged Neuronal Calcium Signaling and Huntington Disease. Biochem. Biophysical Res. Commun.322, 1310–1317. 10.1016/j.bbrc.2004.08.035
6
BoydenE. S.KatohA.PyleJ. L.ChatilaT. A.TsienR. W.RaymondJ. L. (2006). Selective Engagement of Plasticity Mechanisms for Motor Memory Storage. Neuron51 (6), 823–834. 10.1016/j.neuron.2006.08.026
7
CaillardO.MorenoH.SchwallerB.LlanoI.CelioM. R.MartyA. (2000). Role of the Calcium-Binding Protein Parvalbumin in Short-Term Synaptic Plasticity. Proc. Natl. Acad. Sci.97 (24), 13372–13377. 10.1073/pnas.230362997
8
ChenC.KanoM.AbeliovichA.ChenL.BaoS.KimJ. J.et al (1995). Impaired Motor Coordination Correlates with Persistent Multiple Climbing Fiber Innervation in PKCγ Mutant Mice. Cell83 (7), 1233–1242. 10.1016/0092-8674(95)90148-5
9
ChengD.HoogenraadC. C.RushJ.RammE.SchlagerM. A.DuongD. M.et al (2006). Relative and Absolute Quantification of Postsynaptic Density Proteome Isolated from Rat Forebrain and Cerebellum. Mol. Cell Proteomics5 (6), 1158–1170. 10.1074/mcp.D500009-MCP200
10
ChengM. M.TangG.KuoS.-H. (2013). Harmaline-Induced Tremor in Mice: Videotape Documentation and Open Questions about the Model. Tremor and Other Hyperkinetic Movements3 (0), 03. 10.5334/tohm.139
11
CzeredysM. (2020). Dysregulation of Neuronal Calcium Signaling via Store-Operated Channels in Huntington's Disease. Front. Cel Dev. Biol.8. 10.3389/fcell.2020.611735
12
de SouzaL. B.OngH. L.LiuX.AmbudkarI. S. (2021). PIP2 and Septin Control STIM1/Orai1 Assembly by Regulating Cytoskeletal Remodeling via a CDC42-Wasp/wave-Arp2/3 Protein Complex. Cell Calcium99, 102475. 10.1016/j.ceca.2021.102475
13
DebB. K.ChakrabortyP.GopurappillyR.HasanG. (2020). SEPT7 Regulates Ca2+ Entry through Orai Channels in Human Neural Progenitor Cells and Neurons. Cell Calcium90, 102252. 10.1016/j.ceca.2020.102252
14
DebB. K.PathakT.HasanG. (2016). Store-independent Modulation of Ca2+ Entry through Orai by Septin 7. Nat. Commun.7, 11751. 10.1038/ncomms11751
15
DhanyaS. K.HasanG. (2021). Purkinje Neurons with Loss of STIM1 Exhibit Age-dependent Changes in Gene Expression and Synaptic Components. J. Neurosci.41 (17), 3777–3798. 10.1523/jneurosci.2401-20.2021
16
DreesB. L.SundinB.BrazeauE.CavistonJ. P.ChenG.-C.GuoW.et al (2001). A Protein Interaction Map for Cell Polarity Development. J. Cel Biol.154 (3), 549–576. 10.1083/jcb.200104057
17
FatyM.FinkM.BarralY. (2002). Septins: A Ring to Part Mother and Daughter. Curr. Genet.41, 123–131. 10.1007/s00294-002-0304-0
18
FeyderM.KarlssonR.-M.MathurP.LymanM.BockR.MomenanR.et al (2010). Association of MouseDlg4(PSD-95) Gene Deletion and HumanDLG4Gene Variation with Phenotypes Relevant to Autism Spectrum Disorders and Williams' Syndrome. Ajp167 (12), 1508–1517. 10.1176/appi.ajp.2010.10040484
19
FingerF. P.KopishK. R.WhiteJ. G. (2003). A Role for Septins in Cellular and Axonal Migration in C. elegans. Developmental Biol.261 (1), 220–234. 10.1016/S0012-1606(03)00296-3
20
FingerF. P. (2002). One Ring to Bind Them. Developmental Cel3, 761–763. 10.1016/S1534-5807(02)00371-4
21
FremeauR. T.TroyerM. D.PahnerI.NygaardG. O.TranC. H.ReimerR. J.et al (2001). The Expression of Vesicular Glutamate Transporters Defines Two Classes of Excitatory Synapse. Neuron31 (2), 247–260. 10.1016/S0896-6273(01)00344-0
22
FunkeL.DakojiS.BredtD. S. (2005). Membrane-associated Guanylate Kinases Regulate Adhesion and Plasticity at Cell Junctions. Annu. Rev. Biochem.74, 219–245. 10.1146/annurev.biochem.74.082803.133339
23
GibsonD. A.TymanskyjS.YuanR. C.LeungH. C.LefebvreJ. L.SanesJ. R.et al (2014). Dendrite Self-Avoidance Requires Cell-Autonomous Slit/robo Signaling in Cerebellar Purkinje Cells. Neuron81 (5), 1040–1056. 10.1016/j.neuron.2014.01.009
24
GiovannoneB.LeeE.LaviolaL.GiorginoF.ClevelandK. A.SmithR. J. (2003). Two Novel Proteins that Are Linked to Insulin-like Growth Factor (IGF-I) Receptors by the Grb10 Adapter and Modulate IGF-I Signaling. J. Biol. Chem.278 (34), 31564–31573. 10.1074/jbc.M211572200
25
GiovannoneB.TsiarasW. G.De la MonteS.KlysikJ.LautierC.KarashchukG.et al (2009). GIGYF2 Gene Disruption in Mice Results in Neurodegeneration and Altered Insulin-like Growth Factor Signaling. Hum. Mol. Genet.18 (23), 4629–4639. 10.1093/hmg/ddp430
26
GiovannoneD.ReyesM.ReyesR.CorreaL.MartinezD.RaH.et al (2012). Slits Affect the Timely Migration of Neural Crest Cells via Robo Receptor. Dev. Dyn.241 (8), 1274–1288. 10.1002/dvdy.23817
27
GladfelterA.PringleJ. R.LewD. J. (2001). The Septin Cortex at the Yeast Motherâ€"bud Neck. Curr. Opin. Microbiol.4, 681–689. 10.1016/S1369-5274(01)00269-7
28
HanselC.de JeuM.BelmeguenaiA.HoutmanS. H.BuitendijkG. H. S.AndreevD.et al (2006). αCaMKII Is Essential for Cerebellar LTD and Motor Learning. Neuron51 (6), 835–843. 10.1016/j.neuron.2006.08.013
29
HartmannJ.KarlR. M.AlexanderR. P. D.AdelsbergerH.BrillM. S.RühlmannC.et al (2014). STIM1 Controls Neuronal Ca2+ Signaling, mGluR1-dependent Synaptic Transmission, and Cerebellar Motor Behavior. Neuron82 (3), 635–644. 10.1016/j.neuron.2014.03.027
30
HasanG.SharmaA. (2020). Regulation of Neuronal Physiology by Ca2+ Release through the IP3R. Curr. Opin. Physiol.17, 1–8. 10.1016/j.cophys.2020.06.001
31
HashimotoK.IchikawaR.TakechiH.InoueY.AibaA.SakimuraK.et al (2001). Roles of Glutamate Receptor δ2 Subunit (GluRδ2) and Metabotropic Glutamate Receptor Subtype 1 (mGluR1) in Climbing Fiber Synapse Elimination during Postnatal Cerebellar Development. J. Neurosci.21 (24), 9701–9712. 10.1523/jneurosci.21-24-09701.2001
32
HelmichR. C.ToniI.DeuschlG.BloemB. R. (2013). The Pathophysiology of Essential Tremor and Parkinson's Tremor. Curr. Neurol. Neurosci. Rep.13 (9), 1–10. 10.1007/s11910-013-0378-8
33
HoltL. J.SiddleK. (2005). Grb10 and Grb14: Enigmatic Regulators of Insulin Action - and More?Biochem. J.388 (2), 393–406. 10.1042/BJ20050216
34
HsuS.-C.HazukaC. D.RothR.FolettiD. L.HeuserJ.SchellerR. H. (1998). Subunit Composition, Protein Interactions, and Structures of the Mammalian Brain Sec6/8 Complex and Septin Filaments. Neuron20 (6), 1111–1122. 10.1016/S0896-6273(00)80493-6
35
IchikawaR.HashimotoK.MiyazakiT.UchigashimaM.YamasakiM.AibaA.et al (2016). Territories of Heterologous Inputs onto Purkinje Cell Dendrites Are Segregated by Mglur1-dependent Parallel Fiber Synapse Elimination. Proc. Natl. Acad. Sci. USA113 (8), 2282–2287. 10.1073/pnas.1511513113
36
IrazoquiJ. E.LewD. J. (2004). Polarity Establishment in Yeast. J. Cel Sci.117, 2169–2171. 10.1242/jcs.00953
37
KanekoM.YamaguchiK.EirakuM.SatoM.TakataN.KiyoharaY.et al (2011). Remodeling of Monoplanar Purkinje Cell Dendrites during Cerebellar Circuit Formation. PLoS One6 (5), e20108. 10.1371/journal.pone.0020108
38
KanoM.HashimotoK.ChenC.AbeliovichA.AibaA.KuriharaH.et al (1995). Impaired Synapse Elimination during Cerebellar Development in PKCγ Mutant Mice. Cell83 (7), 1223–1231. 10.1016/0092-8674(95)90147-7
39
KanoM.HashimotoK.KuriharaH.WatanabeM.InoueY.AibaA.et al (1997). Persistent Multiple Climbing Fiber Innervationof Cerebellar Purkinje Cellsin Mice Lacking mGluR1. Neuron18 (1), 71–79. 10.1016/S0896-6273(01)80047-7
40
KartmannB.RothD. (2001). Novel Roles for Mammalian Septins: From Vesicle Trafficking to Oncogenesis. J. Cel Sci.114 (5), 839–844. 10.1242/jcs.114.5.839
41
KashiwabuchiN.IkedaK.ArakiK.HiranoT.ShibukiK.TakayamaC.et al (1995). Impairment of Motor Coordination, Purkinje Cell Synapse Formation, and Cerebellar Long-Term Depression in GluRδ2 Mutant Mice. Cell81 (2), 245–252. 10.1016/0092-8674(95)90334-8
42
KimE.ShengM. (2004). PDZ Domain Proteins of Synapses. Nat. Rev. Neurosci.5, 771–781. 10.1038/nrn1517
43
KimH.KimM.ImS.-K.FangS. (2018). Mouse Cre-LoxP System: General Principles to Determine Tissue-specific Roles of Target Genes. Lab. Anim. Res.34 (4), 147. 10.5625/lar.2018.34.4.147
44
KinoshitaM. (2003). Assembly of Mammalian Septins. J. Biochem.134 (4), 491–496. 10.1093/jb/mvg182
45
KinoshitaM.KumarS.MizoguchiA.IdeC.KinoshitaA.HaraguchiT.et al (1997). Nedd5, a Mammalian Septin, Is a Novel Cytoskeletal Component Interacting with Actin-Based Structures. Genes Dev.11 (12), 1535–1547. 10.1101/gad.11.12.1535
46
KinoshitaM.NodaM. (2001). Advances in Cytokinesis Research. Roles of Septins in the Mammalian Cytokinesis Machinery. Cell Struct. Funct.26, 667–670. 10.1247/csf.26.667
47
KlarJ.AliZ.FarooqM.KhanK.WikströmJ.IqbalM.et al (2017). A Missense Variant in ITPR1 Provides Evidence for Autosomal Recessive SCA29 with Asymptomatic Cerebellar Hypoplasia in Carriers. Eur. J. Hum. Genet.25, 848–853. 10.1038/ejhg.2017.54
48
KlejmanM. E.Gruszczynska-BiegalaJ.Skibinska-KijekA.WisniewskaM. B.MisztalK.BlazejczykM.et al (2009). Expression of STIM1 in Brain and Puncta-like Co-localization of STIM1 and ORAI1 upon Depletion of Ca2+ Store in Neurons. Neurochem. Int.54 (1), 49–55. 10.1016/j.neuint.2008.10.005
49
KoeppenA. H.RamirezR. L.BjorkS. T.BauerP.FeustelP. J. (2013). The Reciprocal Cerebellar Circuitry in Human Hereditary Ataxia. Cerebellum12 (4), 493–503. 10.1007/s12311-013-0456-0
50
KoopmansG. C.DeumensR.BrookG.GerverJ.HonigW. M. M.HamersF. P. T.et al (2007). Strain and Locomotor Speed Affect Over-ground Locomotion in Intact Rats. Physiol. Behav.92 (5), 993–1001. 10.1016/j.physbeh.2007.07.018
51
LeeK. Y.KimJ. S.KimS. H.ParkH. S.JeongY.-G.LeeN.-S.et al (2011). Altered Purkinje Cell Responses and Calmodulin Expression in the Spontaneously Ataxic Mouse, Pogo. Eur. J. Neurosci.33 (November 2009), 1493–1503. 10.1111/j.1460-9568.2011.07641.x
52
LinC.-Y.LouisE. D.FaustP. L.KoeppenA. H.VonsattelJ.-P. G.KuoS.-H. (2014). Abnormal Climbing Fibre-Purkinje Cell Synaptic Connections in the Essential Tremor Cerebellum. Brain137 (12), 3149–3159. 10.1093/brain/awu281
53
MaL.Tessier-LavigneM. (2007). Dual branch-promoting and branch-repelling Actions of Slit/Robo Signaling on Peripheral and central Branches of Developing Sensory Axons. J. Neurosci.27 (25), 6843–6851. 10.1523/JNEUROSCI.1479-07.2007
54
MacaraI. G.BaldarelliR.FieldC. M.GlotzerM.HayashiY.HsuS.-C.et al (2002). Mammalian Septins Nomenclature. MBoC13, 4111–4113. 10.1091/mbc.E02-07-0438
55
MarquardtJ.ChenX.BiE. (2019). Architecture, Remodeling, and Functions of the Septin Cytoskeleton. Cytoskeleton76, 7–14. 10.1002/cm.21475
56
MendonçaD. C.MacedoJ. N.GuimarãesS. L.Barroso da SilvaF. L.CassagoA.GarrattR. C.et al (2019). A Revised Order of Subunits in Mammalian Septin Complexes. Cytoskeleton76 (9–10), 457–466. 10.1002/cm.21569
57
MenonM. B.SawadaA.ChaturvediA.MishraP.Schuster-gosslerK.GallaM.et al (2014). Genetic Deletion of SEPT7 Reveals a Cell Type-specific Role of Septins in Microtubule Destabilization for the Completion of Cytokinesis. Plos Genet.10 (8), e1004558. 10.1371/journal.pgen.1004558
58
NagataK.-i.KawajiriA.MatsuiS.TakagishiM.ShiromizuT.SaitohN.et al (2003). Filament Formation of MSF-A, a Mammalian Septin, in Human Mammary Epithelial Cells Depends on Interactions with Microtubules. J. Biol. Chem.278 (20), 18538–18543. 10.1074/jbc.M205246200
59
NagyA. (2000). Cre Recombinase: The Universal Reagent for Genome Tailoring. Genesis26, 99–109. 10.1002/(sici)1526-968x(200002)26:2<99:aid-gene1>3.0.co;2-b
60
Oh-horaM.YamashitaM.HoganP. G.SharmaS.LampertiE.ChungW.et al (2008). Dual Functions for the Endoplasmic Reticulum Calcium Sensors STIM1 and STIM2 in T Cell Activation and Tolerance. Nat. Immunol.9 (4), 432–443. 10.1038/ni1574
61
PanZ.BrottoM.MaJ. (2014). Store-operated Ca2+entry in Muscle Physiology and Diseases. BMB Rep.47 (2), 69–79. 10.5483/BMBRep.2014.47.2.015
62
PintoA. P. A.PereiraH. M.ZeraikA. E.CiolH.FerreiraF. M.Brandão-NetoJ.et al (2017). Filaments and Fingers: Novel Structural Aspects of the Single Septin from Chlamydomonas Reinhardtii. J. Biol. Chem.292 (26), 10899–10911. 10.1074/jbc.M116.762229
63
PrestoriF.MocciaF.D’AngeloE. (2020). Disrupted Calcium Signaling in Animal Models of Human Spinocerebellar Ataxia (SCA). Ijms21 (1), 216–228. 10.3390/ijms21010216
64
RyuC.JangD. C.JungD.KimY. G.ShimH. G.RyuH.-H.et al (2017). STIM1 Regulates Somatic Ca2+ Signals and Intrinsic Firing Properties of Cerebellar Purkinje Neurons. J. Neurosci.37 (37), 8876–8894. 10.1523/JNEUROSCI.3973-16.2017
65
SchwallerB.MeyerM.SchiffmannS. (2002). 'New' Functions for 'old' Proteins: The Role of the Calcium-Binding Proteins Calbindin D-28k, Calretinin and Parvalbumin, in Cerebellar Physiology. Studies with Knockout Mice. The Cerebellum1 (4), 241–258. 10.1080/147342202320883551
66
SharmaS.QuintanaA.FindlayG. M.MettlenM.BaustB.JainM.et al (2013). An siRNA Screen for NFAT Activation Identifies Septins as Coordinators of Store-Operated Ca2+ Entry. Nature499 (7457), 238–242. 10.1038/nature12229
67
ShiotsukiH.YoshimiK.ShimoY.FunayamaM.TakamatsuY.IkedaK.et al (2010). A Rotarod Test for Evaluation of Motor Skill Learning. J. Neurosci. Methods189 (2), 180–185. 10.1016/j.jneumeth.2010.03.026
68
SirajuddinM.FarkasovskyM.HauerF.KühlmannD.MacaraI. G.WeyandM.et al (2007). Structural Insight into Filament Formation by Mammalian Septins. Nature449 (7160), 311–315. 10.1038/nature06052
69
SmeetsC. J. L. M.VerbeekD. S. (2016). Climbing Fibers in Spinocerebellar Ataxia: A Mechanism for the Loss of Motor Control. Neurobiol. Dis.88, 96–106. 10.1016/j.nbd.2016.01.009
70
SoroorF.KimM. S.PalanderO.BalachandranY.CollinsR. F.BenlekbirS.et al (2021). Revised Subunit Order of Mammalian Septin Complexes Explains Their In Vitro Polymerization Properties. MBoC32 (3), 289–300. 10.1091/MBC.E20-06-0398
71
StreetV. A.BosmaM. M.DemasV. P.ReganM. R.LinD. D.RobinsonL. C.et al (1997). The Type 1 Inositol 1,4,5-Trisphosphate Receptor Gene Is Altered in theopisthotonosMouse. J. Neurosci.17 (2), 635–645. 10.1523/jneurosci.17-02-00635.1997
72
StroobantsS.GantoisI.PootersT.D’HoogeR. (2013). Increased Gait Variability in Mice with Small Cerebellar Cortex Lesions and normal Rotarod Performance. Behav. Brain Res.241 (1), 32–37. 10.1016/j.bbr.2012.11.034
73
SunS.ZhangH.LiuJ.PopugaevaE.XuN.-J.FeskeS.et al (2014). Reduced Synaptic STIM2 Expression and Impaired Store-Operated Calcium Entry Cause Destabilization of Mature Spines in Mutant Presenilin Mice. Neuron82 (1), 79–93. 10.1016/j.neuron.2014.02.019
74
SurkaM. C.TsangC. W.TrimbleW. S. (2002). The Mammalian Septin MSF Localizes with Microtubules and Is Required for Completion of Cytokinesis. MBoC13 (10), 3532–3545. 10.1091/mbc.E02-01-0042
75
TadaT.SimonettaA.BattertonM.KinoshitaM.EdbauerD.ShengM. (2007). Role of Septin Cytoskeleton in Spine Morphogenesis and Dendrite Development in Neurons. Curr. Biol.17, 1752–1758. 10.1016/j.cub.2007.09.039
76
Van De LeemputJ.ChandranJ.KnightM. A.HoltzclawL. A.ScholzS.CooksonM. R.et al (2007). Deletion at ITPR1 Underlies Ataxia in Mice and Spinocerebellar Ataxia 15 in Humans. Plos Genet.3 (6), e108. 10.1371/journal.pgen.0030108
77
Van WoerdenG. M.HoebeekF. E.GaoZ.NagarajaR. Y.HoogenraadC. C.KushnerS. A.et al (2009). βCaMKII Controls the Direction of Plasticity at Parallel Fiber-Purkinje Cell Synapses. Nat. Neurosci.12 (7), 823–825. 10.1038/nn.2329
78
VigP. J. S.FratkinJ. D.DesaiahD.CurrierR. D.SubramonyS. H. (1996). Decreased Parvalbumin Immunoreactivity in Surviving Purkinje Cells of Patients with Spinocerebellar Ataxia-1. Neurology47 (1), 249–253. 10.1212/WNL.47.1.249
79
VigP. J. S.SubramonyS. H.BurrightE. N.FratkinJ. D.McDanielD. O.DesaiahD.et al (1998). Reduced Immunoreactivity to Calcium-Binding Proteins in Purkinje Cells Precedes Onset of Ataxia in Spinocerebellar Ataxia-1 Transgenic Mice. Neurology50 (1), 106–113. 10.1212/WNL.50.1.106
80
WatanabeM. (2008). Molecular Mechanisms Governing Competitive Synaptic Wiring in Cerebellar Purkinje Cells. Tohoku J. Exp. Med.214, 175–190. 10.1620/tjem.214.175
81
ZhangJ.KongC.XieH.McPhersonP. S.GrinsteinS.TrimbleW. S. (1999). Phosphatidylinositol Polyphosphate Binding to the Mammalian Septin H5 Is Modulated by GTP. Curr. Biol.9 (24), 1458–1467. 10.1016/S0960-9822(00)80115-3
82
ZhouQ.YenA.RymarczykG.AsaiH.TrengroveC.AzizN.et al (2016). Impairment of PARK14-dependent Ca2+ Signalling Is a Novel Determinant of Parkinson's Disease. Nat. Commun.7. 10.1038/ncomms10332
Summary
Keywords
Ca2+ signaling, gene expression, climbing fibers, VGLUT2, SOCE, synaptic function, neurodegenerative disorders
Citation
Dhanya SK and Hasan G (2021) Deficits Associated With Loss of STIM1 in Purkinje Neurons Including Motor Coordination Can Be Rescued by Loss of Septin 7. Front. Cell Dev. Biol. 9:794807. doi: 10.3389/fcell.2021.794807
Received
14 October 2021
Accepted
15 November 2021
Published
21 December 2021
Volume
9 - 2021
Edited by
Manoj B. Menon, Indian Institute of Technology Delhi, India
Reviewed by
Laura N. Borodinsky, University of California, Davis, United States
Jeremy Smyth, Uniformed Services University of the Health Sciences, United States
Updates

Check for updates
Copyright
© 2021 Dhanya and Hasan.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Gaiti Hasan, gaiti@ncbs.res.in
This article was submitted to Signaling, a section of the journal Frontiers in Cell and Developmental Biology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.