Abstract
Peroxisomes are eukaryotic specific organelles that perform diverse metabolic functions including fatty acid β-oxidation, reactive species metabolism, photorespiration, and responses to stress. However, the potential regulation of these functions by post-translational modifications, including protein phosphorylation, has had limited study. Recently, we identified and catalogued a large number of peroxisomal phosphorylated proteins, implicating the presence of protein kinases in this organelle. Here, we employed available prediction models coupled with sequence conservation analysis to identify 31 protein kinases from the Arabidopsis kinome (all protein kinases) that contain a putative, non-canonical peroxisomal targeting signal type 1 (PTS1). From this, twelve C-terminal domain-PTS1s were demonstrated to be functional in vivo, targeting enhanced yellow fluorescent protein to peroxisomes, increasing the list of presumptive peroxisomal protein kinases to nineteen. Of the twelve protein kinases with functional PTS1s, we obtained full length clones for eight and demonstrated that seven target to peroxisomes in vivo. Screening homozygous mutants of the presumptive nineteen protein kinases revealed one candidate (GPK1) that harbors a sugar-dependence phenotype, suggesting it is involved in regulating peroxisomal fatty acid β-oxidation. These results present new opportunities for investigating the regulation of peroxisome functions.
Introduction
Peroxisomes are eukaryotic specific, single-membraned organelles involved in a host of specialized metabolic events, but are best characterized for their role in fatty acid β-oxidation and photorespiration (; ). Peroxisomes derive from the endoplasmic reticulum (ER), have the ability to bind to and move on the cytoskeleton, to proliferate (; Neuhaus et al., 2016; ) and in plants were recently discovered to have intralumenal vesicles (Wright and Bartel, 2020). Pre-peroxisomes bud from specific ER domains and become mature peroxisomes through importing nuclear-encoded peroxisomal membrane (PMPs) and matrix proteins. Proteins synthesized in the cytosol enter peroxisomes via short sequence signals named peroxisome targeting signal type 1 (PTS1) and 2 (PTS2) located at protein C-termini and N-termini, respectively. The majority of peroxisomal matrix proteins have PTS1 with a prototype SKL> (this is the single amino acid code and >indicates a C-terminal stop codon), while some harbor PTS2 with RLX5HL as a prototype (; ; ; ). Bioinformatic prediction tools have been developed primarily for PTS1 identification and have been widely utilized to identify putative peroxisomal candidate proteins (Reumann, 2004; ; ; Skoulding et al., 2015; Wang et al., 2017; Reumann and Chowdhary, 2018).
Peroxisome biogenesis, functions (), remodelling (Paudyal et al., 2017; ) and crosstalk with other organelles (Oikawa et al., 2015; Thazar-Poulot et al., 2015; ) is expected to be fine-tuned under varying cellular conditions through various post-translational modifications (PTMs) (Sandalio et al., 2019). Yeast protein kinase and phosphatase mutants show a role for protein phosphorylation in peroxisome formation, size, fission, and pexophagy (Saleem et al., 2008; Oeljeklaus et al., 2016). We proposed that phosphorylation could control plant proteins shuttling between peroxisomes and other organelles, possibly under specific conditions (), similar to yeast glycerol-3-phosphate dehydrogenase 1 (GPD1), which changes its localization from the nucleus and cytosol to peroxisomes by a phosphorylation-dependent event (). A limited number of studies have investigated protein phosphorylation in mammalian, yeast, and Arabidopsis peroxisomes (for a full overview we refer readers to two comprehensive reviews about this topic (Oeljeklaus et al., 2016; )). Recently, Arabidopsis and Zea mays peroxisomal photorespiratory glycolate oxidase activity was found to be modulated by phosphorylation () and our recent analysis found more than half of the known peroxisomal proteome to be phosphorylated (). However, it is not known how phosphorylation controls these proteins or the identity of the protein kinases and phosphatases that regulate them. Over the last 2 decades, four Arabidopsis peroxisomal protein phosphatases were identified (; Matre et al., 2009; ; ; ). The number of protein kinases and phosphatases in Arabidopsis is ∼1100 and ∼150, respectively (reviewed in (Uhrig et al., 2013; )). Only calcium-dependent protein kinase 1 (CPK1) and glyoxysomal protein kinase 1 (GPK1) were reported as peroxisome targeted protein kinases (; ; ) with no information about their impact on peroxisome function.
In this study, we screened the Arabidopsis kinome for potential PTS1 sequences, studied their conservation and experimentally investigated 31 protein kinases harboring putative PTS1s or PTS1-like tripeptide sequences. We confirmed functional peroxisomal targeting signals that belong to twelve of these protein kinases and studied the subcellular localization for eight of their full-length proteins. Seven additional protein kinases have previously been implicated as peroxisomal or at least harboring functional PTS1s. Here, we have used an array of approaches to confirm or refute these seven as true peroxisomal proteins. The peroxisomal protein kinase types, sequence relationship, and expression were studied, and several homozygous T-DNA insertion lines were isolated. These mutants were tested for sugar dependence phenotypes, implicating a role for one protein kinase in the peroxisomal degradation of fatty acids.
Materials and Methods
Gene Cloning for in Planta Expression
The 31 fusion constructs Supplementary Table 1 of the protein kinase peroxisomal targeting domains (PTD) were amplified from enhanced yellow fluorescent protein (EYFP) template using forward primer (CACCATGGCAATGGTGAGCAAGGGCGAGGAG) and reverse synthesized primers obtaining the sequence that covers each C-terminal decapeptide of each (primer sequences are in Supplementary Table 2). Arabidopsis protein kinases cDNAs were either amplified from isolated RNA or obtained from the ABRC (Columbus, OH, United States) and RIKEN BioResource Center (Ibaraki, Japan), for more details see Supplementary Table 3. The amplified cDNAs were cloned/subcloned into pCAT-EYFP vector (; ) to create N-terminal protein fusions with EYFP. The subcloning vector has a 35S promoter of cauliflower mosaic virus with a duplicated enhancer region and a 35S polyadenylation site.
RT-PCR
Total RNA was extracted using RNAeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol. First-strand cDNA synthesis was performed using Superscript IV reverse transcriptase (Invitrogen, Carlsbad, CA, United States) in a 20-µl standard reaction mixture containing gene-specific primers. PCR amplification was done using the Expand High FidelityPLUS PCR System (Roche, Mannheim, Germany). Primers for RT-PCR amplifications, and cloning are found in Supplementary Table 3.
Bioinformatics
Sequencing the recombinant constructs was accomplished by Seqlab (Gottingen, Germany) using their facility of Extended Hotshots reactions and the DNA Core DNA services, the University of Calgary (Calgary, Canada). The general promoters T7, SP6, 35S, and NOS terminator primers were used for sequencing in pGEM-T Easy and EYFP-containing plasmids. Sequence analysis was done using Vector NTI (Invitrogen, Carlsbad, CA, United States) in combination with web-based programs for reversing DNA (http://www.bioinformatics.org/SMS/rev_comp.html) and protein translation (http://us.expasy.org/tools/dna.html).
Sites used for predicting PTS1 scores are PredPlantPTS1, http://ppp.gobics.de/ (; Reumann et al., 2012) and PPero, https://biocomputer.bio.cuhk.edu.hk/PP/ (Wang et al., 2017). The prediction threshold was reported to be 0.412 and 0.218 for the PWM and RI models, respectively. To further facilitate the prediction, model-specific posterior probabilities were used to quantify the peroxisome targeting probability (). PPero, a new computational model for predicting PTS1 was developed and reported to improve the PTS1 prediction where the coauthors used and compared their scores with the posterior probability from Lingner et al. and set their prediction threshold to 1.5 (; Wang et al., 2017). PPero developed a bi-profile Bayesian SVM method to extract and learn position-based amino acid features for both PTS1 motifs and their extended adjacent sequences (beyond 14 aa) in plants (Wang et al., 2017). Phylogenetic relationships were inferred by preferential alignments of the protein sequences obtained from NCBI. This was done using the program MEGAx () and vector NTI (Invitrogen, Carlsbad, CA, United States).
Transformation and Microscopy
For transformation analysis in onion epidermal cells and Nicotiana tabacum leaves, plasmids were transiently introduced by a helium-driven particle accelerator (PDS/1000; Bio-Rad, Hercules, CA, United States). The bombarded tissues were incubated for one to 2 days in the dark at room temperature and then observed under the microscope. Peroxisomal markers used were gMDH-CFP () that contains 50 N-terminal amino acids (including the PTS2) from Cucumis sativus glyoxysomal malate dehydrogenase linked with cyan fluorescent protein, and RFP::SKL that contains red fluorescent protein fused with the tripeptide Ser-Lys-Leu to have a C-terminal PTS1 (Matre et al., 2009). Epifluorescence and confocal imaging microscopy and image processing were carried out following the procedures described in , Uhrig et al. (2017), . Typically, 5 to 10 images were captured for each construct in three independent experiments, with a representative image shown. Figures 3–5 and Supplementary Figures 3–5 are showing localization images, which were captured by confocal and epifluorescence imaging, respectively for the same constructs.
Plant Growth
Arabidopsis (Col-0) WT and T-DNA lines were obtained from the European Arabidopsis Stock Centre (Nottingham, United Kingdom, see Supplementary Table 4). Homozygous mutant selection was performed by PCR using primers (see Supplementary Table 4 for genotyping primers sequences) for the T-DNA insertion lines recommended at the SALK institute website SIGnAL (http://www.signal.salk.edu/tdnaprimers.2.html). For plant material grown on soil, seeds were sown directly in a regular soil plant mix. Seeds were stratified for 2 days and transferred to standard growth conditions.
Sugar Dependence Assay
For sugar dependence analysis, seeds of WT Col-0 and mutant were sown on ½ MS medium with vitamins (SIGMA, United States) with or without 1% (w/v) sucrose and stratified in the dark at 4°C for 2 days before being transferred to light for 8 h, and subsequently to darkness at 20°C. Five-day-old seedlings were scanned, and hypocotyl length was measured using ImageJ (Schneider et al., 2012) (http://rsb.info.nih.gov/ij/).
Accession Numbers
Accession numbers are provided in Supplementary Table 1 and Table 1.
TABLE 1
| AGI | Annotation | Acronym (TAIR) | Kinase number | Full-length localization Oniona | Full-length localization tobaccoa | PTDb | PTDPeroxisomal localizationc |
|---|---|---|---|---|---|---|---|
| Confirmed peroxisomal localization | |||||||
| AT5G07180.1 | Receptor-like kinase; ERECTA-LIKE 2 | ERL2 | K1 | Punctate structures | Peroxisomes | FREDISKSSL | This study |
| AT5G60300.3 | L-type lectin receptor kinase I.9 | LECRK-I.9, P2K1, DORN1 | K2 | Punctate structures, aggregates | Peroxisomes | LFFFLQLARL | This study |
| AT4G13190.1 | Protein kinase superfamily protein | PBL24 | K3 | Punctate structures, nucleus? | Peroxisomes, nucleus? | ESPRDVYSLL | This study |
| AT5G49660.1 | Leucine-rich repeat transmembrane protein kinase family protein | CEPR1, XIP1 | K4 | Punctate structures | Peroxisomes | VSDHLTQTRL | This study |
| AT3G57760.1 | Protein kinase superfamily protein | ZRK6 | K8 | Punctate structures, nucleus? | Peroxisomes | SNNRSQMSSI | This study |
| AT4G31230.1 | Kinase with adenine nucleotide alpha hydrolases-like domain-containing protein | PK2 | K13 | Cytosol, punctate structures, nucleus? | Peroxisomes, nucleus?, cytosol | TESQTSSPKL | |
| AT3G08720.1 | Serine/threonine protein kinase 2 | ATPK19, ATPK2, PK6 | K15 | Punctate structures, network-like | Peroxisomes | SFLHRTTSNL | |
| AT3G20530.1 | Protein kinase superfamily protein | PBL23, PK1 | K16 | Punctate structures | Peroxisomes | EEEEDERSKL | ; ; Wang et al., 2017 |
| Partial peroxisomal localization | |||||||
| AT2G26830.1 | Protein kinase; Embryo defective 1187; Choline/Ethanolamine kinase 4 | CEK4, EMB1187 | K5 | Cytosol, nucleus? | Cytosol, nucleus? partly in peroxisomes | LVTSHLSASL | This study |
| AT1G76540.1 | Cyclin-dependent kinase | CDKB2-1 | K6 | Cytosol, network-like, nucleus? | Network-like, partly in peroxisomes | FDDLPEKSSL | This study |
| AT3G17420.1 | Glyoxysomal protein kinase 1 | GPK1, PK7 | K17 | Cytosol, little punctate structures | Partially in peroxisomes | DNDITTDAKI | |
| AT5G03730.1 | Constitutive triple response 1; sugar insensitive 1 | CTR1, SIS1 | K19 | Punctate structures, nucleus? | Partially in peroxisomes | AVPPPNRSDL | |
| Non-peroxisomal localization and untested full-length protein kinases | |||||||
| AT1G29720.1 | Transmembrane protein kinase | RFK1 | K9 | ND | ND | STVENSSSSL | This study |
| AT5G51560.1 | Leucine-rich repeat protein kinase family protein | ND | K10 | ND | ND | HELGNCSSCL | This study |
| AT1G34420.1 | Leucine-rich repeat transmembrane protein kinase family protein | ND | K11 | ND | ND | KTVLRMLTRL | This study |
| AT1G74330.1 | Protein kinase superfamily protein | ND | K12 | ND | ND | KKILLFSSEL | This study |
| AT3G61960.1 | Protein kinase superfamily protein | ATG1A, ATPK4 | K7 | Cytosol | Cytosol, network-like | SNLQHRRSHL | This study; |
| AT1G69270.1 | Receptor-like protein kinase 1 | RPK1, PK5 | K14 | Cytosol, network-like | Cytosol, network-like | LLKRIQPSRL | ; Narsai et al., 2011 |
| AT5G04870.1 | Calcium-dependent kinase 1 | CPK1 | K18 | Cytosol, network-like | Cytosol, network-like | EKSFSIALKL | |
Summary of full-length protein kinases and peroxisomal targeting validation studies. Protein kinase candidates found to harbor functional PTS1s (from this study and previous studies) and those found in a previous peroxisomal proteome are listed. The table is divided into three parts: protein kinases targeted to punctate structures in onion and co-localized with a peroxisomal marker in tobacco; protein kinases targeted partly to peroxisomes in tobacco and remained undetected in onion; non-peroxisomal targeting in both tobacco and onion, and untested protein kinases that harbor functional PTS1. All candidate full-length cDNAs were either subcloned or cloned N-terminally with EYFP from plasmids provided by ABRC or RICKEN or isolated Arabidopsis total RNA (Supplementary Table 3). Only 4 of 12 protein kinase cDNAs were not retrieved.
The results of subcellular localization of EYFP fusions in onion epidermal cells and tobacco, respectively (Figures 3–5; Supplementary Figures 3–6).
The cloned presumptive PTD (C-terminal decapeptides of each kinase).
The study where the PTS1/PTD investigation was reported. ND, not determined.
Results
Bioinformatic Screening for Putative Peroxisomal Signals in the Arabidopsis Kinome
The updated Arabidopsis peroxisomal proteome harbors approximately 200 unique members (catalogued in Pan and Hu (2018)). However, to date, only two peroxisomal protein kinases have been reported by proteomic and subcellular localization studies. The fragile nature and the low number of peroxisomes in cells have made it difficult to identify low-abundance proteins, some of which may only transiently shuttle into peroxisomes under special circumstances (; ). To determine protein kinase candidates for their peroxisomal localization, the Arabidopsis kinome (Zulawski et al., 2014) was searched for the presence of canonical and non-canonical PTS1s. Our search utilized the prediction tools position-specific weight matrices (PWM) and residue interdependence (RI) models in identifying putative PTS1s (). We extracted scores for seven unstudied protein kinases (Supplementary Table 1), which are predicted to harbor functional PTS1 tripeptides (SSL>, ARL>, SQM>, SLL>, SEL>, KRL>, SEL>) at their C-termini. Also, using the newly developed model “PPero”, we were able to extract seven additional protein kinases that harbor putative PTS1s (SKD>, 3 with SSL>, SCL>, 2 with SHL>), that were not detected by the PWM or RI models (Supplementary Table 1).
Although these prediction algorithms are able to correctly infer peroxisomal targeting for many plant proteins, it is advised to use caution and verify predictions because in the past several below-threshold examples proved to be positive, and some predicted examples failed to target to peroxisomes (; ; ; Wang et al., 2017). Taking this into consideration, we expanded our selection to include several candidates located below the threshold of all prediction methods. Thus, we included several candidates harboring non-canonical PTS1s (TRL>, GKL>, SLM>, ASL>, SSL>, ANL>, SEM>), or tripeptides with novel residues at different positions (SIM>, SGM>, RRL>) (Supplementary Table 1). Canonical tripeptides are the dominant signals of high-abundance peroxisomal proteins and are sufficient for peroxisomal targeting, while non-canonical signals are usually found in low-abundance peroxisomal proteins and require target enhancing elements, which are located upstream of the tripeptide and generally fall in the next seven residues N-terminal to the PTS1 (). We also selected two protein-kinase candidates found harboring KRR>, an unusual tripeptide reported to be a functional PTS1 (Ramirez et al., 2014). Because the Q at position -3 was reported in QRL> () and KM> recently was reported in a novel PTS1 (PKM>, ()), we added a protein kinase ending with QKM> to our list. In total, we gathered 31 protein kinase candidates that harbor putative functional PTS1s.
Conservation of PTS1-Like Tripeptides in Protein Kinase Orthologs
To further support our selection process, we examined if the candidate PTS1 or the PTS1-like tripeptides are conserved (Supplementary Figure 1). We extracted orthologous sequences using BLAST and performed alignments. Our analysis used two major parameters for finding orthologs: 1) the conservation of predicted putative PTS1 tripeptides, and 2) the presence of divergent, but known PTS1 tripeptides in the ortholog. Out of the 31 candidates, 15 displayed conservation of their putative PTS1s, including 10 with wide conservation in planta (Supplementary Figure 1). For the PWM-selected candidates, the protein kinases AT4G13190.1 and AT3G24790.1 ending with the PTS1 tripeptides SLL> and SQM>, respectively, were found to have conservation of the PTS1 in their orthologs (see PTD3 and PTD15 in Supplementary Figure 1). The PWM and RI predicted candidate, AT5G60300.3 (ARL>), has only two orthologs with the PTS1 tripeptides QRL>, and ASL>, respectively (see PTD2 in Supplementary Figure 1). For the PPero-selected candidates, six had wider conservation of the PTS1 tripeptides (Supplementary Figure 1). For example, the tripeptides SHL> and SCL> were widely conserved and fulfilled parameter 1 in the orthologs of AT3G61960.1 and AT5G51560.1, respectively (see PTD7 and PTD10 in Supplementary Figure 1). The rest of the PPero-selected candidates fulfilled both conservation parameters (see PTD1, PTD9, PTD23, and PTD26 in Supplementary Figure 1). The targeting sequence conservation supports the idea that this group of protein kinases reside in peroxisomes and encouraged us to pursue further studies.
Additional candidates were found to have a conserved PTS1 in their orthologs. For example, AT2G26830.1 (ASL>), AT3G57760.1 (SSI>), and AT1G66880.1 (ASL>) have limited orthologs that are found primarily in the same family/tribe (Brassicaceae/Camelineae). AT2G26830.1 has an ortholog from the genus Capsella (Capsella rubella, SSV>) and other two orthologs with SSV> and SSL> (see PTD5 in Supplementary Figure 1). AT3G57760.1 retrieved one ortholog with STI> (see PTD8 in Supplementary Figure 1) from the same genus as Arabidopsis (Arabidopsis lyrata). AT1G66880.1 retrieved several orthologs with the PTS1-tripeptide in the genus Arabidopsis and Capsella, in addition to two in Camelina sativa with ASL> (see PTD24 in Supplementary Figure 1). This pattern of limited conservation aligns with the evolution of peroxisomal signals such as seen for the PP2A B’θ-SSL> signal, which was found to be limited to the same family/tribe (Brassicaceae/Camelineae) (; ). The candidates: AT5G49660.1 (TRL>), AT1G34420.1 (TRL>), and AT1G76540.1 (SSL>) were found to have a broader conservation of PTS1 (Supplementary Figure 1). These outcomes strengthen the probability that these expanded selected candidates have functional peroxisomal targeting signals.
Experimental Validation of Protein Kinase PTS1s
Peroxisomal Targeting With Protein Kinase C-Terminal Residues
To study the functionality of the protein kinase C-terminal tripeptides as peroxisomal targeting signals, we fused the C-terminal ten residues of the selected 31 protein kinases to EYFP (Supplementary Table 2) and performed subcellular localization. This screening step was performed in onion epidermal cells due to the ease of the bombardment procedure and visualization. Of the 31 fusion proteins, 12 sequences containing either canonical or non-canonical signals were found to target punctate structures that resemble peroxisomes when transformed (Supplementary Figures 2A–L). Having 12 potential positive localizations, the peroxisomal identity of these structures was determined by co-localization studies through co-transformation with PTS2-CFP derived from the peroxisomal protein gMDH (Figures 1A–L). One of these kinase derived constructs (PTD7, SHL>, Figure 1G; Supplementary Figure 1G; from AT3G61960) acted as an experimental positive control because it was shown previously to target to peroxisomes, but was only predicted by PPero (; Wang et al., 2017). The other 19 constructs appeared to remain in the cytosol and lacked any organelle or structure-like targeting (Supplementary Table 1; data not shown). This approach allowed us to identify 11 novel functional peroxisomal protein kinase C-terminal tripeptides (3 with SSL>, ARL>, SSL>, SCL>, 2 with TRL>, ASL>, SEL>, SSI>) (Supplementary Table 1; Figure 1) and confirm 1 previously studied protein kinase sequence that targets peroxisomes. Of the 12, 7 (three for PWM and 4 for PPero) were predicted, while five signals fell below the prediction thresholds, but were selected for study here (Supplementary Table 1; Figure 1). We will refer to them as protein kinases 1-12, or K1-K12.
FIGURE 1
The sequence immediately N-terminal to the last three residues of the peroxisomal targeting protein includes the target enhancing or inhibiting elements and can affect targeting both positively and negatively and along with the last three residues is referred to as the PTD, or peroxisomal targeting domain. In general, basic residues, especially R, at positions -4 and -6 and proline (P) at -7 from the C-terminus enhance peroxisomal targeting (
FIGURE 2

Logo plots for the peroxisomal versus cytosolic localized putative peroxisomal targeting domain (PTD) sequences of the 31 selected protein kinases. The 31 PTD sequences that were fused to EYFP are grouped according to their bioinformatic selection method and their final localization (peroxisome or cytosol). The height of each letter represents the frequency of the corresponding amino acid at each position. Logos were done using https://skylign.org/ (Wheeler et al., 2014). Peroxisomal refers to targeting of EYFP-PTD fusions to labelled peroxisomes in vivo, while cytosol refers to the accumulation of EYFP-PTD in the cytosol. Plots are based on the outcome of experiments shown in Figure 1 and Supplementary Figure 2. Details of sequence, scores and localizations are provided in Supplementary Table 1.
Subcellular Localization of Full-Length Protein Kinases
To investigate the peroxisomal targeting of the full-length protein kinases with the newly identified functional peroxisomal signals, we amplified the cDNA from either cDNA-clones or RNA (Supplementary Table 3). Out of 12 candidates harboring functional PTDs, we were able to amplify and fuse eight full-length protein kinases N-terminally with EYFP. The EYFP-kinase fusions were first investigated in onion epidermal cells for their subcellular localization through biolistic transformations. Results indicated that four kinases (K1-K4) were found targeting to punctate structures (Supplementary Figures 3A–D; Table 1), and three (K5-K7) remained primarily in the cytosol (Supplementary Figures 3E–G; Table 1), while K8 targets both punctate structures and a region that is likely the nucleus (Supplementary Figure 3H; Table 1). To confirm or refute the results with onions, we switched to Nicotiana tabacum because, like Arabidopsis, tobacco is a dicot and has fewer, larger peroxisomes making co-localization studies easier. Subcellular localization in Nicotiana tabacum (Havana) leaves was performed through biolistic transformations in the presence of a peroxisomal marker (RFP-SKL>) using confocal (Figures 3, 4) and epifluorescence microscopy (Supplementary Figures 4, 5) in several independent experiments with similar outcomes. Using this approach, K1-K4 proved to be peroxisomal (Figures 3A–D; Supplementary Figures 4A–D; Table 1). In addition to peroxisomes, K3 (AT4G13190) appeared to target the nucleus as well (Supplementary Figure 4C).
FIGURE 3

In vivo targeting of full-length RLK and RLCKs. Nicotiana tabacum cells were transformed with EYFP fusion constructs that were C-terminally fused with Arabidopsis protein kinase full-length cDNAs that are annotated as receptor-like or receptor-like cytosolic kinases. These RLK/RLCKs were shown to have functional PTS1s (Figure 1; Supplementary Table 1) and here their full-length fusion constructs targeted to punctate structures that coincided with RFP::SKL> in peroxisomes. Shown left to right are EYFP-kinase (A1), RFP::SKL signals (A2), and merge (A3). The protein kinase expressed as an EYFP fusion is shown in brackets (accession) and annotated K# as defined in Table 1. Representative images (produced by confocal microscopy) are shown. Scale bars are 5 μm.
FIGURE 4

In vivo targeting of full-length soluble protein kinases. Nicotiana tabacum cells were transformed with EYFP fusion constructs that were C-terminally fused with Arabidopsis protein kinase full-length cDNAs. These protein kinases were shown to have functional PTS1s (Figure 1; Supplementary Table 1) and their full-length fusion constructs were targeted to either cytosol, punctate structures that coincided with RFP::SKL> in peroxisomes, or both. Shown left to right are EYFP-kinase (A1), RFP::SKL signals (A2), and merge (A3). The protein kinase expressed as an EYFP fusion is shown in brackets (accession) and annotated K# as defined in Table 1. Circles and arrows represent co-localized EYFP and RFP signals in peroxisomes in C1–3 and D1–3. Representative images (produced by confocal microscopy, except for E, which was done by epifluorescence microscopy) are shown. Scale bars are 5 μm.
In tobacco leaves the protein kinase K5 (At2g26830; Table 1) fusion targeted primarily to the cytosol and possibly to the nucleus (Figure 4A; Supplementary Figure 5A), but also partially coincided with the RFP-SKL in peroxisomes in different cell types (Figure 4B; Supplementary Figure 5B). The cyclin-dependent kinase, K6 (At1g76540; Table 1) was mostly localized to the cytosol and network-like structures, but also proved to partially target to peroxisomes (Figures 4C,D; Supplementary Figure 5C). Although having a functional and conserved PTS1, K7 (AT3G61960) failed to target to peroxisomes and remained in the cytosol and a network-like structure surrounding the nucleus, which resembles ER (Figure 4E; Supplementary Figure 5D) similar to a previous investigation (
Re-Examination of Protein Kinases Predicted to Target Peroxisomes
Previously, three studies have investigated several putative peroxisomal protein kinases (
FIGURE 5

In vivo targeting of previously reported peroxisomal protein kinases. Nicotiana tabacum cells were transformed with EYFP fusion constructs that were C-terminally fused with Arabidopsis full-length cDNAs (K13-K19). These proteins were previously shown to have functional PTS1s and/or detected in isolated peroxisome proteomes (see Table 1 for details), but their full-length peroxisomal targeting was not previously validated. Shown left to right are EYFP-kinase (A1), RFP::SKL> signals (A2), and merge (A3). The protein kinase expressed as an EYFP fusion is shown in brackets (accession) and annotated K# as defined in Table 1. Representative images (produced by confocal microscopy) are shown. Scale bars are 5 μm.
Investigating GPK1, CPK1, and CTR1 Peroxisome Import
GPK1, CPK1 and constitutive triple response 1 (CTR1) have been previously implicated as peroxisomal protein kinases. K17 (GPK1, AT3G17420) was previously identified in the proteome of Arabidopsis glyoxysomes (specialized peroxisomes) (
K18, calcium-dependent protein kinase 1 (CPK1), was previously reported to target to peroxisomes and lipid bodies in an N-myristoylation dependent-fashion (
K19, (CTR1; SDL>) harbors an atypical predicted PTS1 due to the presence of N-terminal target enhancing residues (
Sequence, Phylogenetic, and Expression Analysis of the Peroxisomal Protein Kinases
The Arabidopsis protein kinases have been catalogued and a recent sequence and phylogenetic analyses divided the protein kinases into so called “soluble”, “receptor-like” (RLK; have a transmembrane and extracellular domain) and “receptor-like but lacking a transmembrane and extracellular domain, therefore likely cytosolic” (RLCK), plus a few non-categorized protein kinases (Zulawski et al., 2014). Mapping K1-K19 onto this tree shows the peroxisomal kinases are distributed broadly in each group (soluble, RLK and RLCK). Table 1 is a list of the 19 peroxisome protein kinases studied here (12 identified in this study plus 7 previously studied). Most of these kinases harbor a non-canonical PTS1 (Figure 2; Supplementary Figure 8). These kinases belong to the subclades/superfamilies LRR clade 1, 2, 3, 4, and 11, RLCK 9, RLCK clade2, L-LPK, mixed clade 1, CDK and AGC (Zulawski et al., 2014). To gain potential insight into the function of each peroxisomal protein kinase we generated a phylogenetic tree with the sequences of K1-K19 plus 86 protein kinases with defined roles (Zulawski et al., 2014). This is presented in Supplementary Figure 9. It is interesting to note that K6 (cyclin-dependent kinase B2/ CDKB2) resides nearest CDKA1 and both are described as regulators of mitosis and RNA polymerase II CTD heptapeptide repeat kinases. K12 groups with CDKF1, which is in fact a CDK activating kinase (CAK) that phosphorylates and activates CDKs, suggesting that K12 may be K6’s (CDKB2) activating kinase in the peroxisome. Two other groupings of interest are K3 and K16 which sit near the protein kinase PBS1 that is involved in PAMP-triggered immunity signaling and defense responses downstream of FLS2 (Rao et al., 2018).
Different factors and conditions are expected to influence protein kinase targeting and the exposure of PTS1 to the PEX5 peroxisome receptor for import into peroxisomes. Therefore, it is of importance to study the PTMs and expression of these kinases to ultimately decipher their roles. In addition to K18 (CPK1), K12 (AT1G74330) has a predicted N-myristoylation site (Zulawski et al., 2014). Several of these protein kinases are phosphorylated at multiple sites with K13 having 22 mapped phospho-sites. Four kinases (K15, K16, K17 and K19/CTR1) are phosphorylated in their activation loops, and several phosphopeptides appear to be tissue specific (Zulawski et al., 2014; Mergner et al., 2020). The transcripts of these kinases are found in most tissues and developmental stages as seen in the public GENEVESTIGATOR (microarray, Supplementary Figures 10, 11), and ATHENA (RNAseq/proteome) databases (Zimmermann et al., 2008; Mergner et al., 2020). In addition, several kinase transcripts are found either induced or suppressed in response to external perturbations such as biotic and abiotic stresses (Supplementary Figure 12). Peroxisomes are now known to be involved in several stress response pathways through the synthesis of a jasmonic acid (JA) precursor via 12-oxophytodienoate reductase isoform 3 (OPR3) and β-oxidation, and salicylic acid (SA) signaling and antifungal defense through the peroxisomal enzyme PEN2 myrosinase (reviewed in (
Isolating Kinase Knockout Mutants and Investigating Links to Fatty Acid β-Oxidation
Fatty acid β-oxidation is important for seedling development, and growth is halted in mutants deficient in this process, unless exogenous sucrose is provided. As most β-oxidation enzymes are phosphorylated (
FIGURE 6

The T-DNA knock-out lines of K17 (GPK1) seedlings show sugar dependency. To investigate the potential role of the peroxisomal protein kinases in fatty acid β-oxidation, we performed a sucrose dependence assay on selected homozygous lines (details of the lines and the results are summarized in Supplementary Table 4). Hypocotyl length (cm) of seedlings grown for 1 day in light followed by 5 days in the dark on one-half-strength Murashige and Skoog (MS) medium with or without 1% sucrose. Only, K17 (SAIL_1250_C08) mutant seedlings show significant sucrose dependence phenotypes when compared to WT (Supplementary Table 4, data not shown). To further confirm the K17 knockout mutant phenotype, an additional T-DNA mutant “K17_SALK_047485” seedling was investigated and displayed a significant sugar dependence phenotype. The PEX14 mutant control seedlings also show a significant sucrose dependence phenotype when compared to WT. Columns marked with three stars are significantly different from WT at p < 0.01 (Student’s t-test). The experiments were repeated three times with more than 50 seedlings; error bars represent standard deviation.
CPK1 (K18) is targeted to the membranes of oil bodies and peroxisomes, and previously has been implicated in regulating triacylglycerol degradation in oil bodies, fatty acid β-oxidation in peroxisomes, and possible crosstalk between these organelles during early germination (
Discussion
Identifying Functional Protein Kinase PTS1 Signals
Over the past 2 decades, a combination of methods (proteomics, prediction algorithms, and subcellular verification tools) has helped identify ∼200 peroxisomal proteins and suggested many new functions for plant peroxisomes, as compiled in recent reviews (Pan and Hu, 2018;
Testing Peroxisomal Targeting of Full-Length Protein Kinases
From the 12 newly identified PTS1 signals, we confirmed the ability of 7 full-length protein kinases (K1-K6 and K8) to target to peroxisomes as predicted. We also were able to re-examine a group of additional protein kinases that harbor functional PTS1 tripeptides (K13-16, K18, and K19/CTR1) or were previously detected in the peroxisomal proteome (K17) (
Although having a predicted PTS1, K17 (GPK1) was the only protein kinase that had a non-functional PTS1 but has been found in the glyoxysome proteome (
Subcellular targeting within the eukaryotic cell is governed by a sophisticated suite of protein-protein interactions specific to the subcellular compartment. It is precisely this specificity that prevents mistargeting of proteins. The flexibility in the protein kinases PTS1 amino acid substitutions likely indicates functional specificity, but we cannot eliminate the possibility that these changes are functionally irrelevant or are an evolutionary artifact. Determining the relevance of these substitutions is the arduous challenge of the plant cell biology community. From our new and re-examined peroxisomal protein kinases, we developed an inventory of 19 protein kinases that are associated with Arabidopsis peroxisomes (Table 1) with some having a canonical PTS1, but with the majority having a non-canonical PTS1 (Supplementary Figure 8). The prevalence of non-canonical and weak targeting PTS1s in the peroxisomal kinases is possibly due to a need for weak binding with PEX5 to prevent over-accumulation or to allow proper folding inside peroxisomes. This idea is supported by catalase, which needs a weak PTS1 for proper targeting, and if changed to a strong PTS1 (SKL>) leads to accumulation of catalase protein aggregates (Williams et al., 2012).
The 19 protein kinases from this study are predicted by SUBA to target plasma membrane, extracellular, cytosol, or nucleus (
Linking Peroxisomal Protein Kinases to Cell Function
The Arabidopsis peroxisomal protein kinases have previously been grouped into receptor kinases (RLKs), receptor-like cytoplasmic kinases (RLCKs), soluble and unclassified kinases (Supplementary Figure 9). Here, K1-2, 4, 9–11, 13–14 are RLKs, and 16–17 RLCKs (Supplementary Figure 9). Transcripts for two RLKs, K1 and K11, were downregulated and upregulated, respectively, in response to biotic stress and different elicitors (Supplementary Figure 12). K1 and K11 reside in the same clade with several leucine-rich repeat receptor kinases (LRR-RKs) including the pattern recognition receptors EFR and FLS2, which might imply importance in peroxisome signaling and crosstalk with other organelles and pathways (Supplementary Figure 9). This also aligns with the prediction and experimental verification of a number of resistance proteins of the nucleotide-binding site leucine-rich repeat (NB-LRR) protein family targeting peroxisomes, and may play major roles in signaling during innate immunity (
CPK1, a soluble kinase, has been associated with peroxisomes and is known to have a stress-response role based upon gene induction by fungal elicitors and susceptibility to both biotic and abiotic stresses when knocked out (
We demonstrate that protein kinase K19/CTR1 targets to peroxisomes (Figure 5G). We speculate that placing the fluorophore on the N-terminus to expose the C-terminal PTD, may have blocked ER localization, but also allowed recognition of the PTD by the peroxisome import machinery. The CTR1 PTD may normally be masked letting the enzyme reside in the ER, then under certain conditions, it is exposed to allow peroxisome import. Indeed, CTR1 was suggested to be quarantined in peroxisomes under stress, which could be an alternative strategy for the cell to regulate stress responses (Sorhagen et al., 2013;
Our results demonstrate that many more protein kinases can target the peroxisome than previously thought and that more variant, but functional PTD sequences exist. This leads us to speculate that the protein kinases studied here, perhaps additional protein kinases and even other proteins could reside in the peroxisome (or be excluded) depending on cellular conditions, cell or tissue types. Perhaps this is not surprising given the abundance of protein phosphorylation in the peroxisome, the growing list of peroxisome functions and the dynamic nature of this organelle (
GPK1 (K17) Is Associated With Fatty Acid β-Oxidation
The reduced ability of K17/GPK1 mutant line to elongate their hypocotyls in the dark unless provided with sucrose implicates K17/GPK1 protein kinase as a regulator of fatty acid β-oxidation. Phosphorylation of glyoxosomal proteins was reported biochemically to occur in the presence of various metal ions and ATP (
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Author contributions
AK designed the research; AK, NG, and MJ performed the experiments; AK, MS, DM, JT and GM wrote the manuscript. All authors have seen and approved the manuscript and its contents and are aware of the responsibilities connected to authorship.
Funding
This research was supported by the Research Council of Norway grant (251310/F20) to AK and Natural Sciences and Engineering Research Council of Canada to GM.
Acknowledgments
Thanks to Jianping Hu (PRL, Michigan, United States) for supplying cpk1 seeds.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2022.745883/full#supplementary-material
References
1
AgrawalG.SubramaniS. (2016). De Novo peroxisome Biogenesis: Evolving Concepts and Conundrums. Biochim. Biophys. Acta (Bba) - Mol. Cel Res.1863, 892–901. 10.1016/j.bbamcr.2015.09.014
2
AlbertsM. E.ChuaG.MuenchD. G. (2019). Exposure to Naphthenic Acids and the Acid Extractable Organic Fraction from Oil Sands Process-Affected Water Alters the Subcellular Structure and Dynamics of Plant Cells. Sci. Total Environ.651, 2830–2844. 10.1016/j.scitotenv.2018.10.181
3
Arabidopsis Interactome MappingC. (2011). Evidence for Network Evolution in an Arabidopsis Interactome Map. Science333, 601–607. 10.1126/science.1203877
4
BookerM. A.DelongA. (2017). Atypical Protein Phosphatase 2A Gene Families Do Not Expand via Paleopolyploidization. Plant Physiol.173, 1283–1300. 10.1104/pp.16.01768
5
BuentzelJ.ThomsS. (2017). The Use of Glycosylation Tags as Reporters for Protein Entry into the Endoplasmic Reticulum in Yeast and Mammalian Cells. in Peroxisomes: Methods and Protocols. Editor SchraderM. (New York, NY: Springer New York), 221–232. 10.1007/978-1-4939-6937-1_21
6
BussellJ. D.BehrensC.EckeW.EubelH. (2013). Arabidopsis Peroxisome Proteomics. Front. Plant Sci.4, 101. 10.3389/fpls.2013.00101
7
Cassin-RossG.HuJ. (2014). Systematic Phenotypic Screen of Arabidopsis Peroxisomal Mutants Identifies Proteins Involved in β-Oxidation. Plant Physiol.166, 1546–1559. 10.1104/pp.114.250183
8
ChowdharyG.KatayaA. R.LingnerT.ReumannS. (2012). Non-canonical Peroxisome Targeting Signals: Identification of Novel PTS1 Tripeptides and Characterization of Enhancer Elements by Computational Permutation Analysis. BMC Plant Biol.12, 142. 10.1186/1471-2229-12-142
9
CocaM.San SegundoB. (2010). AtCPK1 Calcium-dependent Protein Kinase Mediates Pathogen Resistance in Arabidopsis. Plant J.63, 526–540. 10.1111/j.1365-313x.2010.04255.x
10
DammannC.IchidaA.HongB.RomanowskyS. M.HrabakE. M.HarmonA. C.et al (2003). Subcellular Targeting of Nine Calcium-dependent Protein Kinase Isoforms from Arabidopsis. Plant Physiol.132, 1840–1848. 10.1104/pp.103.020008
11
FrickE. M.StraderL. C. (2018). Kinase MPK17 and the Peroxisome Division Factor PMD1 Influence Salt-Induced Peroxisome Proliferation. Plant Physiol.176, 340–351. 10.1104/pp.17.01019
12
FukaoY.HayashiM.Hara-NishimuraI.NishimuraM. (2003). Novel Glyoxysomal Protein Kinase, GPK1, Identified by Proteomic Analysis of Glyoxysomes in Etiolated Cotyledons of Arabidopsis thaliana. Plant Cel Physiol44, 1002–1012. 10.1093/pcp/pcg145
13
FukaoY.HayashiM.NishimuraM. (2002). Proteomic Analysis of Leaf Peroxisomal Proteins in Greening Cotyledons of Arabidopsis thaliana. Plant Cel Physiol43, 689–696. 10.1093/pcp/pcf101
14
FuldaM.ShockeyJ.WerberM.WolterF. P.HeinzE. (2002). Two Long-Chain Acyl-CoA Synthetases fromArabidopsis Thalianainvolved in Peroxisomal Fatty Acid β-oxidation. Plant J.32, 93–103. 10.1046/j.1365-313x.2002.01405.x
15
GouldS. G.KellerG. A.SubramaniS. (1987). Identification of a Peroxisomal Targeting Signal at the Carboxy Terminus of Firefly Luciferase. J. Cel Biol105, 2923–2931. 10.1083/jcb.105.6.2923
16
GutierrezC. (2009). The Arabidopsis Cell Division Cycle. The Arabidopsis Book7, e0120. 10.1199/tab.0120
17
HayashiM.NitoK.Toriyama-KatoK.KondoM.YamayaT.NishimuraM. (2000). AtPex14p Maintains Peroxisomal Functions by Determining Protein Targeting to Three Kinds of Plant Peroxisomes. EMBO J.19, 5701–5710. 10.1093/emboj/19.21.5701
18
HooperC. M.CastledenI. R.TanzS. K.AryamaneshN.MillarA. H. (2016). SUBA4: the Interactive Data Analysis centre for Arabidopsis Subcellular Protein Locations. Nucleic Acids Res.45, D1064–D1074. 10.1093/nar/gkw1041
19
HuJ.BakerA.BartelB.LinkaN.MullenR. T.ReumannS.et al (2012). Plant Peroxisomes: Biogenesis and Function. Plant Cell24, 2279–2303. 10.1105/tpc.112.096586
20
JaipargasE. A.MathurN.Bou DaherF.WasteneysG. O.MathurJ. (2016). High Light Intensity Leads to Increased Peroxule-Mitochondria Interactions in Plants. Front Cel Dev Biol4, 6. 10.3389/fcell.2016.00006
21
JossierM.LiuY.MassotS.HodgesM. (2019). Enzymatic Properties of Recombinant Phospho-Mimetic Photorespiratory Glycolate Oxidases from Arabidopsis thaliana and Zea mays. Plants (Basel)9. 10.3390/plants9010027
22
JungS.MarelliM.RachubinskiR. A.GoodlettD. R.AitchisonJ. D. (2010). Dynamic Changes in the Subcellular Distribution of Gpd1p in Response to Cell Stress. J. Biol. Chem.285, 6739–6749. 10.1074/jbc.m109.058552
23
KaoY.-T.GonzalezK. L.BartelB. (2018). Peroxisome Function, Biogenesis, and Dynamics in Plants. Plant Physiol.176, 162–177. 10.1104/pp.17.01050
24
KatayaA. R. A. (2011). in Identification of Peroxisome-Targeted Proteins Implicated in Plant Innate Immunity in Arabidopsis thaliana. Editor ReumannS. (Norway): University of Stavanger).
25
KatayaA. R. A.ElshobakyA.HeidariB.DugassaN.-F.ThelenJ. J.LilloC. (2020a). Multi-targeted Trehalose-6-Phosphate Phosphatase I Harbors a Novel Peroxisomal Targeting Signal 1 and Is Essential for Flowering and Development. Planta251, 98. 10.1007/s00425-020-03389-z
26
KatayaA. R. A.HeidariB.HagenL.KommedalR.SlupphaugG.LilloC. (2015a). Protein Phosphatase 2A Holoenzyme Is Targeted to Peroxisomes by Piggybacking and Positively Affects Peroxisomal β-Oxidation. Plant Physiol.167, 493–506. 10.1104/pp.114.254409
27
KatayaA. R. A.HuJ.MuenchD. G.MoorheadG. B. (2020b). “Plant Peroxisomal Protein Kinases Implicated in Stress‐Related Responses,” in Protein Kinases and Stress Signaling in Plants, 501–517. 10.1002/9781119541578.ch22
28
KatayaA. R. A.MuenchD. G.MoorheadG. B. (2019). A Framework to Investigate Peroxisomal Protein Phosphorylation in Arabidopsis. Trends Plant Sci.24, 366–381. 10.1016/j.tplants.2018.12.002
29
KatayaA. R. A.ScheiE.LilloC. (2015b). MAP Kinase Phosphatase 1 Harbors a Novel PTS1 and Is Targeted to Peroxisomes Following Stress Treatments. J. Plant Physiol.179, 12–20. 10.1016/j.jplph.2015.03.002
30
KatayaA. R. A.ScheiE.LilloC. (2016). Towards Understanding Peroxisomal Phosphoregulation in Arabidopsis thaliana. Planta243, 699–717. 10.1007/s00425-015-2439-5
31
KimP. K.HettemaE. H. (2015). Multiple Pathways for Protein Transport to Peroxisomes. J. Mol. Biol.427, 1176–1190. 10.1016/j.jmb.2015.02.005
32
KumarS.StecherG.LiM.KnyazC.TamuraK. (2018). MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol.35, 1547–1549. 10.1093/molbev/msy096
33
KunzeM. (2020). The Type-2 Peroxisomal Targeting Signal. Biochim. Biophys. Acta (Bba) - Mol. Cel Res.1867, 118609. 10.1016/j.bbamcr.2019.118609
34
Li-BeissonY.ShorroshB.BeissonF.AnderssonM. X.ArondelV.BatesP. D.et al (2013). Acyl-lipid Metabolism. The Arabidopsis Book11, e0161. 10.1199/tab.0161
35
LilloC.KatayaA. R. A.HeidariB.CreightonM. T.Nemie‐feyissaD.GinbotZ.et al (2014). Protein Phosphatases PP 2A, PP 4 and PP 6: Mediators and Regulators in Development and Responses to Environmental Cues. Plant Cel Environ37, 2631–2648. 10.1111/pce.12364
36
LingnerT.KatayaA. R.AntonicelliG. E.BenichouA.NilssenK.ChenX. Y.et al (2011). Identification of Novel Plant Peroxisomal Targeting Signals by a Combination of Machine Learning Methods and In Vivo Subcellular Targeting Analyses. Plant Cell. 10.1105/tpc.111.084095
37
LuD.WuS.GaoX.ZhangY.ShanL.HeP. A. (2010). A Receptor-Like Cytoplasmic Kinase, BIK1, Associates with a Flagellin Receptor Complex to Initiate Plant Innate Immunity. Proc. Natl. Acad. Sci. U.S.A.107, 496–501. 10.1073/pnas.0909705107
38
LuoM.ZhuangX. (2018). Review: Selective Degradation of Peroxisome by Autophagy in Plants: Mechanisms, Functions, and Perspectives. Plant Sci.274, 485–491. 10.1016/j.plantsci.2018.06.026
39
MaC.ReumannS. (2008). Improved Prediction of Peroxisomal PTS1 Proteins from Genome Sequences Based on Experimental Subcellular Targeting Analyses as Exemplified for Protein Kinases from Arabidopsis. J. Exp. Bot.59, 3767–3779. 10.1093/jxb/ern221
40
MatreP.MeyerC.LilloC. (2009). Diversity in Subcellular Targeting of the PP2A B′η Subfamily Members. Planta230, 935–945. 10.1007/s00425-009-0998-z
41
MergnerJ.FrejnoM.ListM.PapacekM.ChenX.ChaudharyA.et al (2020). Mass-spectrometry-based Draft of the Arabidopsis Proteome. Nature579, 409–414. 10.1038/s41586-020-2094-2
42
NarsaiR.LawS. R.CarrieC.XuL.WhelanJ. (2011). In-Depth Temporal Transcriptome Profiling Reveals a Crucial Developmental Switch with Roles for RNA Processing and Organelle Metabolism that Are Essential for Germination in Arabidopsis. Plant Physiol.157, 1342–1362. 10.1104/pp.111.183129
43
NemotoK.SetoT.TakahashiH.NozawaA.SekiM.ShinozakiK.et al (2011). Autophosphorylation Profiling of Arabidopsis Protein Kinases Using the Cell-free System. Phytochemistry72, 1136–1144. 10.1016/j.phytochem.2011.02.029
44
NeuhausA.EggelingC.ErdmannR.SchliebsW. (2016). Why Do Peroxisomes Associate with the Cytoskeleton?Biochim. Biophys. Acta (Bba) - Mol. Cel Res.1863, 1019–1026. 10.1016/j.bbamcr.2015.11.022
45
OeljeklausS.SchummerA.MastalskiT.PlattaH. W.WarscheidB. (2016). Regulation of Peroxisome Dynamics by Phosphorylation. Biochim. Biophys. Acta (Bba) - Mol. Cel Res.1863, 1027–1037. 10.1016/j.bbamcr.2015.12.022
46
OikawaK.MatsunagaS.ManoS.KondoM.YamadaK.HayashiM.et al (2015). Physical Interaction between Peroxisomes and Chloroplasts Elucidated by In Situ Laser Analysis. Nat. Plants1, 15035. 10.1038/nplants.2015.35
47
PanR.HuJ. (2018). Proteome of Plant Peroxisomes. Subcell Biochem.89, 3–45. 10.1007/978-981-13-2233-4_1
48
PaudyalR.RoychoudhryS.LloydJ. P. (2017). Functions and Remodelling of Plant Peroxisomes. in eLS (Chichester: John Wiley & Sons). 10.1002/9780470015902.a9780470001677
49
RamirezR. A.EspinozaB.KwokE. Y. (2014). Identification of Two Novel Type 1 Peroxisomal Targeting Signals in Arabidopsis thaliana. Acta Histochem.116, 1307–1312. 10.1016/j.acthis.2014.08.001
50
RaoS.ZhouZ.MiaoP.BiG.HuM.WuY.et al (2018). Roles of Receptor-like Cytoplasmic Kinase VII Members in Pattern-Triggered Immune Signaling. Plant Physiol.177, 1679–1690. 10.1104/pp.18.00486
51
ReumannS.BuchwaldD.LingnerT. (2012). PredPlantPTS1: A Web Server for the Prediction of Plant Peroxisomal Proteins. Front. Plant Sci.3, 194. 10.3389/fpls.2012.00194
52
ReumannS.ChowdharyG. (2018). Prediction of Peroxisomal Matrix Proteins in Plants. Subcell Biochem.89, 125–138. 10.1007/978-981-13-2233-4_5
53
ReumannS. (2004). Specification of the Peroxisome Targeting Signals Type 1 and Type 2 of Plant Peroxisomes by Bioinformatics Analyses. Plant Physiol.135, 783–800. 10.1104/pp.103.035584
54
SackstederK. A.JonesJ. M.SouthS. T.LiX.LiuY.GouldS. J. (2000). PEX19 Binds Multiple Peroxisomal Membrane Proteins, Is Predominantly Cytoplasmic, and Is Required for Peroxisome Membrane Synthesis. J. Cel Biol148, 931–944. 10.1083/jcb.148.5.931
55
SaleemR. A.KnoblachB.MastF. D.SmithJ. J.BoyleJ.DobsonC. M.et al (2008). Genome-wide Analysis of Signaling Networks Regulating Fatty Acid-Induced Gene Expression and Organelle Biogenesis. J. Cel Biol.181, 281–292. 10.1083/jcb.200710009
56
SandalioL. M.GotorC.RomeroL. C.Romero-PuertasM. C. (2019). Multilevel Regulation of Peroxisomal Proteome by Post-Translational Modifications. Int. J. Mol. Sci.20. 10.3390/ijms20194881
57
SchneiderC. A.RasbandW. S.EliceiriK. W. (2012). NIH Image to ImageJ: 25 Years of Image Analysis. Nat. Methods.9, 671–675.
58
SkouldingN. S.ChowdharyG.DeusM. J.BakerA.ReumannS.WarrinerS. L. (2015). Experimental Validation of Plant Peroxisomal Targeting Prediction Algorithms by Systematic Comparison of In Vivo Import Efficiency and In Vitro PTS1 Binding Affinity. J. Mol. Biol.427, 1085–1101. 10.1016/j.jmb.2014.12.003
59
SørhagenK.LaxaM.PeterhänselC.ReumannS. (2013). The Emerging Role of Photorespiration and Non-photorespiratory Peroxisomal Metabolism in Pathogen Defence. Plant Biol. (Stuttg)15, 723–736. 10.1111/j.1438-8677.2012.00723.x
60
StehlikT.KrempM.KahntJ.BölkerM.FreitagJ. (2020). Peroxisomal Targeting of a Protein Phosphatase Type 2C via Mitochondrial Transit. Nat. Commun.11, 2355. 10.1038/s41467-020-16146-3
61
Thazar-PoulotN.MiquelM.Fobis-LoisyI.GaudeT. (2015). Peroxisome Extensions Deliver the Arabidopsis SDP1 Lipase to Oil Bodies. Proc. Natl. Acad. Sci. USA112, 4158–4163. 10.1073/pnas.1403322112
62
TitorenkoV. I.RachubinskiR. A. (1998). Mutants of the Yeast Yarrowia Lipolytica Defective in Protein Exit from the Endoplasmic Reticulum Are Also Defective in Peroxisome Biogenesis. Mol. Cel Biol18, 2789–2803. 10.1128/mcb.18.5.2789
63
UhrigR. G.LabanderaA.-M.MoorheadG. B. (2013). Arabidopsis PPP Family of Serine/threonine Protein Phosphatases: many Targets but Few Engines. Trends Plant Sci.18, 505–513. 10.1016/j.tplants.2013.05.004
64
UhrigR. G.LabanderaA.-M.TangL.-Y.SiebenN. A.GoudreaultM.YeungE.et al (2017). Activation of Mitochondrial Protein Phosphatase SLP2 by MIA40 Regulates Seed Germination. Plant Physiol.173, 956–969. 10.1104/pp.16.01641
65
WangJ.WangY.GaoC.JiangL.GuoD. (2017). PPero, a Computational Model for Plant PTS1 Type Peroxisomal Protein Prediction. PLoS One12, e0168912. 10.1371/journal.pone.0168912
66
WheelerT. J.ClementsJ.FinnR. D. (2014). Skylign: a Tool for Creating Informative, Interactive Logos Representing Sequence Alignments and Profile Hidden Markov Models. BMC Bioinformatics15, 7. 10.1186/1471-2105-15-7
67
WilliamsC.Bener AksamE.GunkelK.VeenhuisM.Van Der KleiI. J. (2012). The Relevance of the Non-canonical PTS1 of Peroxisomal Catalase. Biochim. Biophys. Acta (Bba) - Mol. Cel Res.1823, 1133–1141. 10.1016/j.bbamcr.2012.04.006
68
WrightZ. J.BartelB. (2020). Peroxisomes Form Intralumenal Vesicles with Roles in Fatty Acid Catabolism and Protein Compartmentalization in Arabidopsis. Nat. Commun.11, 6221. 10.1038/s41467-020-20099-y
69
ZhangX.HuJ. (2010). The Arabidopsis Chloroplast Division Protein DYNAMIN-RELATED PROTEIN5B Also Mediates Peroxisome Division. Plant Cell22, 431–442. 10.1105/tpc.109.071324
70
ZimmermannP.LauleO.SchmitzJ.HruzT.BleulerS.GruissemW. (2008). Genevestigator Transcriptome Meta-Analysis and Biomarker Search Using rice and Barley Gene Expression Databases. Mol. Plant1, 851–857. 10.1093/mp/ssn048
71
ZulawskiM.SchulzeG.BraginetsR.HartmannS.SchulzeW. X. (2014). The Arabidopsis Kinome: Phylogeny and Evolutionary Insights into Functional Diversification. BMC Genomics15, 548. 10.1186/1471-2164-15-548
Summary
Keywords
peroxisome, Protein Kinases, peroxisomal targeting signal 1, beta oxidation, kinome
Citation
Kataya A, Gautam N, Jamshed M, Muench DG, Samuel MA, Thelen JJ and Moorhead GB (2022) Identification of Arabidopsis Protein Kinases That Harbor Functional Type 1 Peroxisomal Targeting Signals. Front. Cell Dev. Biol. 10:745883. doi: 10.3389/fcell.2022.745883
Received
22 July 2021
Accepted
25 January 2022
Published
15 February 2022
Volume
10 - 2022
Edited by
José Lozano, University of Malaga, Spain
Reviewed by
Richard Rachubinski, University of Alberta, Canada
Markus Kunze, Medical University of Vienna, Austria
Updates

Check for updates
Copyright
© 2022 Kataya, Gautam, Jamshed, Muench, Samuel, Thelen and Moorhead.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Amr Kataya, amr.kataya@ucalgary.ca, dramrkataya@gmail.com; Greg B. Moorhead, moorhead@ucalgary.ca
This article was submitted to Signaling, a section of the journal Frontiers in Cell and Developmental Biology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.