Abstract
Retinoic acid (RA) is a central signaling molecule regulating multiple developmental decisions during embryogenesis. Excess RA induces head malformations, primarily by expansion of posterior brain structures at the expense of anterior head regions, i.e., hindbrain expansion. Despite this extensively studied RA teratogenic effect, a number of syndromes exhibiting microcephaly, such as DiGeorge, Vitamin A Deficiency, Fetal Alcohol Syndrome, and others, have been attributed to reduced RA signaling. This causative link suggests a requirement for RA signaling during normal head development in all these syndromes. To characterize this novel RA function, we studied the involvement of RA in the early events leading to head formation in Xenopus embryos. This effect was mapped to the earliest RA biosynthesis in the embryo within the gastrula Spemann-Mangold organizer. Head malformations were observed when reduced RA signaling was induced in the endogenous Spemann-Mangold organizer and in the ectopic organizer of twinned embryos. Two embryonic retinaldehyde dehydrogenases, ALDH1A2 (RALDH2) and ALDH1A3 (RALDH3) are initially expressed in the organizer and subsequently mark the trunk and the migrating leading edge mesendoderm, respectively. Gene-specific knockdowns and CRISPR/Cas9 targeting show that RALDH3 is a key enzyme involved in RA production required for head formation. These observations indicate that in addition to the teratogenic effect of excess RA on head development, RA signaling also has a positive and required regulatory role in the early formation of the head during gastrula stages. These results identify a novel RA activity that concurs with its proposed reduction in syndromes exhibiting microcephaly.
Introduction
Microcephaly is a condition in which the brain fails to achieve its normal size (; Toi et al., 2009; Mochida, 2009; ; ; ). Besides the wide variation in head size in the human population (Natale and Rajagopalan, 2014), individuals with head circumferences (occipitofrontal) smaller by 3 standard deviations from the population mean (age, sex, and ethnicity matched), exhibit what is known as clinical microcephaly (). These individuals encompass up to 0.1% of the human population and most of them suffer from significant intellectual disabilities (). Microcephaly can be subdivided into primary, if developed during embryogenesis and present at birth, or secondary, if developed after birth, but this classification is not universally accepted. To date, Online Mendelian Inheritance in Man (OMIM.org) lists close to a thousand genes, diseases, or syndromes associated with microcephaly in addition to numerous environmental factors that can induce this condition. To elucidate the etiology of primary or developmental microcephaly we need to achieve a better understanding of the signals and processes that regulate the induction, patterning, and differentiation of the rostral neuroectoderm and subsequently the forebrain in the embryo (; Mochida, 2009; Toi et al., 2009; ; ; ) which in turn will affect the size of the head (; Ranke et al., 2015; ). In Xenopus embryos, the group of cells responsible for anterior neuroectoderm induction and patterning, the head organizer, forms as part of the Spemann-Mangold organizer (Spemann and Mangold, 1924; ; ; Yanagi et al., 2015). Very early during embryogenesis, the leading edge mesendoderm (LEM)/prechordal mesoderm (PCM) cells migrate to the rostral region beneath the prospective cranial neuroectoderm, and at this position, they will perform their inductive and patterning functions (; ).
In humans, in utero exposure to alcohol (ethanol, EtOH) is the environmental disturbance that induces Fetal Alcohol Spectrum Disorder (FASD). Individuals suffering from the severe form of FASD, Fetal Alcohol Syndrome (FAS), suffer from a multitude of developmental malformations including microcephaly (Roussotte et al., 2012; ; Popova et al., 2016; ; ; Treit et al., 2017; Petrelli et al., 2019). In FAS, cognitive disabilities, behavioral and social problems, reduced executive functioning, and social withdrawal accompany the microcephaly (Niccols, 2007; Spohr and Steinhausen, 2008; ; ; Popova et al., 2016). In recent years, we established and characterized a Xenopus-based experimental model that recapitulates many of the developmental malformations characteristic of FAS following alcohol exposure, including microcephaly (Yelin et al., 2005; Yelin et al., 2007; ; ; Shabtai et al., 2018). We have shown that many of the developmental malformations arising from embryonic alcohol exposure (EAE) are the result of reduced retinoic acid (RA) signaling (Yelin et al., 2005; ; Shabtai et al., 2018; Shabtai and Fainsod, 2018; ). During early embryogenesis, alcohol clearance and Vitamin A (retinol, ROL) metabolism are performed in part by the same enzymes or enzyme families (; Shabtai and Fainsod, 2018). Biosynthesis of RA from Vitamin A (retinol, ROL) proceeds through two consecutive oxidation steps, the first performed mainly by short-chain dehydrogenase/reductases (SDR) oxidizing ROL to retinaldehyde (RAL), and the subsequent oxidation step from RAL to RA performed by aldehyde dehydrogenases (ALDH) also known as retinaldehyde dehydrogenases (; ; Shabtai and Fainsod, 2018). EtOH detoxification in the embryo makes use of some of the same enzymes, sometimes redirecting them from their involvement in RA biosynthesis and other metabolic processes (; Pullarkat, 1991; ; Shabtai et al., 2018; Shabtai and Fainsod, 2018; ). As it has extensively been shown, RA is crucial for normal embryonic development and tissue homeostasis (Ross et al., 2000; See et al., 2008; ; ; Rhinn and Dollé, 2012; ; ; Nolte et al., 2019), and abnormally high or low levels are extremely teratogenic giving rise to a complex and severe set of developmental malformations (; ; ).
It is widely accepted that increased RA levels adversely affect the formation of the head and in particular, inhibit forebrain development by promoting hindbrain expansion resulting in a microcephalic phenotype (; Sive et al., 1989; ; ; ). On the other hand, reduced RA signaling levels have been linked to an increasing number of developmental syndromes that exhibit microcephaly including FAS, DiGeorge, Smith-Magenis, Matthew-Wood, and Vitamin A Deficiency (VAD) Syndromes, and others (Twal et al., 1995; ; ; ; Vermot et al., 2003; Yelin et al., 2005; ; ; ; Shabtai et al., 2018; ; ). This link between microcephaly and reduced RA levels suggests that RA signaling is required during early head induction and forebrain establishment. In agreement, retinaldehyde dehydrogenase 2 (Raldh2; Aldh1a2) mutants die very early during development exhibiting malformations of the anterior head region (Niederreither et al., 1999; ; Perz-Edwards et al., 2001; ) and dorsal knock-down of the RA nuclear receptor, RARα2 results in head truncation and malformations (Shiotsugu et al., 2004).
To further characterize the role of RA signaling during gastrulation and in particular, in the process of head formation, we experimentally manipulated its levels. We show that localized reduction of RA levels within the embryonic organizer results in a high incidence of embryos with abnormally small heads. RA biosynthesis inhibition or signaling knockdown in induced secondary axes also reduces the efficiency of head formation in the twinned embryos. These observations support the suggestion that RA signaling is required for normal head development. In Xenopus embryos, the aldh1a2 gene is initially expressed within the organizer domain but soon thereafter its expression becomes lateralized and is absent from the dorsal midline (). This pattern of expression prompted us to search for additional RA biosynthetic enzymes that could produce the RA required for head induction. Aldh1a3 (raldh3) transcripts were detected in the early organizer (), and subsequently in the rostrally migrating LEM/PCM cells. We show that aldh1a3 knockdown with antisense morpholino oligonucleotides or by gene targeting with CRISPR/Cas9 efficiently hampers the formation of head structures, resulting in microcephaly in both the endogenous and induced secondary axes. These results indicate that RA signaling is required in the LEM/PCM cells for normal head formation. Further, we show that ALDH1A3 is the main enzyme involved in producing the RA needed for this process.
Materials and Methods
Embryo Culture and Treatments
Xenopus laevis embryos were obtained by in vitro fertilization, incubated in 0.1% Modified Barth’s Solution and Hepes (MBSH) and staged according to Nieuwkoop and Faber (1967). All experiments were performed after obtaining ethics approval and under the supervision of the Institutional Animal Care and Use Committee (IACUC) of the Hebrew University (Ethics approval no. MD-17-15281-3). Treatments with 4-Diethylaminobenzaldehyde (DEAB, Sigma) or 3,7-Dimethyl-2,6-octadienal (citral, Aldrich), were performed in 0.1% MBSH from the mid-blastula transition (MBT, stage 8) until the desired stage for analysis.
Embryos were injected at the 1-4 cell stage with in vitro transcribed capped RNA, expression plasmids, antisense morpholino oligonucleotides, or CRISPR/Cas9 single guide RNAs (sgRNAs). Capped RNAs were prepared using the appropriate RNA polymerase. Cap analog [m7G(5′)ppp(5′)G; New England Biolabs, United States] was added to the reaction mixture using a cap:GTP ratio of 5:1. Expression plasmids were linearized and transcribed as previously described: wnt8a (), tALK3 (), cyp26a1 (), bmp4 (), dkk1 (). Antisense morpholino oligonucleotides (Table 1) were obtained from Gene Tools LLC (United States).
TABLE 1
| Gene | Forward primer | Reverse primer |
|---|---|---|
| RT-qPCR | ||
| admp.S | GCCTTCCGAGCAAGCTTACTT | CCTTGTGGCAACTGTATCTTATTTTTA |
| cer1.S | CTGGTGCCAAGATGTTCTGGAA | CGGCAAGCAATGGGAACAAGTA |
| chrd.1.L/S | ACTGCCAGGACTGGATGGT | GGCAGGATTTAGAGTTGCTTC |
| cyp26a1.S | CGATTCCTCAAGGTTTGGCTTCA | ATTTAGCGGGTAGGTTGTCCACA |
| dhrs3.L | CAGGCGCAAGAAATCCTAAG | CAAAGGCCACGTTACAGGAT |
| dkk1.S | TGCCTACCCGCTCTACAGTT | AACCAGAGAGTTGCCGTTTC |
| frzb1.L | CCAATGCTTACTGTGCTTCGT | AGTGCTGTGGTGGAGATGGT |
| gapdh.S | GCTCCTCTCGCAAAGGTCAT | GGGCCATCCACTGTCTTCTG |
| gsc.L/S | TTCACCGATGAACAACTGGA | TTCCACTTTTGGGCATTTTC |
| hoxa1.L | CCGCTCACTATATCCACCATTC | TGGCAGGAGAACGACAAAC |
| hoxb1.L | TTGCCCCAGTGCCAATGAC | TCCCCCTCCAACAACAAACC |
| hoxb4.S | CCAAGGATCTGTGCGTCAA | GCAGGATGGAGGCGAACT |
| myod1.S | CCCTGTTTCAATACCTCAGACAT | CGTGCTCATCCTCGTTATGG |
| otx2.L | AAGCCGCAATATAGAAAGGAACA | GGGATTCCTTGTCGCAATTAATA |
| aldh1a1.L | GAACTTTCCGTTGTTGAT | GATAGCAGTCAGTGGAGTTTG |
| aldh1a2.L | ATGTTTGCCTGGAAGA | GAGAGCAGTGAGCGGA |
| aldh1a3.L | TAAAGCCCTGTCTGTTTCT | CATACTCTCCAAGTTCCCTT |
| rdh10.L/S | CCCAGAGTAACGAGGAGACG | ATTGCAGCACGGCAGAACT |
| szl.L/S | AACAAGGTCTGCTCCTTCCA | CTGTGGGTCTGGTCCG |
| ventx1.2.S | AGGCAGGAGTTCACAGGAAA | TGCCTGTTCCAGTTTGCTT |
| Genomic nested PCR | ||
| Outer genomic PCR | ||
| aldh1a2.L | CTGGGATCTGCTCATTCAGTGT | ACGTTGATTGATCCGTGGTG |
| aldh1a2.S | CAACAAGTTCATTTTTCCTGCTGAA | ATAGGCAGGTCTCTTGGGGA |
| aldh1a3.L | TCAAAGGAGAAAAGGCTCAGGT | TAGAAATTCACCAGCAGGAAAGC |
| aldh1a3.S | ACCCCATAAAATGTGTGCTACTCT | TTCTAACAGACTGGGTTGGGATG |
| Inner genomic PCR | ||
| aldh1a2.L | GTGTACCCTTTGTATGTTGGCAT | GCCATTGTGCTACGGTTTTG |
| aldh1a2.S | GTCACACACCTTTCAGTTTTTGG | AGGTCTCTTGGGGAAACTGTG |
| aldh1a3.L | TTACCAGTGCAGGGCAACAG | TCTAACAGACTGGGTTGGGGAT |
| aldh1a3.S | AGAACAATTGTGGGGCAGCA | TGCTGCATCTAGCTATAGAAACCC |
| Antisense morpholino oligonucleotides | ||
| ALDH1A2.L/S | CTATTTTACTGGAAGTCATGTCTGG | — |
| ALDH1A3.L/S | TAGTGGTTGTCATGTTGATAGAGGC | — |
| Control MO | CCTCTTACCTCAGTTACAATTTATA | — |
| CRISPR (crRNA) | ||
| aldh1a2.L/S | GAATGGATGCCTCAGAAAGG | — |
| aldh1a3.L/S | CAGCAGTCTCCCTCGGCCAT | — |
Primers for PCR expression analysis, genomic amplification and expression knockdown.
Generation of CRISPant Embryos
For gene-specific single guide RNA design (sgRNA), genomic DNA sequences were selected from Xenbase.org (Nenni et al., 2019) for the L and S homoeologs when present and used CRISPRdirect (Naito et al., 2015) and CRISPRscan (Moreno-Mateos et al., 2015) for target site search. Computational estimation of the sgRNA efficiency was determined using the inDelphi software (Shen et al., 2018; Naert et al., 2020). sgRNA target sequences used are listed in Table 1. For the generation of F0 CRISPant embryos, we injected one-cell stage embryos with Cas9 ribonucleoprotein (RNP) complexes employing the two-RNA component (crRNA:tracrRNA) approach (). Briefly, chemically synthesized and modified for stability (Alt-R) RNAs (crRNA and tracrRNA; IDT, United States) (Table 1) were annealed to generate the double guide complexes (crRNA:tracrRNA), and were incubated (10 min at 37°C) with S. pyogenes Cas9 protein (IDT, United States) to generate RNP complexes. Eight nanoliters of the RNP complex solution were injected into the cytoplasm of one-cell stage embryos.
To determine the efficiency of indel induction, genomic DNA was extracted from 5 individual embryos at mid-gastrula (st. 11) or later, employing the GenElute Mammalian Genomic DNA Miniprep Kit (SIGMA). The genomic region containing the CRISPR/Cas9 targeted region was PCR amplified using a nested PCR approach (Table 1) and the size-selected and cleaned product was sequenced. Genome editing efficiency was analyzed by decomposition analysis () using the Synthego ICE algorithm ().
Whole-Mount in Situ Hybridization
Whole-mount in situ hybridization and double in situ hybridization were performed as previously described (). Probes were prepared by in vitro transcription using Digoxigenin or Fluorescein labeling mix (Roche). Double staining was performed by either 5-Bromo-6-chloro-3-indolyl phosphate p-Toluidine salt (Magenta phosphate, Sigma) or BM purple (Roche) for the first probe and 5-Bromo-4-chloro-3-indolyl phosphate p-Toluidine salt (BCIP, Roche) for the second probe. Probes were transcribed as previously described: pax6 (), ncam1 (), muc2 (XCG-1) (Sive et al., 1989), chrd.1 (chordin) (Sasai et al., 1994), gsc (goosecoid) (), cyp26a1 (), aldh1a2 (raldh2) (), aldh1a3 (raldh3) (), otx2 (Smith et al., 1993).
Quantitative Reverse Transcription Real-Time PCR (qPCR)
Total RNA from embryos was extracted with the Aurum™ Total RNA Mini Kit (Bio-Rad) and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad). The real-time PCR reactions were performed using the CFX384 Real-Time System (Bio-Rad) and iTaq Universal SYBR Green Supermix (Bio-Rad). Each experiment was repeated at least three independent times and each time the samples were run in triplicate. GAPDH was used as the housekeeping reference gene. The primers used are listed in Table 1.
ß-Galactosidase Activity Assays
Chemiluminescent quantification of the reporter pRAREhsplacZ plasmid (Rossant et al., 1991) activity was performed using ß-gal Juice Plus (PJK, Germany) as previously described (Yelin et al., 2005). Chemiluminescence activity was measured on a TD-20/20 Luminometer (Turner Designs). LacZ RNA was prepared from a clone containing a nuclear localization signal (pSP6nuc ß-gal) in pGEM-3Z (Promega). The staining of embryos for ß-galactosidase activity was performed with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Xgal).
Statistical Analysis
All statistical comparisons were carried out using the Prism software package (Graph Pad Software Inc., San Diego, CA). Results are given as the mean ± standard error of the mean (SEM). Tests used were the 2-tailed t-test for two-sample comparisons, Dunnett’s (ANOVA) multiple comparisons test, or Fisher test. Differences between means were considered significant at a significance level of p < 0.05.
Results
Retinoic Acid Signaling Reduction Induces Microcephaly
To support the requirement for RA signaling in the formation of the head, we reduced the endogenous RA levels by localized dorsal or ventral injection of mRNA encoding CYP26A1. The CYP26A1 enzyme is a RA hydroxylase rendering it biologically inactive, thus reducing the activity of this signaling pathway (). RNA encoding ß-galactosidase (LacZ) was co-injected as a lineage tracer to monitor and verify the injection site. To study the effect on anterior head structure formation and to determine whether the embryos exhibit normal, mild, or severe microcephaly, we analyzed the development of the eyes (pax6) and cement gland (muc2) by in situ hybridization (Figures 1A–C). Dorsal CYP26A1 overexpression induced microcephaly with high efficiency (80%), with the majority of the embryos exhibiting severe microcephaly (61.1%; Figures 1B–D). Ventral cyp26a1 RNA injections resulted in a distribution of head phenotypes similar to control embryos (13.9% very mild microcephaly; Figure 1D). To support the requirement for normal RA signaling levels in head development, we also performed systemic RA biosynthesis inhibition with 4-diethylaminobenzaldehyde (DEAB; 150 μM) (Russo et al., 1988; Morgan et al., 2015; Shabtai et al., 2016). The DEAB treatment induced mild microcephaly in 40.3% of the embryos (Figure 1D). Combined ventral cyp26A1 mRNA injection with DEAB treatment had no significant additive effect compared to the DEAB treatment alone, increasing only slightly the proportion of mild microcephalic embryos to 43.5%. In contrast, the addition of DEAB to dorsally cyp26a1 RNA injected embryos increased the incidence of microcephaly to 100% of the embryos (Figure 1D), showing that most of the RA signaling activity required for normal head development is localized dorsally.
FIGURE 1
Based on the organizer-restricted expression of aldh1a2 and the activation of RA signaling in the gastrula organizer (; Yelin et al., 2005), we expect activation of RA signaling in supernumerary organizers induced on the ventral side of the embryo. For this reason, we induced secondary axes by either ventral activation of Wnt/ß-catenin signaling (wnt8a RNA injection) (Sokol et al., 1991), or inhibition of BMP signaling by smad6 () or a dominant negative BMP receptor (tALK3) () mRNA injection. Activation of RA signaling in the secondary organizer was monitored using the RA reporter pRAREhspLacZ (RAREZ) plasmid (Rossant et al., 1991; Yelin et al., 2005) which was co-injected with the axis-inducing RNA. Expression from this reporter plasmid relies on an RA responsive element (RARE), which in turn depends on the availability of the RA ligand, the retinoic acid nuclear receptors, and their cofactors, i.e., an active RA signaling pathway. During gastrula (st. 10.25) and early neurula (st. 14/15) expression of the RAREZ reporter plasmid was detected irrespective of the mode of secondary axis induction employed (Supplementary Figure S1). During early gastrula, the induced secondary organizers exhibited RAREZ activity in about 76% of the embryos (Supplementary Figure S1C). This observation shows that although secondary dorsal lips, organizers, are induced, not all of them manage to activate the RAREZ reporter. It is important to note that activity of this reporter plasmid is totally dependent on the local biosynthesis of RA and expression of the RAR and RXR nuclear receptors. These results show that the induced secondary organizer also exhibits active RA signaling, although a more effective and efficient induction might be needed to activate a detectable RA signal trace.
As induced secondary organizers exhibit active RA signaling, we studied the requirement for this signal in the head organizer activity by studying the effect of reduced RA signaling on head development in secondary axis head induction. Ventral wnt8a mRNA injection was selected for axis induction as a large percentage of the secondary axes form anterior head structures (Sokol et al., 1991). Co-injection of cyp26a1 mRNA together with the wnt8a RNA was used to reduce, in a localized manner, the RA level in the induced secondary axes. Embryos were processed for in situ hybridization with ncam1 as a marker of the neural plate to score the secondary trunk, while anterior head formation was determined using pax6 as an eye marker (Figures 1E–G). The efficiency of secondary axis induction was not significantly affected by the reduction in RA signaling compared to control embryos (61.3%, n = 856 and 55.5%, n = 1,450, respectively; Figure 1H). Analysis of the presence of anterior head structures morphologically and by marker gene expression showed that in the control group, 43.8% of the secondary axes had anterior head structures (Figures 1F,H). In contrast, RA knock-down reduced the proportion of secondary axes containing anterior head structures to only 27.9% of all the injected embryos, representing a reduction of 36.3% in full secondary axes (Figures 1G,H). These results show that RA is also required for the head organizer activity in induced secondary axes, similar to the endogenous organizer.
Additional support for the requirement for RA during head formation was obtained using additional means of secondary axis induction and RA signaling inhibition. Embryos were injected ventrally with wnt8a mRNA and subsequently treated with the RALDH inhibitor, DEAB. The DEAB treatment reduced the efficiency of head formation in the secondary axes by 59.6% (n = 328; Figure 1H), further supporting that RA is required for head formation. In addition, we induced head-containing secondary axes by simultaneous inhibition of BMP and Wnt signaling by co-injection of RNA encoding the dominant-negative BMP receptor, tALK3, and the Wnt antagonist, DKK1 (). Similar to the previous combined treatments, DEAB-mediated inhibition of RA biosynthesis resulted in a 41.1% decrease in head formation in the induced secondary axes (n = 344; Figure 1H). We conclude that RA signaling is required for efficient anterior head structure development both in the endogenous and induced organizers.
Retinoic Acid is Required for Normal Head Formation During Early Gastrula
To map the developmental window when RA signaling is required for normal head development, we inhibited RA biosynthesis by initiating the DEAB treatment at different developmental stages and analysis of the resulting head malformations at st. 32 (Figures 1A–C). Inhibition of RA synthesis from mid to late blastula stages (st. 8-9) resulted in 62–78% of the embryos developing microcephaly (Figure 2A). In the st. 8 sample, most embryos (57%) developed severe head malformations and 21% of them had mild head defects (Figure 2A). DEAB treatment from early gastrula (st. 10) resulted in a similar frequency of affected embryos (Figure 2A). Inhibition of RA biosynthesis from mid gastrula (st. 10.5) onwards showed a significant decrease in the induction of microcephaly, identifying a shift in the requirement for RA in the head organizer; only 37% of the embryos exhibit some form of microcephaly, 20% mild and 17% severe (Figure 2A). These results show a requirement for RA signaling during late blastula-early gastrula for normal head development.
FIGURE 2
RA and its biosynthetic intermediates have been detected in the gastrula organizer in vertebrate embryos (; ; ; ; ; Niederreither et al., 1997; ; Yelin et al., 2005), suggesting an active role for this signaling pathway in this central embryonic regulatory structure. It is generally accepted that the appearance of the retinaldehyde dehydrogenase activity with the onset of aldh1a2 (raldh2) expression marks the completion of the biosynthetic pathway and the onset of RA signaling (; Niederreither et al., 1999; ; Shabtai et al., 2018). To obtain a better picture of the onset of RA signaling in the embryo, we took advantage of the RA reporter plasmid, RAREZ (Rossant et al., 1991), and determined the kinetics of increase in ß-galactosidase activity by chemiluminescence for maximal sensitivity. Embryos injected radially with the RAREZ plasmid (Yelin et al., 2005) were analyzed at different developmental stages from the midblastula transition (MBT; st. 8.5) to late gastrula (st. 12) (Figure 2B). This analysis shows that the RA reporter plasmid becomes active at the onset of gastrulation (st. 10-10.25) and its activity increases towards mid/late gastrula stages (st. 11.5-12). This temporal pattern of RAREZ activity places the onset of RA signaling around the beginning of gastrulation and, from then on, it increases towards late gastrula overlapping with the expression of aldh1a2 (; Shabtai et al., 2018) and the proposed activity of the head organizer and the transition to trunk organizer (Niehrs, 2004).
Retinoic Acid is Required for Normal Gene Expression in the Head Organizer
Using transgenic embryos, we previously showed that the RA pathway is active during early/mid gastrula mainly in the organizer and subsequently along the dorsal midline (Yelin et al., 2005). The early requirement for RA signaling for normal head development led us to study the role of RA within the organizer at a stage when both RA producing enzymes, ALDH1A2 and ALDH1A3 are expressed in this embryonic region. We manipulated the endogenous level of RA in the embryo and determined the effect of such manipulations on organizer-specific gene expression and, in particular, genes important for the head organizer activity. To decrease or increase the RA signaling levels, embryos were treated with increasing concentrations of DEAB (30-250 μM), or all-trans retinoic acid (atRA; 10 nM–10 μM) respectively, and incubated to early gastrula stages (st. 10.25) for expression analysis. To support the generation of different RA signaling levels we monitored the expression of the RA-regulated genes, hoxb1 and cyp26a1 by qPCR. This analysis revealed that our manipulations efficiently created an RA activity gradient ranging from a strong knockdown to gain-of-function (Figures 3A,B). Under these conditions, we studied the effect of RA manipulation on the expression of the organizer-specific genes; cer1, admp, dkk1, chrd.1, and otx2. The decrease in RA levels resulted in the downregulation of all the genes studied (Figures 3C–G). The downregulation ranged from about 40 to 60% from normal expression levels, suggesting that RA is a required signal for the normal expression of these organizer genes. Surprisingly, increasing the RA levels also reduced the expression of all genes studied by about 40–60% (Figures 3C–G). These results suggest that the embryo has close to optimal amounts of RA in the early gastrula organizer and any deviation results in reduced expression of the organizer genes studied.
FIGURE 3
To obtain support of whether the organizer normally contains almost optimal levels of RA to control the expression level of genes like gsc, cer1, admp, dkk1, chrd.1, and otx2, we performed a fine titration of the inhibition of RA biosynthesis using DEAB (Figure 3H). For gsc, chrd.1, and dkk1, the lowest amount of DEAB used (1 μM) resulted in upregulation of their expression, whereas higher concentrations had either no effect or had an opposite effect and downregulated their expression (Figure 3H). For cer1, otx2, admp, and cyp26a1, low DEAB concentrations had no effect, but higher concentrations induced lower expression levels (Figure 3H). These results show that RA has a complex gene regulatory role within the organizer, both positively and negatively controlling the levels of gene expression in a concentration and threshold-dependent manner to fine-tune the expression of the organizer genes.
Expression of aldh1a2, and aldh1a3 During Gastrula Stages
The results show that RA signaling is required during late blastula or early gastrula for normal organizer-specific gene expression and this early function contributes to the activity of the head organizer. We previously described the temporal pattern of expression of the three retinaldehyde dehydrogenase-encoding genes, aldh1a1, aldh1a2, and aldh1a3 (raldh1, raldh2, and raldh3, respectively) in early Xenopus embryos and their relative transcript abundance (Shabtai et al., 2018; Parihar et al., 2021). The results showed that all three genes exhibit similar temporal expression patterns and are upregulated above background levels with the onset of gastrulation, but aldh1a2 is the most abundant transcript. Since transcripts of aldh1a2 and aldh1a3 have been detected in the embryonic organizer (; ) we compared their spatial expression patterns by qPCR and double whole-mount in situ hybridization (dWISH) later during gastrulation. The relative localization of the aldh1a1, aldh1a2, and aldh1a3 transcripts was determined by dissecting dorsal, lateral, and ventral marginal zones (DMZ, LMZ, and VMZ, respectively) from embryos during mid-gastrula (st. 11). The RNA from these regions was analyzed by qPCR to determine the relative transcript distribution (Figure 4A). Although expressed at very low levels (Shabtai et al., 2018), most of the aldh1a1 transcripts are localized in the LMZ explants (Figure 4A). With this type of analysis, aldh1a2 expression appears ubiquitous with similar abundance in all three regions in agreement with its wide expression domain during mid/late gastrula stages as observed by WISH (Figures 4B,C, turquoise). Expression of aldh1a3 is mostly localized to the DMZ with almost no transcripts in other embryonic regions (Figure 4A). This aldh1a3 transcript distribution is in agreement with the expression being restricted to the organizer and to cells along the dorsal midline, suggesting that this gene might be involved in the head-promoting role of RA. The accuracy of the embryonic dissections was corroborated by analyzing the expression of chrd.1 as a dorsal marker, myod1 as a lateral marker, and szl as a ventral marker (Figure 4A).
FIGURE 4
To better understand the pattern of aldh1a3 expression, we studied its spatial expression in parallel to aldh1a2, cyp26a1, and otx2. Comparative analysis of the aldh1a2 and aldh1a3 expression patterns clearly shows that by mid/late gastrula (st. 11.5) both genes are expressed in non-overlapping domains (Figure 4B). While the aldh1a2 expression remains posterior, close to the blastopore, aldh1a3 expression is restricted to a small cluster of cells, probably representing the migrating LEM/PCM (Figure 4B). By early neurula stages (st. 15) aldh1a3 expression becomes undetectable and only the expression of aldh1a2 in the prospective trunk is observed (Figure 4C). The rostral localization of aldh1a3 expression during late gastrula prompted us to look at its position relative to other genes expressed in the same region. First, we analyzed the spatial localization relative to cyp26a1, another member of the RA metabolic network known to be expressed in the neuroectoderm of the prospective forebrain region (
The enzymatic function of aldh1a3 as a producer of RA places a dynamic, second RA signaling center in the dorsal region of the gastrula embryo. The expression pattern of aldh1a3 during gastrula and early neurula is characteristic of organizer genes that continue to have dorsal midline expression. To further study the dorsal identity of aldh1a3-expressing cells, embryos were dorsalized by promoting Wnt/ß-catenin signaling, or ventralized by increasing the BMP signal. Embryos were injected with wnt8a or bmp4 mRNA to induce dorsalization and ventralization, respectively, and samples were collected during early/mid gastrula (st. 10.5), mid gastrula (st. 11), and early neurula (st. 13) to account for the dynamic nature of the expression patterns. To verify the efficacy of the RNA injections, we studied the responses of gsc and admp as dorsal genes and szl and ventx1.2 as ventral genes by qPCR. In agreement with their dorsal expression, gsc and admp were upregulated by wnt8a RNA injection dorsalization and downregulated by bmp4 ventralization (Figures 4H,I). szl and ventx1.2, on the other hand, exhibited the expected opposite responses as ventral targets of BMP4 signaling, downregulation by wnt8a, and upregulation by bmp4 overexpression (Figures 4H,I). At all stages studied, aldh1a3 was upregulated by wnt8a overexpression and downregulated by bmp4, similar to gsc and admp (Figures 4H,I). These results show that aldh1a3 responds like a typical organizer and dorsal midline gene to the manipulation of dorsal-ventral patterning. In contrast, from stage 10.5, the aldh1a2 domain of expression expands laterally and its transcripts are eliminated from the organizer or midline region (Figures 4A–C) (
ALDH1A3 Produces Retinoic Acid Required for Head Formation
Characterization of the aldh1a3 and aldh1a2 expression patterns showed that while aldh1a2 expression begins in the organizer and then expands and shifts laterally, aldh1a3 expression begins in the organizer and until late gastrula remains restricted to the dorsal midline, rostrally migrating LEM/PCM cells (Figures 4B,C). From the shared expression patterns in the gastrula organizer and the timing of the RA signal we were unable to identify whether one of these enzymes has a more prominent role in normal head development. To functionally determine which RA-producing enzyme contributes to head formation, we designed antisense morpholino oligonucleotides (MO) targeting either aldh1a3 or aldh1a2 (R3MO or R2MO, respectively). To determine the efficiency and specificity of R2MO and R3MO we constructed GFP variants containing the aldh1a3 and aldh1a2 MO target sequences (R3GFP or R2GFP, respectively). RNAs encoding the GFP variants were co-injected with the R3MO, R2MO, or control MO (coMO) into Xenopus embryos (Supplementary Figure S2). Only when R2GFP was co-injected with the R2MO or R3GFP was co-injected with the R3MO, was the GFP fluorescence strongly reduced (Supplementary Figures S2D,I). Co-injection with the control MO had no effect on the fluorescence intensity of the GFP variants (Supplementary Figures S2B,C,G,H). These results demonstrate that R2MO and R3MO are efficient tools for the knock-down of their respective proteins.
Knockdown of the ALDH1A3 or ALDH1A2 enzymes is expected to reduce their activity and ultimately result in a reduction in RA signaling. For this reason, additional validation of the efficacy of the MOs directed against aldh1a2 and aldh1a3 (R2MO and R3MO) tested their effect on RA signaling levels. The effect of ALDH1A3 and ALDH1A2 knockdown on RA signaling was studied by co-injection with the RA reporter plasmid, RAREZ. Embryos injected with RAREZ and either R3MO or R2MO were collected at early/mid gastrula (st. 10.5) and the level of ß-galactosidase activity was determined using its chemiluminescent substrate (Figure 5A). This analysis showed that knockdown of either enzyme, ALDH1A3 or ALDH1A2, efficiently reduces the level of RA signaling by about 50–60% of control levels (Figure 5A). Thus, R3MO and R2MO efficiently hamper the production of RA, and both enzymes contribute to RA in the early gastrula embryo.
FIGURE 5

ALDH1A3 is necessary for normal head development. Embryos were injected with the R2MO or R3MO to reduce the activity of ALDH1A2 or ALDH1A3, respectively. (A) Analysis of the effect on the RA signaling level by co-injection of the RA reporter plasmid and chemiluminescent analysis of the ß-galactosidase activity. (B–F) Embryos injected dorsally with the R2MO, R3MO, or coMO to induce ALDH1A2 or ALDH1A3 knockdown in the Spemann-Mangold organizer. Embryos were sensitized for changes in RA levels by co-injection of low, non-teratogenic, amounts of cyp26a1 RNA. The extent of microcephaly induction was quantitated (B). Examples of head development for control uninjected (C), coMO (D), R2MO (E), and R3MO (F) injected embryos are shown. (G–J) Analysis of head malformations in secondary axes induced by ventral injection of wnt8a RNA together with ALDH1A2 or ALDH1A3 knockdown. (G) Control embryo. (H) ALDH1A2 knockdown. (I) ALDH1A3 knockdown. (J) Quantitation of the effect of ALDH1A2 or ALDH1A3 knockdown on head development in the induced secondary axes. The overall number of embryos injected or manipulated is shown (n =). *, p < 0.05 **, p < 0.01; ***, p < 0.001 ****, p < 0.0001; ns, not significant.
Our results of systemic RA reduction by CYP26A1 overexpression or the use of RA biosynthesis inhibition (DEAB) show that this signal is required for normal head development and its reduction results in microcephaly. Taking advantage of R2MO and R3MO we determined the relative contribution of ALDH1A3 and ALDH1A2 to normal head development. We reduced the expression of ALDH1A3 or ALDH1A2 by MO-mediated knockdown in the endogenous organizer by injecting embryos dorsally with R2MO, R3MO, or coMO, and the extent of induced microcephaly was quantitated (Figures 5B–F). The R2MO and R3MO efficiently induce knockdown of the endogenous activity, but we have shown that different embryo clutches respond differently to RA inhibition probably establishing a compensatory robustness response (
To corroborate the requirement for the function ALDH1A3 in normal head formation, we studied head-containing secondary axes induced by ventral injection of wnt8a mRNA. The role of ALDH1A3 or ALDH1A2 in head formation was studied by injection of the R2MO or R3MO together with the induction of the secondary axis (Figures 5G,H). ALDH1A3 knockdown dramatically reduced the efficiency of head formation in the induced secondary axes by 70% (Figures 5I,J); in contrast, ALDH1A2 knockdown did not affect the efficiency of head formation as compared to control wnt8a RNA injected embryos (Figures 5F,J). Neither morpholino significantly affects the efficiency of secondary axis induction (Figure 5J). These results show that ALDH1A3 has a strong effect on head development and appears to be a central RA producing enzyme required for this process.
To validate the MO results on head formation, we designed single guide RNAs (sg) to induce indels in either the aldh1a2 or aldh1a3 genes (sgR2 and sgR3, respectively) using the CRISPR/Cas9 approach (Tandon et al., 2017; Naert et al., 2020). The sgR2 and sgR3 RNAs were designed to target both homoeologs of either aldh1a2 or aldh1a3, respectively (Table 1; Supplementary Figures S3A,B). One-cell embryos were injected with RNP complexes of either sgR2 or sgR3 RNA together with Cas9 protein to generate CRISPant embryos that were allowed to develop to early tailbud stages (st.32) for genomic DNA extraction. Sequencing of the genomic region targeted by the sgRNAs revealed clear disruption of the normal sequence (Supplementary Figures S3C–E). Decomposition analysis of the genomic sequences estimated a frameshift efficiency higher than 78% (Supplementary Figure S3C). The efficiency of the sgR2 and sgR3 allow us to perform gene editing experiments and analyze the injected founder (F0) individuals, CRISPants.
Taking advantage of the generation of CRISPant embryos, we performed the head formation inhibition assay in secondary axes by injecting CRISPR/Cas9 with either sgR2 or sgR3 (Figure 6). Embryos were injected ventrally with a combination of wnt8a RNA for secondary axis induction together with the sgRNA/Cas9 RNP complex. The sgRNA/Cas9 complex had no effect on the secondary axis induction efficiency which was around 60% of the injected embryos in control wnt8a only and sgR2 or sgR3 CRISPant embryos (Figures 6A,C). Indel induction in the aldh1a3 CRISPants significantly increased the loss of secondary head formation efficiency (55.5% loss; Figures 6C,D). Knockdown of the ALDH1A2 activity had a slight (17.9%) and not significant effect on head formation in the secondary axes (Figures 6B,D). These results confirm that loss-of-function the ALDH1A3 activity by CRISPR/Cas9 gene targeting is critical for normal head development.
FIGURE 6

aldh1a3 CRISPants exhibit enhanced head malformations. Secondary axes were induced by ventrally injecting wnt8a mRNA. Co-injection of sgR2 or sgR3 RNPs was performed to generate aldh1a2 or aldh1a3 CRISPant embryos, respectively. (A) Secondary axis induction efficiency in wnt8a RNA injected embryos along or in conjunction with aldh1a2 or aldh1a3 CRISPant induction. (B) Control embryo. (C)aldh1a2 CRISPant embryo with two axes. (D)aldh1a3 CRISPant twinned axis embryo. (E) Analysis of the effect of the aldh1a2 and aldh1a3 CRISPR/Cas9-mediated knockdown on head formation in the induced secondary axes. The overall number of embryos injected or manipulated is shown (n =). Percent embryos wnt8a mRNA injected, embryos with secondary axes without heads and with heads. **, p < 0.01; ns, not significant.
The knockdown experiments suggest a novel function for RA signaling during gastrulation by providing a required signal for normal head development. To further support this RA requirement in head formation we performed rescue experiments. Microcephaly was induced by generating aldh1a3 CRISPant embryos and the head malformations were rescued by the addition of low amounts of RA (5 nM or 10 nM) (Figure 7). Whereas, among Cas9 injected control embryos only 8.4% developed severe microcephaly, targeting the aldh1a3 gene with sgR3 resulted in a significant three-fold increase (25%) of embryos with severe microcephaly (Figure 7). The addition of low amounts of RA to the aldh1a3 CRISPant embryos reduced the extent of severe microcephaly by about a third (to 15.4–16.2%). It is important to note that low amounts of RA alone induced severe microcephaly (26.3% for 5 nM and 44.7% for 10 nM) through inhibition of forebrain fates. These results show that RA supplementation of aldh1a3 CRISPant embryos partially rescues the microcephaly induced by the loss of the RA producing enzyme.
FIGURE 7

RA rescues the microcephaly induced by loss of ALDH1A3 activity. Microcephaly was induced in Xenopus embryos by targeting the aldh1a3 gene with CRISPR/Cas9+sgR3. As controls, embryos were injected with Cas9 only. For rescue of the microcephalic phenotype, embryos were treated with 5 nM or 10 nM RA. The rescue efficiency was calculated by Chi-square, comparing each treatment to the Cas9 control microcephaly level. *, p < 0.05; **, p < 0.01; ****, p < 0.0001; ns, not significant.
Retinoic Acid Regulatory Functions During Early Head Formation
RA is well known to regulate the genes that affect its level. To better characterize the molecular, gene-regulatory role of RA signaling in the head organizer, we studied the effect of RA addition on the expression of aldh1a2 and aldh1a3 and a number of head organizer genes. The initial activation of aldh1a2 expression is probably RA-independent but soon thereafter the RA self-regulation might contribute to the expression of RA network genes including aldh1a2 and aldh1a3. To determine the responsiveness to increased levels of RA of gastrula expressed RA metabolic genes, we treated embryos with 100 nM RA from late blastula to early/mid (st. 10.25) and late gastrula stages (st. 12). Analysis of hoxb1 expression revealed the expected RA-dependent upregulation at both gastrula stages supporting the efficiency of this treatment (Figure 8A). Similarly, the expression of genes important for attenuating RA signaling, dhrs3, and cyp26a1, was upregulated relative to controls in agreement with their enzymatic role (Figure 8A). In contrast, genes encoding RA biosynthetic enzymes, aldh1a2, aldh1a3, and rdh10 exhibit weak, not significant responses to the RA increase during early gastrula stages (Figure 8A); aldh1a2 and rdh10 exhibit slight downregulation, whereas aldh1a3 exhibits weak upregulation (Figure 8A). During late gastrula, however, all three RA biosynthetic genes exhibit a more robust and significant, RA-mediated downregulation (Figure 8A). These results indicate the very early establishment of RA self-regulatory network gene responses. While increased RA levels upregulate genes encoding enzymes that suppress the levels of RA from early gastrula, genes involved in the production of RA are downregulated only by late gastrula (Figure 8A).
FIGURE 8

RA autoregulation and control of LEM/PCM gene expression. (A) Embryos were treated with RA (100 nM) during late blastula stages and RNA samples were collected during early (st. 10.25) and late (st. 12) gastrula stages. The effect of the manipulation on RA network gene expression (dhrs3, cyp26a1, aldh1a2, aldh1a3, and rdh10) was determined by qPCR. The expression of hoxb1 was studied to monitor the changes in RA level. Samples were normalized to control expression level at each stage. (B,C) The expression of organizer genes linked to head formation (gsc, cer1, dkk1, frzb1, admp, otx2, and chrd.1) was analyzed in aldh1a2 and aldh1a3 CRISPants. The RA-regulated genes, cyp26a1, hoxa1, hoxb4, aldh1a2, and aldh1a3, were studied in parallel. The gene expression analysis was performed at st. 10.25 (B) and st. 12 (C). Relative expression was normalized to control expression levels at each stage. *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; ns, not significant.
To understand the contribution of the RA signaling centers during gastrulation to head development, we took advantage of the sgR2 and sgR3 gene-specific CRISPants and analyzed the effect on organizer genes previously shown to be involved in head development, i.e., head organizer genes. CRISPants were collected at early gastrula (st. 10.25) when the domains of aldh1a2 and aldh1a3 overlap, and during late gastrula when their domains are separate (Figure 4B). qPCR analysis of gsc, cer1, dkk1, frzb1, admp, otx2, and chrd.1 was performed, in addition to a number of known RA-regulated genes: cyp26a1, hoxa1, hoxb4, aldh1a2, and aldh1a3 (Figures 8B,C). During early gastrula, most genes studied exhibited some degree of downregulation in both aldh1a2 and aldh1a3 CRISPants (Figure 8B). This observation is in agreement with the required role of RA in the normal gene expression in the organizer and surrounding regions supporting the results of systemic RA manipulations (Figure 3). Interestingly, knockdown of either gene had similar effects suggesting that both enzymes contribute to the production of RA in the organizer. By late gastrula, however, the effect of the aldh1a2 and aldh1a3 CRISPants differs. While the gene expression changes to aldh1a2 knockdown are very slight, in aldh1a3 CRISPants most genes tested exhibited weak upregulation (Figure 8C). These results suggest that ALDH1A2 has a very limited effect on the expression of organizer genes that continue to be expressed in the LEM/PCM cells. In agreement with a role in head formation, ALDH1A3 knockdown affects most genes tested suggesting that in the LEM/PCM cells, RA modulates their expression.
Discussion
Retinoic Acid is Required for Head Formation
Induction of the anterior neuroectoderm including formation of the head is the focus of extensive study in developmental biology. In addition to the interest in the basic understanding of these processes, multiple human conditions arise from defects in these events including microcephaly and its accompanying cognitive disabilities. Numerous mutations or exposure to environmental factors can induce microcephaly in humans (
It is commonly accepted that RA has an inhibitory function on the development of the rostral neuroectodermal domain by promoting hindbrain expansion and malformations (
The Head-Promoting Activity of Retinoic Acid Localizes to the Organizer
Multiple studies have shown that RA is already present in the vertebrate embryonic organizer during early gastrula stages (
Although RA accumulation and signaling in the organizer has been known for many years, the gene-regulatory function of this early RA signal has remained elusive. Taking advantage of the inhibition of RA biosynthesis or all-trans RA treatments we manipulated embryos creating samples that contain a gradient of RA concentrations above and below the normal endogenous amount. In these samples we studied the expression of organizer genes known to contribute to the formation of the head. The results showed that the unmanipulated embryo contains an almost optimal amount of RA and that experimentally induced small concentration changes in either direction results in reduced organizer-specific gene expression. Therefore, RA is normally required for the expression of all the organizer genes tested, but it also prevents the overexpression of these genes.
The observation that RA signaling in the early organizer is required for head formation raised a number of possibilities regarding the identity of the cells affected and the genetic network involved. The genes we analyzed in the RA manipulated embryos have all been shown to play an early role in the formation of the head (Matsuo et al., 1995;
RALDH3 Produces the Retinoic Acid Needed for Head Formation
The results using inhibitors of RA biosynthesis (DEAB and citral) or degradation of the RA itself (CYP26A1) support a requirement for this signal during formation of the anterior head domain. To conclusively determine the involvement of RA in the early steps of head formation we set out to identify the source of this signal, i.e., the retinaldehyde dehydrogenase producing the RA for this activity. Two aldh1a genes are known to be expressed in the Spemann-Mangold organizer. Aldh1a2 is the first retinaldehyde dehydrogenase expressed at the onset of gastrulation (
To characterize the function of ALDH1A3 we took advantage of a knockdown approach. We could show that reducing ALDH1A3 activity induces microcephaly and prevents head formation in a secondary axis induction assay. These results show that from its earliest expression, ALDH1A3 is present in the cells normally involved in the formation of the head. Thus, RA is required for the normal induction and formation of the head and a retinaldehyde dehydrogenase is expressed in the right cells at the right developmental stages. The source of RA for the head-forming activity is provided by the aldh1a3-expressing cells that induce the head. ALDH1A2 knockdown induced a weaker microcephaly suggesting that the ALDH1A3 activity might play a more central role in the induction and formation of the head and aldh1a2 performs a very early function that can be partially compensated by aldh1a3.
Positive and Negative Regulation of Rostral Head Domains by Retinoic Acid
It is widely accepted that RA is a negative regulator of anterior brain regions based on extensive experimental evidence describing the transformation of anterior neural tissues to more posterior identities following RA treatment or mutation of genes involved in the attenuation of the RA signal (
FIGURE 9

RA biosynthetic/signaling centers during gastrulation. (A) Schematic depiction of an early gastrula embryo where the domain of overlapping aldh1a2 and aldh1a3 expression in the Spemann-Mangold organizer is marked (green box). The RA producing and regulatory activities are summarized. (B) Schematic summary of the two RA biosynthetic/signaling centers during late gastrula. The domains of expression and activity of aldh1a2 in the trunk (blue) and aldh1a3 in the LEM/PCM (purple) are shown.
A possible explanation for the apparent discrepancy between positive and negative regulation of head formation by RA could be a combination of timing and location. During early gastrula, we have previously described a delay in the invagination and migration of the LEM/PCM cells under reduced RA signaling conditions (Yelin et al., 2007; Yelin et al., 2005). In support of a role in the regulation of morphogenetic movements, vitamin A deficiency alters the extracellular matrix and the cellular activities dependent on it (
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Ethics statement
The animal study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the Hebrew University (Ethics approval no. MD-17-15281-3).
Author contributions
AF, MG, and LB-K. conceived and designed the experiments and analysis methodology. AF supervised the study and received funding. MG, LB-K, YS, and GP performed embryo experiments, designed sgRNAs and morpholino oligonucleotides, performed real-time PCR expression analysis and developed the figures. MG, LB-K, and AF interpreted the results and drafted the manuscript.
Funding
This work was funded in part by grants from the United States-Israel Binational Science Foundation (2017199), The Israel Science Foundation (668/17), the Manitoba Liquor and Lotteries (RG-003-21), and the Wolfson Family Chair in Genetics to AF.
Acknowledgments
We wish to thank Martin Blum and Tim Ott for introducing us to the CRISPR/Cas9 approach in Xenopus embryos. We thank Sally Moody for critically reading the manuscript.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcell.2022.844619/full#supplementary-material
Abbreviations
ALDH, aldehyde dehydrogenase; EAE, embryonic alcohol exposure; FASD, Fetal Alcohol Spectrum Disorder; FAS, Fetal Alcohol Syndrome; LEM, leading edge mesendoderm; PCM, prechordal mesoderm; RA, retinoic acid; RAL, retinaldehyde; ROL, retinol; SDR, short-chain dehydrogenase/reductase.
References
1
AbueloD. (2007). Microcephaly Syndromes. Semin. Pediatr. Neurol.14, 118–127. 10.1016/j.spen.2007.07.003
2
AlexandreD.ClarkeJ. D.OxtobyE.YanY. L.JowettT.HolderN. (1996). Ectopic Expression of Hoxa-1 in the Zebrafish Alters the Fate of the Mandibular Arch Neural Crest and Phenocopies a Retinoic Acid-Induced Phenotype. Development122, 735–746. 10.1242/dev.122.3.735
3
AngH. L.DuesterG. (1997). Initiation of Retinoid Signaling in Primitive Streak Mouse Embryos: Spatiotemporal Expression Patterns of Receptors and Metabolic Enzymes for Ligand Synthesis. Dev. Dyn.208, 536–543. 10.1002/(SICI)1097-0177(199704)208:4<536::AID-AJA9>3.0.CO;2-J
4
AngH. L.DuesterG. (1999). Stimulation of Premature Retinoic Acid Synthesis in Xenopus Embryos Following Premature Expression of Aldehyde Dehydrogenase ALDH1. Eur. J. Biochem.260, 227–234. 10.1046/j.1432-1327.1999.00139.x
5
BarberT.Esteban-PretelG.MarínM.TimonedaJ. (2014). Vitamin a Deficiency and Alterations in the Extracellular Matrix. Nutrients6, 4984–5017. 10.3390/nu6114984
6
BegemannG.SchillingT. F.RauchG.-J.GeislerR.InghamP. W. (2001). The Zebrafish Neckless Mutation Reveals a Requirement for raldh2 in Mesodermal Signals that Pattern the Hindbrain. Development128, 3081–3094. 10.1242/dev.128.16.3081
7
BelyaevaO. V.LeeS.-A.AdamsM. K.ChangC.KedishviliN. Y. (2012). Short Chain Dehydrogenase/reductase Rdhe2 is a Novel Retinol Dehydrogenase Essential for Frog Embryonic Development. J. Biol. Chem.287, 9061–9071. 10.1074/jbc.M111.336727
8
BlenticA.GaleE.MadenM. (2003). Retinoic Acid Signalling Centres in the Avian Embryo Identified by Sites of Expression of Synthesising and Catabolising Enzymes. Dev. Dyn.227, 114–127. 10.1002/dvdy.10292
9
BlitzI. L.ChoK. W. (1995). Anterior neurectoderm is progressively induced during gastrulation: the role of the Xenopus homeobox gene orthodenticle. Development121, 993–1004. 10.1242/dev.121.4.993
10
BlumM.De RobertisE. M.WallingfordJ. B.NiehrsC. (2015). Morpholinos: Antisense and Sensibility. Develop. Cel35, 145–149. 10.1016/j.devcel.2015.09.017
11
BrinkmanE. K.ChenT.AmendolaM.van SteenselB. (2014). Easy Quantitative Assessment of Genome Editing by Sequence Trace Decomposition. Nucleic Acids Res.42, e168. 10.1093/nar/gku936
12
Catharine RossA.ZolfaghariR. (2011). Cytochrome P450s in the Regulation of Cellular Retinoic Acid Metabolism. Annu. Rev. Nutr.31, 65–87. 10.1146/annurev-nutr-072610-145127
13
ChassaingN.GolzioC.OdentS.LequeuxL.VigourouxA.Martinovic-BourielJ.et al (2009). Phenotypic Spectrum of STRA6 Mutations: from Matthew-Wood Syndrome to Non-lethal Anophthalmia. Hum. Mutat.30, E673–E681. 10.1002/humu.21023
14
ChenY.HuangL.RussoA. F.SolurshM. (1992). Retinoic Acid is Enriched in Hensen's Node and is Developmentally Regulated in the Early Chicken Embryo. Proc. Natl. Acad. Sci.89, 10056–10059. 10.1073/pnas.89.21.10056
15
ChenY.HuangL.SolurshM. (1994). A Concentration Gradient of Retinoids in the Early Xenopus laevis Embryo. Develop. Biol.161, 70–76. 10.1006/dbio.1994.1008
16
ChenY.PolletN.NiehrsC.PielerT. (2001). Increased XRALDH2 Activity has a Posteriorizing Effect on the central Nervous System of Xenopus Embryos. Mech. Develop.101, 91–103. 10.1016/S0925-4773(00)00558-X
17
ChoK. W. Y.BlumbergB.SteinbeisserH.De RobertisE. M. (1991). Molecular Nature of Spemann's Organizer: the Role of the Xenopus Homeobox Gene Goosecoid. Cell67, 1111–1120. 10.1016/0092-8674(91)90288-a
18
ChristianJ. L.MoonR. T. (1993). Interactions between Xwnt-8 and Spemann Organizer Signaling Pathways Generate Dorsoventral Pattern in the Embryonic Mesoderm of Xenopus. Genes Dev.7, 13–28. 10.1101/gad.7.1.13
19
Clagett-DameM.DeLucaH. F. (2002). The Role of Vitamin A in Mammalian Reproduction and Embryonic Development. Annu. Rev. Nutr.22, 347–381. 10.1146/annurev.nutr.22.010402.102745E
20
Clagett-DameM.KnutsonD. (2011). Vitamin A in Reproduction and Development. Nutrients3, 385–428. 10.3390/nu3040385
21
CollinsM. D.MaoG. E. (1999). Teratology of Retinoids. Annu. Rev. Pharmacol. Toxicol.39, 399–430. 10.1146/annurev.pharmtox.39.1.399
22
ConlonR. A.RossantJ. (1992). Exogenous Retinoic Acid Rapidly Induces Anterior Ectopic Expression of Murine Hox-2 Genes In Vivo. Development116, 357–368. 10.1242/dev.116.2.357
23
CrabbD. W.MatsumotoM.ChangD.YouM. (2004). Overview of the Role of Alcohol Dehydrogenase and Aldehyde Dehydrogenase and Their Variants in the Genesis of Alcohol-Related Pathology. Proc. Nutr. Soc.63, 49–63. 10.1079/PNS2003327
24
CrandallJ. E.GoodmanT.McCarthyD. M.DuesterG.BhideP. G.DrägerU. C.et al (2011). Retinoic Acid Influences Neuronal Migration from the Ganglionic eminence to the Cerebral Cortex. J. Neurochem.119, 723–735. 10.1111/j.1471-4159.2011.07471.x
25
Creech KraftJ.SchuhT.JuchauM. R.KimelmanD. (1994). Temporal Distribution, Localization and Metabolism of All-Trans-Retinol, Didehydroretinol and All-Trans-Retinal during Xenopus Development. Biochem. J.301 (Pt 1), 111–119. 10.1042/bj3010111
26
CunninghamT. J.DuesterG. (2015). Mechanisms of Retinoic Acid Signalling and its Roles in Organ and Limb Development. Nat. Rev. Mol. Cel Biol.16, 110–123. 10.1038/nrm3932
27
de RoosK.SonneveldE.CompaanB.ten BergeD.DurstonA. J.van der SaagP. T. (1999). Expression of Retinoic Acid 4-hydroxylase (CYP26) during Mouse and Xenopus laevis Embryogenesis. Mech. Develop.82, 205–211. 10.1016/s0925-4773(99)00016-7
28
Del CampoM.JonesK. L. (2017). A Review of the Physical Features of the Fetal Alcohol Spectrum Disorders. Eur. J. Med. Genet.60, 55–64. 10.1016/j.ejmg.2016.10.004
29
DeltourL.AngH. L.DuesterG. (1996). Ethanol Inhibition of Retinoic Acid Synthesis as a Potential Mechanism for Fetal Alcohol Syndrome. FASEB J.10, 1050–1057. 10.1096/fasebj.10.9.8801166
30
DoschR.NiehrsC. (2000). Requirement for Anti-dorsalizing Morphogenetic Protein in Organizer Patterning. Mech. Develop.90, 195–203. 10.1016/s0925-4773(99)00245-2
31
DrautH.LiebensteinT.BegemannG. (2019). New Insights into the Control of Cell Fate Choices and Differentiation by Retinoic Acid in Cranial, Axial and Caudal Structures. Biomolecules9, 860. 10.3390/biom9120860
32
DuerinckxS.AbramowiczM. (2018). The Genetics of Congenitally Small Brains. Semin. Cel Develop. Biol.76, 76–85. 10.1016/j.semcdb.2017.09.015
33
DuesterG. (1991). A Hypothetical Mechanism for Fetal Alcohol Syndrome Involving Ethanol Inhibition of Retinoic Acid Synthesis at the Alcohol Dehydrogenase Step. Alcohol. Clin. Exp. Res.15, 568–572. 10.1111/j.1530-0277.1991.tb00562.x
34
DupéV.MattN.GarnierJ.-M.ChambonP.MarkM.GhyselinckN. B. (2003). A Newborn Lethal Defect Due to Inactivation of Retinaldehyde Dehydrogenase Type 3 is Prevented by Maternal Retinoic Acid Treatment. Proc. Natl. Acad. Sci.100, 14036–14041. 10.1073/pnas.2336223100
35
DurstonA. J.TimmermansJ. P. M.HageW. J.HendriksH. F. J.de VriesN. J.HeideveldM.et al (1989). Retinoic Acid Causes an Anteroposterior Transformation in the Developing central Nervous System. Nature340, 140–144. 10.1038/340140a0
36
DymentD. A.SawyerS. L.Warman-ChardonJ.BoycottK. M. (2013). Recent Advances in the Genetic Etiology of Brain Malformations. Curr. Neurol. Neurosci. Rep.13, 364. 10.1007/s11910-013-0364-1
37
ElseaS. H.WilliamsS. R. (2011). Smith-Magenis Syndrome: Haploinsufficiency of RAI1 Results in Altered Gene Regulation in Neurological and Metabolic Pathways. Expert Rev. Mol. Med.13, e14. 10.1017/S1462399411001827
38
EpsteinM.PillemerG.YelinR.YisraeliJ. K.FainsodA. (1997). Patterning of the Embryo along the Anterior-Posterior axis: the Role of the Caudal Genes. Development124, 3805–3814. 10.1242/dev.124.19.3805
39
FaheemM.NaseerM. I.RasoolM.ChaudharyA. G.KumosaniT. A.IlyasA. M.et al (2015). Molecular Genetics of Human Primary Microcephaly: an Overview. BMC Med. Genomics8 (Suppl. 1), S4. 10.1186/1755-8794-8-S1-S4
40
FainsodA.Kot-LeibovichH. (2018). Xenopus Embryos to Study Fetal Alcohol Syndrome, a Model for Environmental Teratogenesis. Biochem. Cel Biol.96, 77–87. 10.1139/bcb-2017-0219
41
FainsodA.SteinbeisserH.De RobertisE. M. (1994). On the Function of BMP-4 in Patterning the Marginal Zone of the Xenopus Embryo. EMBO J.13, 5015–5025. 10.1002/j.1460-2075.1994.tb06830.x
42
FainsodA.Bendelac-KaponL.ShabtaiY. (2020). Fetal Alcohol Spectrum Disorder: Embryogenesis under Reduced Retinoic Acid Signaling Conditions. Subcell Biochem.95, 197–225. 10.1007/978-3-030-42282-0_8
43
FainsodA.AbbouT.Bendelac-KaponL.EdriT.PillemerG. (2022). “Fetal Alcohol Spectrum Disorder as a Retinoic Acid Deficiency Syndrome,” in Fetal Alcohol Spectrum Disorder. Advances in Research and Practice. Editors ChudleyA. E.HicksG. G. (New York, NY: Springer Nature).
44
GautamP.NuñezS. C.NarrK. L.KanE. C.SowellE. R. (2014). Effects of Prenatal Alcohol Exposure on the Development of white Matter Volume and Change in Executive Function. NeuroImage Clin.5, 19–27. 10.1016/j.nicl.2014.05.010
45
GautamP.LebelC.NarrK. L.MattsonS. N.MayP. A.AdnamsC. M.et al (2015). Volume Changes and Brain-Behavior Relationships in white Matter and Subcortical gray Matter in Children with Prenatal Alcohol Exposure. Hum. Brain Mapp.36, 2318–2329. 10.1002/hbm.22772
46
GhyselinckN. B.DuesterG. (2019). Retinoic Acid Signaling Pathways. Development146, dev167502. 10.1242/dev.167502
47
GlinkaA.WuW.DeliusH.MonaghanA. P.BlumenstockC.NiehrsC. (1998). Dickkopf-1 is a Member of a New Family of Secreted Proteins and Functions in Head Induction. Nature391, 357–362. 10.1038/34848
48
GraffJ. M.ThiesR. S.SongJ. J.CelesteA. J.MeltonD. A. (1994). Studies with a Xenopus BMP Receptor Suggest that Ventral Mesoderm-Inducing Signals Override Dorsal Signals In Vivo. Cell79, 169–179. 10.1016/0092-8674(94)90409-x
49
GrandelH.LunK.RauchG.-J.RhinnM.PiotrowskiT.HouartC.et al (2002). Retinoic Acid Signalling in the Zebrafish Embryo is Necessary during Pre-segmentation Stages to Pattern the Anterior-Posterior axis of the CNS and to Induce a Pectoral Fin Bud. Development129, 2851–2865. 10.1242/dev.129.12.2851
50
GuerriC.BazinetA.RileyE. P. (2009). Foetal Alcohol Spectrum Disorders and Alterations in Brain and Behaviour. Alcohol Alcohol.44, 108–114. 10.1093/alcalc/agn105
51
HalilagicA.ZileM. H.StuderM. (2003). A Novel Role for Retinoids in Patterning the Avian Forebrain during Presomite Stages. Development130, 2039–2050. 10.1242/dev.00423
52
HalilagicA.RibesV.GhyselinckN. B.ZileM. H.DolléP.StuderM. (2007). Retinoids Control Anterior and Dorsal Properties in the Developing Forebrain. Develop. Biol.303, 362–375. 10.1016/j.ydbio.2006.11.021
53
HoganB. L. M.ThallerC.EicheleG. (1992). Evidence that Hensen's Node is a Site of Retinoic Acid Synthesis. Nature359, 237–241. 10.1038/359237a0
54
HollemannT.ChenY.GrunzH.PielerT. (1998). Regionalized Metabolic Activity Establishes Boundaries of Retinoic Acid Signalling. EMBO J.17, 7361–7372. 10.1093/emboj/17.24.7361
55
HoshijimaK.JurynecM. J.Klatt ShawD.JacobiA. M.BehlkeM. A.GrunwaldD. J. (2019). Highly Efficient CRISPR-Cas9-Based Methods for Generating Deletion Mutations and F0 Embryos that Lack Gene Function in Zebrafish. Develop. Cel51, 645–657. 10.1016/j.devcel.2019.10.004
56
HsiauT.ConantD.RossiN.MauresT.WaiteK.YangJ.et al (2018). Inference of CRISPR Edits from Sanger Trace Data. BioRxiv. 10.1101/251082
57
HuangY.WinklbauerR. (2018). Cell Migration in the Xenopus Gastrula. WIREs Dev. Biol.7, e325. 10.1002/wdev.325
58
InuiM.MontagnerM.Ben-ZviD.MartelloG.SoligoS.ManfrinA.et al (2012). Self-regulation of the Head-Inducing Properties of the Spemann Organizer. Proc. Natl. Acad. Sci. USA109, 15354–15359. 10.1073/pnas.1203000109
59
IshibashiH.MatsumuraN.HanafusaH.MatsumotoK.RobertisE. M. D.KurodaH. (2008). Expression of Siamois and Twin in the Blastula Chordin/Noggin Signaling center is Required for Brain Formation in Xenopus laevis Embryos. Mech. Develop.125, 58–66. 10.1016/j.mod.2007.10.005
60
JarmaszJ. S.BasalahD. A.ChudleyA. E.Del BigioM. R. (2017). Human Brain Abnormalities Associated with Prenatal Alcohol Exposure and Fetal Alcohol Spectrum Disorder. J. Neuropathol. Exp. Neurol.76, 813–833. 10.1093/jnen/nlx064
61
KanedaT.MotokiJ.-y. D. (2012). Gastrulation and Pre-gastrulation Morphogenesis, Inductions, and Gene Expression: Similarities and Dissimilarities between Urodelean and Anuran Embryos. Develop. Biol.369, 1–18. 10.1016/j.ydbio.2012.05.019
62
KaoK. R.ElinsonR. P. (1988). The Entire Mesodermal Mantle Behaves as Spemann's Organizer in Dorsoanterior Enhanced Xenopus laevis Embryos. Develop. Biol.127, 64–77. 10.1016/0012-1606(88)90189-3
63
KedishviliN. Y. (2013). Enzymology of Retinoic Acid Biosynthesis and Degradation. J. Lipid Res.54, 1744–1760. 10.1194/jlr.R037028
64
KieckerC.LumsdenA. (2012). The Role of Organizers in Patterning the Nervous System. Annu. Rev. Neurosci.35, 347–367. 10.1146/annurev-neuro-062111-150543
65
Kin Ting KamR.DengY.ChenY.ZhaoH. (2012). Retinoic Acid Synthesis and Functions in Early Embryonic Development. Cell Biosci.2, 11. 10.1186/2045-3701-2-11
66
KoideT.DownesM.ChandraratnaR. A. S.BlumbergB.UmesonoK. (2001). Active Repression of RAR Signaling is Required for Head Formation. Genes Dev.15, 2111–2121. 10.1101/gad.908801
67
KoideT.UmesonoK.HashimotoC. (2002). When Does the Anterior Endomesderm Meet the Anterior-Most Neuroectoderm during Xenopus Gastrulation?Int. J. Dev. Biol.46, 777–783.
68
Kot-LeibovichH.FainsodA. (2009). Ethanol Induces Embryonic Malformations by Competing for Retinaldehyde Dehydrogenase Activity during Vertebrate Gastrulation. Dis. Model. Mech.2, 295–305. 10.1242/dmm.001420
69
KoyabuD.WerneburgI.MorimotoN.ZollikoferC. P. E.ForasiepiA. M.EndoH.et al (2014). Mammalian Skull Heterochrony Reveals Modular Evolution and a Link between Cranial Development and Brain Size. Nat. Commun.5, 3625. 10.1038/ncomms4625
70
KraftJ. C.SchuhT.JuchauM.KimelmanD. (1994). The Retinoid X Receptor Ligand, 9-Cis-Retinoic Acid, is a Potential Regulator of Early Xenopus Development. Proc. Natl. Acad. Sci.91, 3067–3071. 10.1073/pnas.91.8.3067
71
KriegP. A.SakaguchiD. S.KintnerC. R. (1989). Primary Structure and Developmental Expression of a Large Cytoptasmic Domain Form of Xenopus Laevisneural Cell Adhesion Molecule (NCAM). Nucl. Acids Res.17, 10321–10335. 10.1093/nar/17.24.10321
72
KurodaH.WesselyO.RobertisE. M. D. (2004). Neural Induction in Xenopus: Requirement for Ectodermal and Endomesodermal Signals via Chordin, Noggin, β-Catenin, and Cerberus. Plos Biol.2, E92. 10.1371/journal.pbio.0020092
73
LiH.TierneyC.WenL.WuJ. Y.RaoY. (1997). A Single Morphogenetic Field Gives Rise to Two Retina Primordia under the Influence of the Prechordal Plate. Development124, 603–615. 10.1242/dev.124.3.603
74
LiangD.ZhangM.BaoJ.ZhangL.XuX.GaoX.et al (2008). Expressions of Raldh3 and Raldh4 during Zebrafish Early Development. Gene Expr. Patterns8, 248–253. 10.1016/j.gep.2007.12.007
75
Lloret-VilaspasaF.JansenH. J.DeroosK.ChandraratnaR. A. S.ZileM. H.SternC. D.et al (2010). Retinoid Signalling is Required for Information Transfer from Mesoderm to Neuroectoderm during Gastrulation. Int. J. Dev. Biol.54, 599–608. 10.1387/ijdb.082705fl
76
LohnesD.MarkM.MendelsohnC.DolléP.DierichA.GorryP.et al (1994). Function of the Retinoic Acid Receptors (RARs) during Development (I). Craniofacial and Skeletal Abnormalities in RAR Double Mutants. Development120, 2723–2748. 10.1242/dev.120.10.2723
77
LupoG.LiuY.QiuR.ChandraratnaR. A. S.BarsacchiG.HeR.-Q.et al (2005). Dorsoventral Patterning of the Xenopus Eye: a Collaboration of Retinoid, Hedgehog and FGF Receptor Signaling. Development132, 1737–1748. 10.1242/dev.01726
78
MadenM. (2000). The Role of Retinoic Acid in Embryonic and post-embryonic Development. Proc. Nutr. Soc.59, 65–73. 10.1017/s0029665100000082
79
MarkM.GhyselinckN. B.ChambonP. (2006). Function of Retinoid Nuclear Receptors: Lessons from Genetic and Pharmacological Dissections of the Retinoic Acid Signaling Pathway during Mouse Embryogenesis. Annu. Rev. Pharmacol. Toxicol.46, 451–480. 10.1146/annurev.pharmtox.46.120604.141156
80
MarkM.GhyselinckN. B.ChambonP. (2009). Function of Retinoic Acid Receptors during Embryonic Development. Nucl. Recept. Signal.7, nrs.07002. 10.1621/nrs.07002
81
MaromK.LevyV.PillemerG.FainsodA. (2005). Temporal Analysis of the Early BMP Functions Identifies Distinct Anti-organizer and Mesoderm Patterning Phases. Develop. Biol.282, 442–454. 10.1016/j.ydbio.2005.03.024
82
MartiniM.KlausingA.LüchtersG.HeimN.Messing-JüngerM. (2018). Head Circumference - a Useful Single Parameter for Skull Volume Development in Cranial Growth Analysis?Head Face Med.14, 3. 10.1186/s13005-017-0159-8
83
MatsuoI.KurataniS.KimuraC.TakedaN.AizawaS. (1995). Mouse Otx2 Functions in the Formation and Patterning of Rostral Head. Genes Dev.9, 2646–2658. 10.1101/gad.9.21.2646
84
MendelsohnC.LohnesD.DécimoD.LufkinT.LeMeurM.ChambonP.et al (1994). Function of the Retinoic Acid Receptors (RARs) during Development (II). Multiple Abnormalities at Various Stages of Organogenesis in RAR Double Mutants. Development120, 2749–2771. 10.1242/dev.120.10.2749
85
MicF. A.MolotkovA.MolotkovaN.DuesterG. (2004). Raldh2 Expression in Optic Vesicle Generates a Retinoic Acid Signal Needed for Invagination of Retina during Optic Cup Formation. Dev. Dyn.231, 270–277. 10.1002/dvdy.20128
86
MochidaG. H. (2009). Genetics and Biology of Microcephaly and Lissencephaly. Semin. Pediatr. Neurol.16, 120–126. 10.1016/j.spen.2009.07.001
87
MolotkovaN.MolotkovA.DuesterG. (2007). Role of Retinoic Acid during Forebrain Development Begins Late when Raldh3 Generates Retinoic Acid in the Ventral Subventricular Zone. Develop. Biol.303, 601–610. 10.1016/j.ydbio.2006.11.035
88
Moreno-MateosM. A.VejnarC. E.BeaudoinJ.-D.FernandezJ. P.MisE. K.KhokhaM. K.et al (2015). CRISPRscan: Designing Highly Efficient sgRNAs for CRISPR-Cas9 Targeting In Vivo. Nat. Methods12, 982–988. 10.1038/nmeth.3543
89
MorganC. A.ParajuliB.BuchmanC. D.DriaK.HurleyT. D. (2015). N,N-diethylaminobenzaldehyde (DEAB) as a Substrate and Mechanism-Based Inhibitor for Human ALDH Isoenzymes. Chem. Biol. Interact.234, 18–28. 10.1016/j.cbi.2014.12.008
90
MuralidharanP.SarmahS.MarrsJ. A. (2015). Zebrafish Retinal Defects Induced by Ethanol Exposure are Rescued by Retinoic Acid and Folic Acid Supplement. Alcohol49, 149–163. 10.1016/j.alcohol.2014.11.001
91
NaertT.TulkensD.EdwardsN. A.CarronM.ShaidaniN.-I.WlizlaM.et al (2020). Maximizing CRISPR/Cas9 Phenotype Penetrance Applying Predictive Modeling of Editing Outcomes in Xenopus and Zebrafish Embryos. Sci. Rep.10, 14662. 10.1038/s41598-020-71412-0
92
NaitoY.HinoK.BonoH.Ui-TeiK. (2015). CRISPRdirect: Software for Designing CRISPR/Cas Guide RNA with Reduced Off-Target Sites. Bioinformatics31, 1120–1123. 10.1093/bioinformatics/btu743
93
NakatsujiN. (1983). Craniofacial Malformation inXenopus Laevis Tadpoles Caused by the Exposure of Early Embryos to Ethanol. Teratology28, 299–305. 10.1002/tera.1420280220
94
NataleV.RajagopalanA. (2014). Worldwide Variation in Human Growth and the World Health Organization Growth Standards: a Systematic Review. BMJ Open4, e003735. 10.1136/bmjopen-2013-003735
95
NenniM. J.FisherM. E.James-ZornC.PellsT. J.PonferradaV.ChuS.et al (2019). Xenbase: Facilitating the Use of Xenopus to Model Human Disease. Front. Physiol.10, 154. 10.3389/fphys.2019.00154
96
NiccolsA. (2007). Fetal Alcohol Syndrome and the Developing Socio-Emotional Brain. Brain Cogn.65, 135–142. 10.1016/j.bandc.2007.02.009
97
NiederreitherK.McCafferyP.DrägerU. C.ChambonP.DolléP. (1997). Restricted Expression and Retinoic Acid-Induced Downregulation of the Retinaldehyde Dehydrogenase Type 2 (RALDH-2) Gene during Mouse Development. Mech. Develop.62, 67–78. 10.1016/S0925-4773(96)00653-3
98
NiederreitherK.SubbarayanV.DolléP.ChambonP. (1999). Embryonic Retinoic Acid Synthesis is Essential for Early Mouse post-implantation Development. Nat. Genet.21, 444–448. 10.1038/7788
99
NiehrsC.KazanskayaO.WuW.GlinkaA. (2001). Dickkopf1 and the Spemann-Mangold Head Organizer. Int. J. Dev. Biol.45, 237–240.
100
NiehrsC. (2004). Regionally Specific Induction by the Spemann-Mangold Organizer. Nat. Rev. Genet.5, 425–434. 10.1038/nrg1347
101
NieuwkoopP. D.FaberJ. (1967). Normal Table of Xenopus laevis (Daudin): A Systematical and Chronological Survey of the Development from the Fertilized Egg till the End of Metamorphosis. Amsterdam: North-Holland Publishing Company.
102
NolteC.De KumarB.KrumlaufR. (2019). Hox Genes: Downstream “Effectors” of Retinoic Acid Signaling in Vertebrate Embryogenesis. Genesis57, e23306. 10.1002/dvg.23306
103
PanneseM.PoloC.AndreazzoliM.VignaliR.KablarB.BarsacchiG. (1995). The Xenopus homologue of Otx2 is a maternal homeobox gene that demarcates and specifies anterior body regions. Development121, 707–720. 10.1242/dev.121.3.707
104
PariharM.Bendelac-KaponL.GurM.AbbouT.BelorkarA.AchantaS.et al (2021). Retinoic Acid Fluctuation Activates an Uneven, Direction-dependent Network-wide Robustness Response in Early Embryogenesis. Front. Cel Dev. Biol.9, 747969. 10.3389/fcell.2021.747969
105
Perz-EdwardsA.HardisonN. L.LinneyE. (2001). Retinoic Acid-Mediated Gene Expression in Transgenic Reporter Zebrafish. Develop. Biol.229, 89–101. 10.1006/dbio.2000.9979
106
PetrelliB.BendelacL.HicksG. G.FainsodA. (2019). Insights into Retinoic Acid Deficiency and the Induction of Craniofacial Malformations and Microcephaly in Fetal Alcohol Spectrum Disorder. Genesis57, e23278. 10.1002/dvg.23278
107
PopovaS.LangeS.ShieldK.MihicA.ChudleyA. E.MukherjeeR. A. S.et al (2016). Comorbidity of Fetal Alcohol Spectrum Disorder: a Systematic Review and Meta-Analysis. The Lancet387, 978–987. 10.1016/S0140-6736(15)01345-8
108
PullarkatR. K. (1991). Hypothesis: Prenatal Ethanol-Induced Birth Defects and Retinoic Acid. Alcohol. Clin. Exp. Res.15, 565–567. 10.1111/j.1530-0277.1991.tb00561.x
109
RankeM. B.Krägeloh-MannI.VollmerB. (2015). Growth, Head Growth, and Neurocognitive Outcome in Children Born Very Preterm: Methodological Aspects and Selected Results. Dev. Med. Child. Neurol.57, 23–28. 10.1111/dmcn.12582
110
RhinnM.DolléP. (2012). Retinoic Acid Signalling during Development. Development139, 843–858. 10.1242/dev.065938
111
RhinnM.SchuhbaurB.NiederreitherK.DolléP. (2011). Involvement of Retinol Dehydrogenase 10 in Embryonic Patterning and rescue of its Loss of Function by Maternal Retinaldehyde Treatment. Proc. Natl. Acad. Sci.108, 16687–16692. 10.1073/pnas.1103877108
112
RibesV.WangZ.DolléP.NiederreitherK. (2006). Retinaldehyde Dehydrogenase 2 (RALDH2)-Mediated Retinoic Acid Synthesis Regulates Early Mouse Embryonic Forebrain Development by Controlling FGF and Sonic Hedgehog Signaling. Development133, 351–361. 10.1242/dev.02204
113
RibesV.FraulobV.PetkovichM.DolléP. (2007). The Oxidizing Enzyme CYP26a1 Tightly Regulates the Availability of Retinoic Acid in the Gastrulating Mouse Embryo to Ensure Proper Head Development and Vasculogenesis. Dev. Dyn.236, 644–653. 10.1002/dvdy.21057
114
RossS. A.McCafferyP. J.DragerU. C.De LucaL. M. (2000). Retinoids in Embryonal Development. Physiol. Rev.80, 1021–1054. 10.1152/physrev.2000.80.3.1021
115
RossantJ.ZirngiblR.CadoD.ShagoM.GiguèreV. (1991). Expression of a Retinoic Acid Response Element-hsplacZ Transgene Defines Specific Domains of Transcriptional Activity during Mouse Embryogenesis. Genes Dev.5, 1333–1344. 10.1101/gad.5.8.1333
116
RoussotteF. F.SulikK. K.MattsonS. N.RileyE. P.JonesK. L.AdnamsC. M.et al (2012). Regional Brain Volume Reductions Relate to Facial Dysmorphology and Neurocognitive Function in Fetal Alcohol Spectrum Disorders. Hum. Brain Mapp.33, 920–937. 10.1002/hbm.21260
117
RussoJ. E.HauquitzD.HiltonJ. (1988). Inhibition of Mouse Cytosolic Aldehyde Dehydrogenase by 4-(diethylamino) benzaldehyde. Biochem. Pharmacol.37, 1639–1642. 10.1016/0006-2952(88)90030-5
118
SamarutE.FraherD.LaudetV.GibertY. (2015). ZebRA: An Overview of Retinoic Acid Signaling during Zebrafish Development. Biochim. Biophys. Acta Gene Regul. Mech.1849, 73–83. 10.1016/j.bbagrm.2014.05.030
119
SandellL. L.SandersonB. W.MoiseyevG.JohnsonT.MushegianA.YoungK.et al (2007). RDH10 is Essential for Synthesis of Embryonic Retinoic Acid and is Required for Limb, Craniofacial, and Organ Development. Genes Dev.21, 1113–1124. 10.1101/gad.1533407
120
SasaiY.LuB.SteinbeisserH.GeissertD.GontL. K.De RobertisE. M. (1994). Xenopus Chordin: a Novel Dorsalizing Factor Activated by Organizer-specific Homeobox Genes. Cell79, 779–790. 10.1016/0092-8674(94)90068-x
121
SeeA. W.-M.KaiserM. E.WhiteJ. C.Clagett-DameM. (2008). A Nutritional Model of Late Embryonic Vitamin A Deficiency Produces Defects in Organogenesis at a High Penetrance and Reveals New Roles for the Vitamin in Skeletal Development. Develop. Biol.316, 171–190. 10.1016/j.ydbio.2007.10.018
122
ShabtaiY.FainsodA. (2018). Competition between Ethanol Clearance and Retinoic Acid Biosynthesis in the Induction of Fetal Alcohol Syndrome. Biochem. Cel Biol.96, 148–160. 10.1139/bcb-2017-0132
123
ShabtaiY.JubranH.NassarT.HirschbergJ.FainsodA. (2016). Kinetic Characterization and Regulation of the Human Retinaldehyde Dehydrogenase 2 Enzyme during Production of Retinoic Acid. Biochem. J.473, 1423–1431. 10.1042/BCJ20160101
124
ShabtaiY.BendelacL.JubranH.HirschbergJ.FainsodA. (2018). Acetaldehyde Inhibits Retinoic Acid Biosynthesis to Mediate Alcohol Teratogenicity. Sci. Rep.8, 347. 10.1038/s41598-017-18719-7
125
ShenM. W.ArbabM.HsuJ. Y.WorstellD.CulbertsonS. J.KrabbeO.et al (2018). Predictable and Precise Template-free CRISPR Editing of Pathogenic Variants. Nature563, 646–651. 10.1038/s41586-018-0686-x
126
ShiotsuguJ.KatsuyamaY.ArimaK.BaxterA.KoideT.SongJ.et al (2004). Multiple Points of Interaction between Retinoic Acid and FGF Signaling during Embryonic Axis Formation. Development131, 2653–2667. 10.1242/dev.01129
127
ShukrunN.ShabtaiY.PillemerG.FainsodA. (2019). Retinoic Acid Signaling Reduction Recapitulates the Effects of Alcohol on Embryo Size. Genesis57, e23284. 10.1002/dvg.23284
128
SiveH. L.HattoriK.WeintraubH. (1989). Progressive Determination during Formation of the Anteroposterior axis in Xenopus laevis. Cell58, 171–180. 10.1016/0092-8674(89)90413-3
129
SiveH. L.DraperB. W.HarlandR. M.WeintraubH. (1990). Identification of a Retinoic Acid-Sensitive Period during Primary axis Formation in Xenopus laevis. Genes Dev.4, 932–942. 10.1101/gad.4.6.932
130
SmithW. C.KnechtA. K.WuM.HarlandR. M. (1993). Secreted Noggin Protein Mimics the Spemann Organizer in Dorsalizing Xenopus Mesoderm. Nature361, 547–549. 10.1038/361547a0
131
SokolS.ChristianJ. L.MoonR. T.MeltonD. A. (1991). Injected Wnt RNA Induces a Complete Body axis in Xenopus Embryos. Cell67, 741–752. 10.1016/0092-8674(91)90069-b
132
SpemannH.MangoldH. (1924). über Induktion von Embryonalanlagen durch Implantation artfremder Organisatoren. Archiv F Mikr Anat. U Entwicklungsmechanik100, 599–638. 10.1007/bf02108133
133
SpohrH.-L.SteinhausenH.-C. (2008). Fetal Alcohol Spectrum Disorders and their Persisting Sequelae in Adult Life. Dtsch Arztebl Int.105, 693–698. 10.3238/arztebl.2008.0693
134
StrateI.MinT. H.IlievD.PeraE. M. (2009). Retinol Dehydrogenase 10 is a Feedback Regulator of Retinoic Acid Signalling during axis Formation and Patterning of the central Nervous System. Development136, 461–472. 10.1242/dev.024901
135
TanakaS.HosokawaH.WeinbergE. S.MaegawaS. (2017). Chordin and Dickkopf-1b are Essential for the Formation of Head Structures through Activation of the FGF Signaling Pathway in Zebrafish. Develop. Biol.424, 189–197. 10.1016/j.ydbio.2017.02.018
136
TandonP.ConlonF.FurlowJ. D.HorbM. E. (2017). Expanding the Genetic Toolkit in Xenopus : Approaches and Opportunities for Human Disease Modeling. Develop. Biol.426, 325–335. 10.1016/j.ydbio.2016.04.009
137
TanibeM.MichiueT.YukitaA.DannoH.IkuzawaM.IshiuraS.et al (2008). Retinoic Acid Metabolizing Factor xCyp26c is Specifically Expressed in Neuroectoderm and Regulates Anterior Neural Patterning in Xenopus laevis. Int. J. Dev. Biol.52, 893–901. 10.1387/ijdb.082683mt
138
TanibeM.IshiuraS.-I.AsashimaM.MichiueT. (2012). xCOUP-TF-B Regulates xCyp26 Transcription and Modulates Retinoic Acid Signaling for Anterior Neural Patterning in Xenopus. Int. J. Dev. Biol.56, 239–244. 10.1387/ijdb.113482mt
139
ToiA.ChitayatD.BlaserS. (2009). Abnormalities of the Foetal Cerebral Cortex. Prenat. Diagn.29, 355–371. 10.1002/pd.2211
140
TreitS.ChenZ.ZhouD.BaughL.RasmussenC.AndrewG.et al (2017). Sexual Dimorphism of Volume Reduction but Not Cognitive Deficit in Fetal Alcohol Spectrum Disorders: A Combined Diffusion Tensor Imaging, Cortical Thickness and Brain Volume Study. NeuroImage Clin.15, 284–297. 10.1016/j.nicl.2017.05.006
141
TwalW.RozeL.ZileM. H. (1995). Anti-retinoic Acid Monoclonal Antibody Localizes All-Trans-Retinoic Acid in Target Cells and Blocks normal Development in Early Quail Embryo. Develop. Biol.168, 225–234. 10.1006/dbio.1995.1075
142
UlvenS. M.GundersenT. E.WeedonM. S.LandaasV. Ø.SakhiA. K.FrommS. H.et al (2000). Identification of Endogenous Retinoids, Enzymes, Binding Proteins, and Receptors during Early Postimplantation Development in Mouse: Important Role of Retinal Dehydrogenase Type 2 in Synthesis of All-Trans-Retinoic Acid. Develop. Biol.220, 379–391. 10.1006/dbio.2000.9634
143
VermotJ.NiederreitherK.GarnierJ.-M.ChambonP.DolléP. (2003). Decreased Embryonic Retinoic Acid Synthesis Results in a DiGeorge Syndrome Phenotype in Newborn Mice. Proc. Natl. Acad. Sci.100, 1763–1768. 10.1073/pnas.0437920100
144
WestonA. D.BlumbergB.UnderhillT. M. (2003). Active Repression by Unliganded Retinoid Receptors in Development. J. Cel Biol.161, 223–228. 10.1083/jcb.200211117
145
WhitingJ. (1997). Craniofacial Abnormalities Induced by the Ectopic Expression of Homeobox Genes. Mutat. Res. Fund. Mol. Mech. Mutagen.396, 97–112. 10.1016/s0027-5107(97)00177-2
146
YanagiT.ItoK.NishiharaA.MinaminoR.MoriS.SumidaM.et al (2015). The S Pemann Organizer Meets the Anterior‐most Neuroectoderm at the Equator of Early Gastrulae in Amphibian Species. Develop. Growth Differ.57, 218–231. 10.1111/dgd.12200
147
YelinR.Ben-Haroush SchyrR.KotH.ZinsS.FrumkinA.PillemerG.et al (2005). Ethanol Exposure Affects Gene Expression in the Embryonic Organizer and Reduces Retinoic Acid Levels. Develop. Biol.279, 193–204. 10.1016/j.ydbio.2004.12.014
148
YelinR.KotH.YelinD.FainsodA. (2007). Early Molecular Effects of Ethanol during Vertebrate Embryogenesis. Differentiation75, 393–403. 10.1111/j.1432-0436.2006.00147.x
149
ZaffranS.OdelinG.StefanovicS.LescroartF.EtcheversH. C. (2018). Ectopic Expression of Hoxb1 Induces Cardiac and Craniofacial Malformations. Genesis56, e23221. 10.1002/dvg.23221
150
ZhongG.HogarthC.SnyderJ. M.PalauL.ToppingT.HuangW.et al (2019). The Retinoic Acid Hydroxylase Cyp26a1 Has Minor Effects on Postnatal Vitamin A Homeostasis, but is Required for Exogenous atRA Clearance. J. Biol. Chem.294, 11166–11179. 10.1074/jbc.RA119.009023
Summary
Keywords
retinoic acid biosynthesis, embryo development, Xenopus embryo, CRISPR/Cas9, gene knockdown, Fetal Alcohol Syndrome, prechordal mesoderm, retinaldehyde dehydrogenase
Citation
Gur M, Bendelac-Kapon L, Shabtai Y, Pillemer G and Fainsod A (2022) Reduced Retinoic Acid Signaling During Gastrulation Induces Developmental Microcephaly. Front. Cell Dev. Biol. 10:844619. doi: 10.3389/fcell.2022.844619
Received
28 December 2021
Accepted
24 February 2022
Published
14 March 2022
Volume
10 - 2022
Edited by
Silvia L. López, CONICET Instituto de Biología Celular y Neurociencias (IBCN), Argentina
Reviewed by
James Alan Marrs, Indiana University—Purdue University Indianapolis, United States
Jean-Pierre Saint-Jeannet, New York University, United States
Updates

Check for updates
Copyright
© 2022 Gur, Bendelac-Kapon, Shabtai, Pillemer and Fainsod.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Abraham Fainsod, abraham.fainsod@mail.huji.ac.il
† These authors share first authorship
This article was submitted to Morphogenesis and Patterning, a section of the journal Frontiers in Cell and Developmental Biology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.