Abstract
Introduction:
Recent evidence supports the hypothesis of an association between gut microbiota and the pathogenesis of retinal and eye diseases, suggesting the existence of a gut-eye axis. However, no data are available on the possible effect of the gut microbiota on the optic nerve fiber maturation and myelin development.
Methods:
We investigated the impact of gut microbiota on the optic nerves collected from neonatal and young adult germ-free (GF), gnotobiotic (stably colonized with 12 bacteria strains, OMM12) and control (colonized with a complex gut microbiota, CGM) mice, by performing stereological and morphoquantitative analyses with transmission electron microscopy and gene expression analysis by quantitative real-time PCR.
Results:
Young adult GF and OMM12 optic nerve axons are smaller and hypermyelinated compared to CGM ones, while no such differences were detected in neonatal optic nerves. The transcription factors Olig1, Olig2, and Sox10 (oligodendrocyte myelination positive regulators) are downregulated in CGM and OMM12 young adult mice compared to the respective neonates. Such developmental downregulation was not observed in GF optic nerves, suggesting that the absence of the gut microbiota prolongs the stimulation of optic nerve fiber myelination, possibly through mechanisms that are yet to be identified.
Discussion:
Altogether, these data underscore the gut microbiota pivotal role in driving optic nerve myelination, contributing to our knowledge about both the gut-eye axis and the gut-brain axis, and opening new horizons for further investigations that will explore the role of the microbiota also in pathologies, injuries and regeneration associated with the optic nerve.
Introduction
The optic nerve is the second cranial nerve responsible for transmitting special sensory information for vision from the retina to the brain, and contains only afferent (sensory) fibers. These fibers are the extensions of ganglion cells located in the ganglion cell layer of the retina (Smith and Czyz, 2024). The optic nerve also contains different types of glial cells, namely, oligodendrocytes, astrocytes, microglia, and neuron glial antigen 2 (NG2) expressing cells, which support the functionality of the optic nerve fibers (Yazdankhah et al., 2021). Damage to the optic nerve or along the visual pathway can cause a variety of visual field defects (Sarkies, 2004; ).
The optic nerve is considered a central nervous system (CNS) structure, like the cranial nerves III-XII. The optic nerve is derived from the outpouching optic vesicles from embryonic diencephalon during development. As a CNS structure, the optic nerve is myelinated by oligodendrocytes and is ensheathed in the three meningeal layers (dura mater, arachnoid mater, and pia mater) (Smith and Czyz, 2024).
Myelination of axons by specific glial cells is a dynamic process spanning from early life to adulthood in both the peripheral nervous system (PNS) and CNS, and it is crucial for regulating motor, sensory and higher-order cognitive functions (; ). Over the past decade, there has been a significant surge in research on the gut-microbiota-brain axis, revealing compelling connections between the gut microbiota composition and the structure and function of the brain. Recent findings underscored the pivotal role of the gut microbiota in regulating CNS myelination (; ; ; Sharvin et al., 2023), while we could demonstrate a direct connection between gut microbiota composition and myelination in the PNS (; ).
The gut microbiota consists of the collection of bacteria, archaea, viruses and eukarya inhabiting the gastrointestinal tract and its composition undergoes dynamic changes from birth to adulthood (). Various factors, including the mode of colonization, antibiotic use, dietary habits, lifestyle, and age, contribute to the continuous modifications in the gut microbiota composition throughout an individual’s life (Thursby and Juge, 2017). It is also noteworthy that with regard to the developing nervous system, the maternal gut microbiome plays a crucial role (Vuong et al., 2020; ). The gut microbiota - more specifically, its “products” and metabolites - plays a pivotal role in sustaining host health, and alterations in its composition have been linked to a spectrum of diseases, including inflammatory bowel diseases, autoimmune disorders, neurological conditions, cardiovascular and liver diseases, and more (; ; ). Investigating the impact of the gut microbiota and its metabolites on host health represents therefore one of the most active fields of biomedical research and can be expected to enhance our understanding of disease mechanisms and to inspire the development of innovative therapeutic strategies in disease management.
The relationship between the eye and the gut microbiota is an emerging area of research () and recent studies have highlighted a potential association between gut microbiota and ocular health, suggesting the existence of a “gut–eye axis” implicated in the development and progression of multiple ocular conditions including uveitis, age-related macular degeneration, diabetic retinopathy, dry eye, glaucoma and chalazion (; Scuderi et al., 2021; ; ). Together with the gut microbiota, also the ocular surface microbiota has been shown to influence the occurrence of various eye diseases, such as blepharitis, conjunctivitis, keratitis, trachoma and dry eye syndrome (Song et al., 2024; Xue et al., 2021). Despite the increasing number of studies on this topic, to date the literature lacks data regarding the influence of gut (or others) microbiota on the maturation of optic nerve fibers and the development of their myelination. To fill this gap, in the current study, we analyzed optic nerves from neonatal and young adult germ-free (GF), gnotobiotic (stably colonized with 12 bacteria strains, Oligo-Mouse-Microbiota 12, OMM12), and mice characterized by a specific pathogen-free, but complex, gut microbiota composition (CGM).
Materials and methods
Mice and sample collection
Samples were harvested from the same animals used for a recently published previous study (). Briefly, neonatal (P8-14) and young adult (63–67 days old) germ-free (GF), gnotobiotic (colonized with Oligo-Mouse-Microbiota 12, OMM12 ()], and specific pathogen-free C57BL6/JZtm (harboring specific-pathogen free, complex gut microbiota, CGM) mice were obtained from the Central Animal Facility at Hannover Medical School, Hannover, Germany. By colonising GF C57BL6/JZtm mice with their respective microbiota, microbiota-colonised mice (CGM and OMM12) were generated. The colonization procedure was repeated every 10 generations to avoid the formation of substrains. The breeding and maintenance of GF and OMM12 mice was performed in plastic film isolators (Metall + Plastik GmbH, Radolfzell-Stahringen, Germany) located in a room with a controlled environment (20°C–22°C, 50%–55% humidity) and 12-h light/dark cycles. The animals were collected sequentially over a period of several months from stable breeding colonies (CGM, OMM12 and GF) depending on their availability. The animals were sacrificed by decapitation (young adult ones after inducing anesthesia in CO2 atmosphere). Further details about gut microbiota colonization procedure, breeding and maintenance, as well as protocols for screening of GF and OMM12 colonies and results of the shallow shotgun metagenomics we carried out on young adult CGM and OMM12 mice fecal pellets are available in our previous published work ().
All procedures were performed in accordance with the German Animal Welfare Legislation and the principles of the Basel Declaration and recommendations of Directive 2010/63/EU, and were approved by the local Institutional Animal Care and Research Advisory Committee and registered with the Animal Care Committee of Lower-Saxony, Germany. Breeding and animal husbandry was registered under the number 42500/1H according to §11 of the German protection of animals act (TierSchG). Animal sacrifice for scientific purposes was announced to the authorities under the numbers §4 2021-289 (postnatal mice) and §4 2017-171 (young adult mice).
Stereological and morphometric analysis of optic nerve fibers
A total of 30 fresh optic nerves collected from 15 neonates and 15 young adult mice were analyzed, with n = 5 optic nerves derived from n = 5 different animals for each experimental group/age (CGM, OMM12, GF).
Nerve samples were fixed using Karnovsky solution (2% paraformaldehyde, 2.5% glutaraldehyde in 0.2 M sodium cacodylate buffer, pH 7.3, 24 h), washed (0.1 M sodium cacodylate, 7.5% sucrose), post–fixed (1% osmium tetroxide for 1.5 h), and then embedded in epon as previously described ().
2.5 μm thick semi-thin transverse sections were cut using an Ultracut UCT ultramicrotome (Leica Microsystems, Germany); sections were stained with 1% Toluidine blue and blindly analyzed with a DM4000B microscope equipped with a DFC320 digital camera and an IM50 image manager system (Leica Microsystems, Germany) to measure the nerve cross-sectional area (×20 magnification).
Stereological and morpho-quantitative analyses (total fiber number, fiber density and size parameters - fiber and axon diameter, myelin thickness and g-ratio) were performed on ultrathin sections (70-nm-thick) using a JEM-1010 transmission electron microscope (JEOL, Tokyo, Japan) equipped with a Mega-View-III digital camera and a Soft-Imaging-System (SIS, Münster, Germany). Images were acquired at a magnification of ×12,000 and then analyzed using the ImageJ software.
Quantitative real-time PCR (qRT-PCR) analysis
RNA from snap frozen optic nerve samples (from the opposite eye as above) was isolated using the TRIzol Reagent (Life Technologies) following manufacturer’s instructions. RNA extracted from each sample was quantified using NanoDrop 1000 Spectrophotometer (Thermo Scientific) and its purity was evaluated by reading the absorbance at 260, 280 and 230 nm.
Complementary DNA (cDNA) of each sample was obtained by reverse-transcription (RT). To reverse transcribe RNA to cDNA, 0.4 μg RNA for each sample were reverse-transcribed in a 25 μL total reaction volume containing 1 mM dNTPs, 1x RT-buffer, 0.10 μg/μL bovine serum albumin (BSA), 0.05% Triton, 7.5 μM Random Hexamer Primers, 200 U reverse transcriptase (RevertAid Thermo Scientific Fermentas, #EP0441), 40 U RNase inhibitor (Ribolock Thermo Scientific Fermentas #E00381). To perform the reverse transcriptase reaction, Thermocycler was set at 25°C for 10 min, 42°C for 90 min, 70°C for 10 min. The obtained cDNA was diluted 1:10 in a final volume of 250 μL nuclease free water and finally stored at −20°C.
To quantify cDNA and determine gene expression, quantitative real-time Polymerase Chain Reaction (qRT-PCR) was performed with an ABI prism 7300 (Applied Biosystems) detection system using Sybr Green chemistry. Reactions were run in duplicates for each sample on 96-well optical PCR plates (Bio-Rad). In each well a qRT-PCR was carried out in a reaction volume of 20 μL containing 5 μL of diluted cDNA, 1x iTaq Universal SYBR Green Supermix (Bio-Rad) and 300 nM forward and reverse primers (Life Technology). All primers were designed using ANNHYB software (http://www.bioinformatics.org/annhyb/) and synthesized by Invitrogen (Life Technologies Europe BV, Monza, Italy). Primer sequences are reported in Table 1. After an initial denaturation step for 30 s at 95°C, denaturation in the subsequent 40 cycles was performed for 15 s at 95°C followed by primer annealing and elongation at 60°C for 1 min. The dissociation curves obtained were routinely analyzed to check the quality of the reaction.
TABLE 1
| Gene | NCBI accession number | Primers | Sequence 5′-3′ | Amplification length |
|---|---|---|---|---|
| Tbp | NM_013684.3 | mrTbp FW | GATCAAACCCAGAATTGTTCTCC | 106 bp |
| mrTbp REV | GGGGTAGATGTTTTCAAATGCTTC | |||
| Olig1 | NM_016968.4 | mrOlig1 FW | GTGTGAACGCGGCTCCCG | 100 bp |
| mrOlig1 REV | GGTGGCTGCCTGTAACCCAC | |||
| Olig2 | NM_016967.2 | mrOlig2 FW | GACTCGGACGCCAGCCTG | 107 bp |
| mrOlig2 REV | CCTCCTGTGAAGCCGCTGC | |||
| Sox2 | NM_011443.4 | mrSox2 FW | CTCGGAGATCAGCAAGCGCC | 111 bp |
| mrSox2 REV | TGCTCCTTCATGTGCAGAGCG | |||
| Sox10 | NM_011437.1 | mrSox10 FW | CCATGTCAGATGGGAACCCAGAGC | 80 bp |
| mrSox10 REV | CTCTGTCTTTGGGGTGGTTGGAGG | |||
| Myrf | NM_001033481 | mMyrf FW | CCCTATGCCCCAGGCACAC | 110 bp |
| mMyrf REV | GTCTCCGGGGTTATGGTGCG | |||
| Pten | NM_008960.2 | mPten FW | GGCGGAACTTGCAATCCTCAGTTTG | 120 bp |
| mPten REV | CAATGGCTGAGGGAACTCAAAGTACATG | |||
| c-Jun | NM_021835.3 | mrJun FW | ACGACCTTCTACGACGATGCCC | 116 bp |
| mrJun REV | GGGTCGGCCAGGTTCAAGG | |||
| Mbp | NM_001025251.2 | mrMbp FW | GGACCCAAGATGAAAACCCAGTAGTCC | 81 bp |
| mMbp REV | CCTTCCCTTGGGATGGAGGTGG | |||
| Plp1 | NM_011123.4 | mPlp FW | GAGCGGGTGTGTCATTGTTTGGG | 119 bp |
| mPlp1_REV | GTACACAGGTACAGCCGAGCAG | |||
| P2Y12R | NM_001357008.1 | mP2Y12R FW | GCCAGTCTGCAAGTTCCACTAACTAG | 118 bp |
| mP2Y12R REV | GAAGGTGGTATTGGCTGAGGTGG | |||
| Iba1 | AK006562.1 | mIba1 FW | GGGGATCAACAAGCAATTCCTCGATG | 160 bp |
| mIba1 REV | CCCAAGTTTCTCCAGCATTCGCTTC | |||
| CD68 | BC021637.1 | mCD68 FW | ACTTCGGGCCATGTTTCTCT | 138 bp |
| mCD68 REV | GCTGGTAGGTTGATTGTCGT |
List of selected primers used in the qRT-PCR reaction, showing the NCBI accession number and the length of the amplification product obtained from the reaction.
m, indicates primer compatible for mouse; r, indicates primer compatible for rat; mr, indicates primer compatible for both species.
Data obtained with qRT-PCR experiments were quantified using the 2−ΔΔCt relative quantification method ().
For data normalization, the threshold cycle number (Ct) values obtained of both the calibrator and the samples of interest were normalized to the housekeeping gene Tbp (TATA-box binding protein).
Protein extraction and western blot analysis
Optic nerve total proteins were extracted using TRIzol reagent (Life Technology) after RNA extraction according to the manufacturer’s instructions. Then, the protein pellet was dissolved in a boiling LaemLi buffer (2.5% sodium dodecyl sulphate, 0.125 M Tris-HCl, pH 6.8). The Bicinchoninic Acid assay kit (Sigma-Aldrich, Merck) was used to determine protein concentration and equal amounts of proteins (10 µg) were resolved by 7.5% precasted SDS-PAGE (Bio-Rad) and blotted on supported nitrocellulose membrane (#1620094, Bio-Rad). Western blot analysis was carried out as previously described (). Primary antibodies used were: rabbit anti-AKT (1:1000, Cell Signaling, #9272); mouse anti-GAPDH (1:20000; Applied Biosystem, Ambion, #AM300); secondary antibodies used were HRP-linked anti-rabbit (Cell Signaling Technology, #7074) and anti-mouse (Cell Signaling Technology, #7076), both diluted 1:15000 in 5% non-fat dry milk in TBS-T. Bands were detected using ECL substrate (#170-5061, Bio-Rad), collected with Chemidoc, quantified with Image Lab Software (Bio-Rad, California, United States). The AKT band intensity was normalized to GAPDH.
Statistical analysis
Statistical analyses were performed using GraphPad Prism Version 8 (GraphPad Software, San Diego, CA, United States). Normal distribution was tested using the Shapiro-Wilk test. For parametric data, the statistical significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons post hoc test. Non-parametric data were subjected to the Kruskal–Wallis test followed by Dunn’s multiple comparisons post hoc test or Mann-Whitney test, as indicated. P values were considered significant at a p value ≤0.05. Data are expressed as the mean ± SEM.
Results
We examined the optic nerves of neonatal and young adult GF, OMM12 and CGM mice to determine whether there were alterations in nerve fiber morphology, number, dimension and myelin sheath morphology and thickness in relation to the different gut microbiota composition.
The optic nerves of neonatal mice revealed a similar architecture in the three experimental groups (Figures 1A–F), with no visible alterations; stereological and morpho-quantitative analysis performed on myelinated fibers revealed a small decrease in fiber diameter in OMM12 specimens that was significant only in comparison to GF optic nerves (Figure 1K). All the other measured parameters were not statistically different among groups (Figure 1). The morphological results were additionally displayed as regression curves of the distribution of axon diameter (Figure 1N), fiber diameter (Figure 1O), myelin thickness (Figure 1P) and g-ratio (Figure 1Q), showing again no major differences among the three groups. Images taken at higher resolution allowed visualizing the state of development and myelination of the optic nerve occurring at about 14 days after birth. A great heterogeneity was observed in all groups, in terms of size and degree of myelination, with properly myelinated axons, along with axons which were still undergoing myelination (myelination appeared still uncompleted) and unmyelinated axons (Figure 2).
FIGURE 1
FIGURE 2
Light microscopy and low magnification electron microscopy analyses of optic nerves from young adult mice (at about 67 days after birth) revealed, again, a similar organization in the three experimental groups: the optic nerves were composed of closely packed and completely myelinated nerve fibers with variable size (Figures 3A–F). No differences were seen for the cross-sectional area among groups (Figure 3G). Stereological analysis revealed a significantly increased density and higher total number of myelinated fibers in OMM12 optic nerves (Figures 3H, I).
FIGURE 3
Morpho-quantitative analysis (Figure 4) revealed significantly reduced axon and nerve fiber dimensions in both young adult GF and OMM12 optic nerves compared to CGM specimens (Figures 4A, B). Interestingly, although the mean thickness of the myelin sheaths, on average, was not significantly but only marginally increased in OMM12 and GF myelinated axons (Figure 4C), the g-ratio (defined as the relationship between axon diameter/fiber diameter) was significantly lower in GF and OMM12 samples in comparison to CGM (Figure 4D). Therefore, morpho-quantitative analysis revealed a hypermyelination of myelinated optic nerve fibers in young adult OMM12 and GF mice. Interestingly, the distributions of axon and fiber diameters, displayed as regression curves (Figures 4E, F), showed a clear shift to the left for data derived from GF and OMM12 mice, indicating that optic nerve axons and fibers in these two experimental groups were smaller compared to those in the CGM group. While the regression curve for myelin thickness appears similar across the three experimental groups (Figure 4G), hypermyelination is clearly evident, as indicated by the significant shift to the left in the g-ratio data distributions for both OMM12 and GF groups compared to CGM (Figure 4H). This quantitative result was further confirmed by the clearly visible hypermyelinated axons observed in high-magnification electron microscopy images (Figures 4I–K). Finally, the scatter plot of the g-ratio against the axon diameter indicated that the decreased g-ratio in GF and OMM12 samples compared to CGM was most evident for axons with smaller diameters (Figures 4L–N).
FIGURE 4
To evaluate any differences in gene expression linked to limited or absent gut microbiota, we additionally carried out qRT-PCR on optic nerve samples from both neonatal and young adult mice. Expression levels of genes and transcription factors known to be important for the myelination process are depicted in Figure 5. Our results demonstrated a downregulation of oligodendrocyte transcription factor 1 and 2 (Olig1 and Olig2), as well as sex determining region Y-box 10 (Sox10) during maturation of optic nerves in CGM and OMM12 samples, where a lower expression level was evident in young adult optic nerves than in neonatal samples. Interestingly, in the GF specimen only a marginal, but not significant, downregulation was detected (Figures 5A, B, D).
FIGURE 5
Expression levels of sex determining region Y-box 2 (Sox2), myelin regulatory factor (Myrf), c-Jun, phosphatase and tensin homolog (Pten), myelin basic protein (Mbp) and proteolipid protein 1 (Plp1) showed no differences, neither among the different experimental groups nor in the neonatal versus young adult comparison (Figures 5C, E–I). We also evaluated the expression of microglial markers and we found that ionized calcium-binding adapter molecule 1 (Iba1) is upregulated during development in all the three experimental models, while the purinergic P2Y12 receptor (P2Y12R) and cluster of differentiation 68 (CD68) are significantly upregulated during development only in GF mice (Figures 5J–L).
Since the activation of PI3-kinase and its effector AKT are crucial for initiating myelination in both the PNS (; ) and the CNS (; Yu et al., 2023), we assessed whether AKT expression and phosphorylation differ among the three experimental groups. Proteins extracted from young adult CGM, OMM12 and GF mice optic nerves were analyzed by Western blotting, as shown in Figure 5M. Total AKT expression normalized to GAPDH expression was significantly higher in GF optic nerves when compared with CGM and OMM12 samples (Figure 5N), while AKT phosphorylation was not detectable (data not shown).
Discussion
Human gut microbiota is the set of microorganisms that live in the human gut, which evolves throughout life and appears to provide essential health benefits to its host, by producing bioactive metabolites (vitamins, short-chain fatty acids, amino acids and others), regulating energy balance, maintaining immune and metabolic homeostasis and protecting against pathogens (; ). An imbalance in bacterial composition, a condition known as dysbiosis, is becoming recognized as an environmental factor that interacts with the host’s metabolism, causing various disorders (; ).
The gut microbiota influences numerous organs and systems via multiple routes including neural, metabolic, endocrine and immune pathways, resulting in the formation of gut-organ axes (; Saxami et al., 2023). Within these axes, the gut-brain axis has been recognized since the 19th century (). With regard to CNS myelination, most recently a reciprocal interdependence has been described for gut microbiota and oligodendrocytes indicating that the relevant axis could be an interesting therapeutic target (Tang et al., 2024). Furthermore, a growing number of studies have confirmed the existence of the gut–eye axis () and the gut-retina axis (Zhang and Mo, 2023) emerging with a relevance for pathological conditions of the optic system. Instead, so far research has never been focused on how gut microbiota might modulate the development of the optic nerve in physiological conditions.
To fill this gap, in this study we investigated the impact of the mouse gut microbiota on the rodent optic nerve fiber maturation and myelin development, thus providing additional knowledge on both the gut-eye/retina axis and the gut-brain-axis.
Interestingly, we demonstrated that optic nerves from young adult, but not neonatal, mice completely lacking gut microbiota (germ-free, GF mice) and mice with a limited and strictly controlled microbiota (OMM12 mice) have smaller and significantly hypermyelinated optic nerve fibers, as indicated by an overall decrease in g-ratio, compared to mice colonized with a complex gut microbiota (CGM mice). These data are in accordance with studies which revealed that adult GF mice displayed hypermyelinated fibers in the prefrontal cortex, a brain region that shows later myelination than, e.g., primary sensory or motor cortex (). While this alteration in myelination was originally demonstrated to be unexpectedly region-specific to the prefrontal cortex () and also others demonstrated later an impact of gut microbiota on proper callosal myelination (), we provide here evidence for further gut microbiota-dependent alterations.
In our analyses we found no alterations in terms of optic nerve fiber myelination in neonatal mice. We can hypothesize that this depends on the observation window and the myelination phase in which we performed the analysis. In the mouse CNS, myelin sheaths are formed by oligodendrocytes, and myelination occurs as a multistep process which includes up to three waves of differentiation of oligodendrocyte progenitor cells into pre-myelinating and mature myelinating oligodendrocytes (Yu et al., 2023). Pre-myelinating oligodendrocytes forming compact myelin sheaths appear at about P7 in the brain, while spinal cord myelination has already initiated at P0. The process of CNS myelination shows a peak between 2 and 4 weeks after birth, and continues for at least eight postnatal months, when myelination is almost completed in most brain regions (; Yu et al., 2023). A morphometric analysis of the mouse optic nerve conducted in the late 1990s, showed that no myelinated nerve fibers were observed before P5. Once myelination started, it was described to progress very rapidly during the early stages of postnatal development, but to gradually slow down with age, with a peak level of myelination between 9 and 16 weeks of postnatal life (). A more recent study reports the decisive size of retinal neuron axons for initiating myelination to be >0.3 µm (), a size that was already reached by the majority of optic nerve axons in our study (both for neonatal and young adult samples). Furthermore, the authors describe that myelination by pre-myelinating oligodendrocytes continuously increases between P7 and P14 ().
With regard to the results we report here, it is likely that we could not detect early postnatal alterations in our P8-14 mice, because we were in this initial and actively changing period of optic nerve myelination with high variation in the number of already myelinated fibers. Furthermore, the optic nerve fibers were very heterogeneous in terms of size and degree of myelination. During stereological and morpho-quantitative analyses, we counted and measured all fibers with a clear myelin sheath, but we were not able to discriminate between the already completely myelinated fibers and the partially myelinated ones. This limitation probably flattened out any variations that could possibly be observed by measuring only the fibers with complete myelin sheaths. We can therefore not definitely exclude that the presence/absence of gut microbiota did not have an effect on the optic nerve myelination already during the first week of optic nerve myelination.
It is noteworthy that we have recently described an effect of the gut microbiota composition on the myelination in the somatic PNS, where nerve fibers are myelinated by another type of myelinating glial cells, namely, the Schwann cells (). Axons in the peripheral median nerves of GF and OMM12 mice were also detected to be reduced in axonal diameter while myelin thickness was increased, resulting in hypermyelinated axons. This indicates that central and peripheral axons as well as central and peripheral glia may share at least parts of their myelination-inducing cross-talk (), resulting in a similar gut microbiota-dependent effect on myelination. The underlying mechanisms leading to the described similar phenotype in optic and somatic peripheral nerves remain to be elucidated. Additionally, no phenotypic rescue is observed in either the median or optic nerve in OMM12 mice, suggesting that the 12 bacterial species colonizing the gut in this specific gnotobiotic model are insufficient to support optimal maturation and proper myelination in either the somatic PNS or the optic nerve.
Myelination is a process tightly regulated during development by both cellular and molecular factors, such as transcription factors, growth factors, chemokines/cytokines, axonal signals and intracellular signaling pathways (Yu et al., 2023; Sock and Wegner, 2019; Simons et al., 2024). To understand whether some of these key factors were altered and therefore could explain the hypermyelinated phenotype of retinal ganglion cell axons in the optic nerves of GF and OMM12 mice, we analyzed the expression levels of different genes involved in the regulation of oligodendrocyte development and myelination in both neonatal and young adult samples.
Our results showed a downregulation of the transcription factors Olig-1/2 and Sox10 between neonatal samples and their young adult counterparts from CGM and OMM12 mice; however, this downregulation was not observed in GF animals, where similar expression levels were detected between neonatal and young adult optic nerves. Therefore, we have to assume that while OMM12 and GF mice exhibited phenotypic similarity in terms of ultrastructural hypermyelination, they differed in gene expression (at least for the genes we analyzed in our study). This leads us to hypothesize that colonization with the 12 bacterial species in the OMM12 mouse model was sufficient to rescue transcriptomic changes, but not phenotypic changes, in the optic nerve. In accordance with this is the report that colonization of GF mice with conventional gut microbiota at weaning was sufficient to rescue transcriptomic changes in the prefrontal cortex, but it could not reverse the hypermyelinated axonal phenotype (). The authors suggested a critical time window in which gut microbiota signaling could be necessary for regular cortical myelination (). From our results, we hypothesize that, in the very first weeks of embryonic development and very first weeks of postnatal life, the expression of Olig1, Olig2 and Sox10, as positive regulators of oligodendrocyte maturation, differentiation and myelination (Sock and Wegner, 2019) is increased, to allow a correct myelination of nerve fibers. Subsequently, in a later phase, when myelination is completed, in the animals with physiological (CGM) or limited (OMM12) gut microbiota these transcriptional factors become downregulated, but not in the GF animals; therefore, the absence of microbiota seems to lead to a stimulation of myelination for a more prolonged period, through mechanisms yet to be investigated.
Moreover, the analysis of markers of microglia, the resident immune cells involved in regulatory processes critical for development and physiology of the CNS (), revealed an increase in Iba1 expression during optic nerve development across all three experimental models, while P2Y12R and CD68 are significantly upregulated during development only in GF mice. This transcriptomic difference suggests a potential functional variation in microglial activity in mice lacking gut microbiota, as previously demonstrated in brain tissue (), which could impact the myelination process. Indeed, the distinct properties of microglia enable them to regulate myelination both during development and throughout life ().
Derived from what has been described in the literature, it is possible that events of hypermyelination in the maturing optic nerve depend on a disruption of dynamic neuronal signaling along the fibers that undergo myelination (). In addition, evidence exists that gut microbial metabolites within the circulating metabolome develop an impact on neuronal signaling and modulate brain activity (). Therefore, and with appropriate caution, we can carefully speculate that missing metabolites from the gut microbiota account for a dysregulation in optic nerve myelination in our study. We consider that the OMM12 gut microbiome still lacks important components that could sufficiently restore the axon-oligodendrocyte cross-talk towards correct myelination of optic nerve fibers. The search for critical bacterial strains or metabolites and the direct link between the same and optic nerve myelination must be the focus of future studies.
In conclusion, our results demonstrate a critical role for the gut microbiota in driving optic nerve maturation and myelination, and therefore contribute to extending our knowledge in the gut-eye/gut-retina-axis.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The animal study was approved by local Institutional Animal Care and Research Advisory Committee and registered with the Animal Care Committee of Lower-Saxony, Germany. Breeding and animal husbandry was registered under the number 42500/1H according to §11 of the German protection of animals act (TierSchG). Animal sacrifice for scientific purposes was announced to the authorities under the numbers §4 2021-289 (postnatal mice) and §4 2017-171 (young adult mice). The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
GR: Conceptualization, Funding acquisition, Investigation, Methodology, Supervision, Writing–original draft, Writing–review and editing. DP: Data curation, Formal Analysis, Methodology, Writing–review and editing. ME: Data curation, Investigation, Methodology, Writing–review and editing. OA: Data curation, Investigation, Methodology, Writing–review and editing. FG: Data curation, Investigation, Methodology, Writing–review and editing. SF: Investigation, Methodology, Writing–review and editing. RN: Supervision, Writing–review and editing. MB: Conceptualization, Methodology, Resources, Writing–review and editing, Formal Analysis. SB: Formal Analysis, Investigation, Methodology, Writing–review and editing. SG: Supervision, Writing–review and editing. MC: Conceptualization, Supervision, Writing–original draft, Project administration. KH-T: Conceptualization, Project administration, Supervision, Writing–original draft. GG: Conceptualization, Investigation, Methodology, Project administration, Supervision, Writing–original draft.
Funding
The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This study was supported by the European Union- Next Generation EU, Mission 4 Component 1, Project Title: “Gut and NeuroMuscular system: investigating the impact of microbiota on nerve regeneration and muscle reinnervation after peripheral nerve injury”, CUP D53D23007770006, MUR: 20227YB93W, to GR.
Acknowledgments
We thank Jennifer Metzen, Silke Fischer, and Natascha Heidrich (Institute of Neuroanatomy and Cell Biology, Hannover Medical School, Germany), Anna Smoczek and Tim Scheele (Institute for Laboratory Animals Science, Hannover Medical School) Germany for their technical assistance.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The authors declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.
Generative AI statement
The authors declare that no Generative AI was used in the creation of this manuscript.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
AfzaalM.SaeedF.ShahY. A.HussainM.RabailR.SocolC. T.et al (2022). Human gut microbiota in health and disease: unveiling the relationship. Front. Microbiol.13, 999001. 10.3389/fmicb.2022.999001
2
AhlawatS.AshaS. K. K. (2021). Gut-organ axis: a microbial outreach and networking. Lett. Appl. Microbiol.72 (6), 636–668. 10.1111/lam.13333
3
AhmedH.LeyrolleQ.KoistinenV.KarkkainenO.LayeS.DelzenneN.et al (2022). Microbiota-derived metabolites as drivers of gut-brain communication. Gut Microbes14 (1), 2102878. 10.1080/19490976.2022.2102878
4
AlmeidaR. G.LyonsD. A. (2017). On myelinated axon plasticity and neuronal circuit formation and function. J. Neurosci.37 (42), 10023–10034. 10.1523/JNEUROSCI.3185-16.2017
5
AtkinsE. J.NewmanN. J.BiousseV. (2008). Post-traumatic visual loss. Rev. Neurol. Dis.5 (2), 73–81.
6
CalabròS.KankowskiS.CesconM.GambarottaG.RaimondoS.Haastert-TaliniK.et al (2023). Impact of gut microbiota on the peripheral nervous system in physiological, regenerative and pathological conditions. Int. J. Mol. Sci.24 (9), 8061. 10.3390/ijms24098061
7
CampagnoliL. I. M.VaresiA.BarbieriA.MarchesiN.PascaleA. (2023). Targeting the gut-eye Axis: an emerging strategy to face ocular diseases. Int. J. Mol. Sci.24 (17), 13338. 10.3390/ijms241713338
8
CesconM.GambarottaG.CalabròS.CicconettiC.AnselmiF.KankowskiS.et al (2024). Gut microbiota depletion delays somatic peripheral nerve development and impairs neuromuscular junction maturation. Gut Microbes16 (1), 2363015. 10.1080/19490976.2024.2363015
9
CookJ.PrinzM. (2022). Regulation of microglial physiology by the microbiota. Gut Microbes14 (1), 2125739. 10.1080/19490976.2022.2125739
10
CristobalC. D.LeeH. K. (2022). Development of myelinating glia: an overview. Glia70 (12), 2237–2259. 10.1002/glia.24238
11
CryanJ. F.O'RiordanK. J.CowanC. S. M.SandhuK. V.BastiaanssenT. F. S.BoehmeM.et al (2019). The microbiota-gut-brain Axis. Physiol. Rev.99 (4), 1877–2013. 10.1152/physrev.00018.2018
12
DangataY. Y.FindlaterG. S.KaufmanM. H. (1996). Postnatal development of the optic nerve in (C57BL x CBA)F1 hybrid mice: general changes in morphometric parameters. J. Anat.189 (Pt 1), 117–125.
13
DeGruttolaA. K.LowD.MizoguchiA.MizoguchiE. (2016). Current understanding of dysbiosis in disease in human and animal models. Inflamm. Bowel Dis.22 (5), 1137–1150. 10.1097/MIB.0000000000000750
14
EberlC.RingD.MunchP. C.BeutlerM.BasicM.SlackE. C.et al (2019). Reproducible colonization of germ-free mice with the oligo-mouse-microbiota in different animal facilities. Front. Microbiol.10, 2999. 10.3389/fmicb.2019.02999
15
FloresA. I.NarayananS. P.MorseE. N.ShickH. E.YinX.KiddG.et al (2008). Constitutively active Akt induces enhanced myelination in the CNS. J. Neurosci.28 (28), 7174–7183. 10.1523/JNEUROSCI.0150-08.2008
16
FuX.TanH.HuangL.ChenW.RenX.ChenD. (2023). Gut microbiota and eye diseases: a bibliometric study and visualization analysis. Front. Cell Infect. Microbiol.13, 1225859. 10.3389/fcimb.2023.1225859
17
GambarottaG.GarzottoD.DestroE.MautinoB.GiampietroC.CutrupiS.et al (2004). ErbB4 expression in neural progenitor cells (ST14A) is necessary to mediate neuregulin-1beta1-induced migration. J. Biol. Chem.279 (47), 48808–48816. 10.1074/jbc.M408374200
18
Haastert-TaliniK.GeunaS.DahlinL. B.MeyerC.StenbergL.FreierT.et al (2013). Chitosan tubes of varying degrees of acetylation for bridging peripheral nerve defects. Biomaterials34 (38), 9886–9904. 10.1016/j.biomaterials.2013.08.074
19
HartyB. L.CoelhoF.Pease-RaissiS. E.MoghaA.AckermanS. D.HerbertA. L.et al (2019). Myelinating Schwann cells ensheath multiple axons in the absence of E3 ligase component Fbxw7. Nat. Commun.10 (1), 2976. 10.1038/s41467-019-10881-y
20
HobanA. E.StillingR. M.RyanF. J.ShanahanF.DinanT. G.ClaessonM. J.et al (2016). Regulation of prefrontal cortex myelination by the microbiota. Transl. Psychiatry6, e774. 10.1038/tp.2016.42
21
HouK.WuZ. X.ChenX. Y.WangJ. Q.ZhangD.XiaoC.et al (2022). Microbiota in health and diseases. Signal Transduct. Target Ther.7 (1), 135. 10.1038/s41392-022-00974-4
22
JandhyalaS. M.TalukdarR.SubramanyamC.VuyyuruH.SasikalaM.Nageshwar ReddyD. (2015). Role of the normal gut microbiota. World J. Gastroenterol.21 (29), 8787–8803. 10.3748/wjg.v21.i29.8787
23
KeoghC. E.KimD. H. J.PuscedduM. M.KnottsT. A.RabasaG.SladekJ. A.et al (2021). Myelin as a regulator of development of the microbiota-gut-brain axis. Brain Behav. Immun.91, 437–450. 10.1016/j.bbi.2020.11.001
24
LivakK. J.SchmittgenT. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods25 (4), 402–408. 10.1006/meth.2001.1262
25
LuJ.LuL.YuY.BaranowskiJ.ClaudE. C. (2020). Maternal administration of probiotics promotes brain development and protects offspring's brain from postnatal inflammatory insults in C57/BL6J mice. Sci. Rep.10 (1), 8178. 10.1038/s41598-020-65180-0
26
LuckB.EngevikM. A.GaneshB. P.LackeyE. P.LinT.BalderasM.et al (2020). Bifidobacteria shape host neural circuits during postnatal development by promoting synapse formation and microglial function. Sci. Rep.10 (1), 7737. 10.1038/s41598-020-64173-3
27
LynchC. M. K.NagpalJ.ClarkeG.CryanJ. F. (2021). Wrapping things up: recent developments in understanding the role of the microbiome in regulating myelination. Curr. Opin. Physiol.23, 100468. 10.1016/j.cophys.2021.100468
28
MasengaS. K.HamooyaB.HangomaJ.HayumbuV.ErtugluL. A.IshimweJ.et al (2022). Recent advances in modulation of cardiovascular diseases by the gut microbiota. J. Hum. Hypertens.36 (11), 952–959. 10.1038/s41371-022-00698-6
29
MaurelP.SalzerJ. L. (2000). Axonal regulation of Schwann cell proliferation and survival and the initial events of myelination requires PI 3-kinase activity. J. Neurosci.20 (12), 4635–4645. 10.1523/JNEUROSCI.20-12-04635.2000
30
MayoralS. R.EtxeberriaA.ShenY. A.ChanJ. R. (2018). Initiation of CNS myelination in the optic nerve is dependent on axon caliber. Cell Rep.25 (3), 544–550. 10.1016/j.celrep.2018.09.052
31
MiyauchiE.ShimokawaC.SteimleA.DesaiM. S.OhnoH. (2023). The impact of the gut microbiome on extra-intestinal autoimmune diseases. Nat. Rev. Immunol.23 (1), 9–23. 10.1038/s41577-022-00727-y
32
NapolitanoP.FilippelliM.DavinelliS.BartollinoS.dell'OmoR.CostagliolaC. (2021). Influence of gut microbiota on eye diseases: an overview. Ann. Med.53 (1), 750–761. 10.1080/07853890.2021.1925150
33
NeedhamB. D.FunabashiM.AdameM. D.WangZ.BoktorJ. C.HaneyJ.et al (2022). A gut-derived metabolite alters brain activity and anxiety behaviour in mice. Nature602 (7898), 647–653. 10.1038/s41586-022-04396-8
34
NguyenY.Rudd Zhong ManisJ.RonczkowskiN. M.BuiT.OxenriderA.JadejaR. N.et al (2024). Unveiling the gut-eye axis: how microbial metabolites influence ocular health and disease. Front. Med. (Lausanne)11, 1377186. 10.3389/fmed.2024.1377186
35
OgataT.IijimaS.HoshikawaS.MiuraT.YamamotoS.OdaH.et al (2004). Opposing extracellular signal-regulated kinase and Akt pathways control Schwann cell myelination. J. Neurosci.24 (30), 6724–6732. 10.1523/JNEUROSCI.5520-03.2004
36
RadulescuC. I.Garcia-MirallesM.SidikH.BardileC. F.YusofN.LeeH. U.et al (2019). Manipulation of microbiota reveals altered callosal myelination and white matter plasticity in a model of Huntington disease. Neurobiol. Dis.127, 65–75. 10.1016/j.nbd.2019.02.011
37
RowlandI.GibsonG.HeinkenA.ScottK.SwannJ.ThieleI.et al (2018). Gut microbiota functions: metabolism of nutrients and other food components. Eur. J. Nutr.57 (1), 1–24. 10.1007/s00394-017-1445-8
38
RutschA.KantsjoJ. B.RonchiF. (2020). The gut-brain Axis: how microbiota and host inflammasome influence brain physiology and pathology. Front. Immunol.11, 604179. 10.3389/fimmu.2020.604179
39
SantosE. N.FieldsR. D. (2021). Regulation of myelination by microglia. Sci. Adv.7 (50), eabk1131. 10.1126/sciadv.abk1131
40
SarkiesN. (2004). Traumatic optic neuropathy. Eye (Lond)18 (11), 1122–1125. 10.1038/sj.eye.6701571
41
SaxamiG.KerezoudiE. N.EliopoulosC.ArapoglouD.KyriacouA. (2023). The gut-organ Axis within the human body: gut dysbiosis and the role of prebiotics. Life (Basel)13 (10), 2023. 10.3390/life13102023
42
ScuderiG.TroianiE.MinnellaA. M. (2021). Gut microbiome in retina health: the crucial role of the gut-retina Axis. Front. Microbiol.12, 726792. 10.3389/fmicb.2021.726792
43
SharvinB. L.AburtoM. R.CryanJ. F. (2023). Decoding the neurocircuitry of gut feelings: region-specific microbiome-mediated brain alterations. Neurobiol. Dis.179, 106033. 10.1016/j.nbd.2023.106033
44
SimonsM.GibsonE. M.NaveK. A. (2024). Oligodendrocytes: myelination, plasticity, and axonal support. Cold Spring Harb. Perspect. Biol.16, a041359. 10.1101/cshperspect.a041359
45
SmithA. M.CzyzC. N. (2024). “Neuroanatomy, cranial nerve 2 (optic),” in StatPearls (Treasure Island, FL).
46
SockE.WegnerM. (2019). Transcriptional control of myelination and remyelination. Glia67 (11), 2153–2165. 10.1002/glia.23636
47
SongJ.DongH.WangT.YuH.YuJ.MaS.et al (2024). What is the impact of microbiota on dry eye: a literature review of the gut-eye axis. BMC Ophthalmol.24 (1), 262. 10.1186/s12886-024-03526-2
48
TangW.WangQ.SunM.LiuC.HuangY.ZhouM.et al (2024). The gut microbiota-oligodendrocyte axis: a promising pathway for modulating oligodendrocyte homeostasis and demyelination-associated disorders. Life Sci.354, 122952. 10.1016/j.lfs.2024.122952
49
ThursbyE.JugeN. (2017). Introduction to the human gut microbiota. Biochem. J.474 (11), 1823–1836. 10.1042/BCJ20160510
50
VuongH. E.PronovostG. N.WilliamsD. W.ColeyE. J. L.SieglerE. L.QiuA.et al (2020). The maternal microbiome modulates fetal neurodevelopment in mice. Nature586 (7828), 281–286. 10.1038/s41586-020-2745-3
51
XueW.LiJ. J.ZouY.ZouB.WeiL. (2021). Microbiota and ocular diseases. Front. Cell Infect. Microbiol.11, 759333. 10.3389/fcimb.2021.759333
52
YazdankhahM.ShangP.GhoshS.HoseS.LiuH.WeissJ.et al (2021). Role of glia in optic nerve. Prog. Retin Eye Res.81, 100886. 10.1016/j.preteyeres.2020.100886
53
YuQ.GuanT.GuoY.KongJ. (2023). The initial myelination in the central nervous system. ASN Neuro15, 17590914231163039. 10.1177/17590914231163039
54
ZhangH.MoY. (2023). The gut-retina axis: a new perspective in the prevention and treatment of diabetic retinopathy. Front. Endocrinol. (Lausanne)14, 1205846. 10.3389/fendo.2023.1205846
Summary
Keywords
gnotobiotic mice, microbiota, myelin, oligodendrocytes, germ-free mice
Citation
Ronchi G, Pellegrino D, El Soury M, Amato O, Gaia F, Farzin S, Nuzzi R, Basic M, Bolsega S, Geuna S, Cescon M, Haastert-Talini K and Gambarotta G (2025) Gut microbiota regulates optic nerve fiber myelination. Front. Cell Dev. Biol. 13:1526855. doi: 10.3389/fcell.2025.1526855
Received
12 November 2024
Accepted
27 January 2025
Published
20 February 2025
Volume
13 - 2025
Edited by
Rui Alvites, University of Oporto, Portugal
Reviewed by
Carlos Puebla, Universidad de O'Higgins, Chile
Lihua Ye, The Ohio State University, United States
Dongqing Shi, University of Michigan, United States
Updates
Copyright
© 2025 Ronchi, Pellegrino, El Soury, Amato, Gaia, Farzin, Nuzzi, Basic, Bolsega, Geuna, Cescon, Haastert-Talini and Gambarotta.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Giulia Ronchi, giulia.ronchi@unito.it
† These authors share last authorship
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.