ORIGINAL RESEARCH article

Front. Immunol., 18 March 2019

Sec. Autoimmune and Autoinflammatory Disorders

Volume 10 - 2019 | https://doi.org/10.3389/fimmu.2019.00451

High-Dose Dexamethasone Alters the Increase in Interleukin-16 Level in Adult Immune Thrombocytopenia

  • 1. Department of Haematology and Qilu Hospital, Shandong University, Jinan, China

  • 2. Department of Haematology, Liaocheng People's Hospital, Liaocheng, China

  • 3. Shandong Provincial Key Laboratory of Immunohematology, Qilu Hospital, Shandong University, Jinan, China

  • 4. West China School of Medicine, Sichuan University, Jinan, China

  • 5. Department of Immunology, Shandong University School of Medicine, Jinan, China

Abstract

Adult primary immune thrombocytopenia (ITP) is an autoimmune-mediated haemorrhagic disorder. Interleukin-16 (IL-16) can directly affect cellular or humoural immunity by mediating the cellular cross-talk among T cells, B cells and dendritic cells. Several studies have focused on IL-16 as an immunomodulatory cytokine that takes part in Th1 polarization in autoimmune diseases. In this study, we investigated IL-16 expression in the bone marrow supernatant and plasma of ITP patients and healthy controls. What's more, we detected IL-16 expression in ITP patients with the single-agent 4-day high-dose dexamethasone (HD-DXM) therapy. In patients with active ITP, bone marrow supernatant and plasma IL-16 levels increased (P < 0.05) compared with those of healthy controls. In the meantime, the mRNA expression in BMMCs (pro-IL-16, caspase-3) and PBMCs (pro-IL-16, caspase-3 and T-bet) of ITP patients was increased (P < 0.05) relative to those of healthy controls. In patients who responded to HD-DXM therapy, both plasma IL-16 levels and gene expression in PBMCs (pro-IL-16, caspase-3, and T-bet) were decreased (P < 0.05). In summary, the abnormal level of IL-16 plays important roles in the pathogenesis of ITP. Regulating Th1 polarization associated with IL-16 by HD-DXM therapy may provide a novel insight for immune modulation in ITP.

Introduction

Adult primary immune thrombocytopenia (ITP) is an autoimmune-mediated haemorrhagic disorder in which platelets are destroyed by specific antibodies directed against platelet surface membrane glycoproteins (GPs) and prematurely cleared by macrophages in the reticuloendothelial system (). The pathophysiology of ITP is characterized by excessive platelet destruction and a decrease in platelet production. The traditional mechanism of platelet destruction was GP-specific antibody mediated platelet clearance. Besides, skewed balance of T helper cell type 1 (Th1) to T helper cell type 2 (Th2) (, ), reduced and defective capability of regulatory T cells (, ), abnormal Th17 and Th22 cells (), cytotoxic T lymphocyte (CTL)–mediated platelet destruction (), and altered levels of cytokines including IL-11, IL-18, IL-27, and IL-35 were involved in the pathogenesis of ITP (–). However, there are several abnormalities contributing to the pathophysiology of ITP that remain to be explored.

Interleukin-16 (IL-16) is one of the first characterized cytokines with chemo-attractive activities for human T cells, which does not have any homology with other cytokines (). The IL-16 gene is located on chromosome 15q26 in humans; it is translated into a 636-amino acid precursor, which was detected in both cytoplasm and nucleus (). By activated caspase-3, pro-IL-16 is cleaved into a 121-amino acid carboxyl-terminal fragment (C-IL-16) and an amino-terminal prodomain (N-IL-16) in the cytoplasm, both of which have been found to be biologically active (). The C-IL-16 is secreted into the plasma as a ligand for CD4/CD9 with chemo-attractant, growth factor, and differentiation factor capabilities on a variety of haematopoietic cell types that are involved in various specific autoimmune and inflammatory responses (). The N-IL-16 is involved in the stabilization of p27Kip1 protein and retention of T lymphocytes in the G0/G1 cell cycle phase (, ).

IL-16 is secreted by several leukocyte subsets, including T cells (, ), eosinophils (), mast cells (, ), monocytes (), and dendritic cells (). Moreover, B cells constitutively express pro-IL-16. IL-16 mediates the cross-talk between B cells and T cells via its chemotactic properties within lymph node follicles (, ). CD4, the common surface molecule, is known to be a receptor for IL-16 (), while another surface molecule, CD9, has also been suggested as an alternate IL-16 receptor (). Moreover, the effect of IL-16 on immune cells can be direct or indirect via the modulation of cytokines. For example, in addition to its role in regulating the recruitment and activation of CD4+ T cells to sites of inflammation (), IL-16 stimulates the production of proinflammatory cytokines by monocytes, including interleukin 6, tumor necrosis factor-α, interleukin 1β, and interleukin 15, with related downstream biological effects ().

An increasing number of studies have demonstrated IL-16 as an immunomodulatory cytokine that contributes to the regulation of recruitment and activation of CD4+ cell at sites with Th1 polarization in association with several autoimmune diseases, such as multiple sclerosis lesions () and autoimmune type 1 diabetes (). The plasma level and gene expression of IL-16 in childhood ITP was previously studied by our team. Newly diagnosed ITP patients with a Th1-dominant immune phenotype exhibit a high level of plasma IL-16 (by ELISA) and IL-16 gene expression (by DNA microarray analysis) ().

Adult ITP is an autoimmune disease with Th1 superiority(, ). Similarly, the quantitative and qualitative abnormalities of immunological cells and immune dysfunction in patients with ITP can be, at least in part, attributed to IL-16, suggesting the potential value of IL-16 in prognostic evaluation in ITP. The roles of pro-IL-16/mature IL-16 in ITP remain unknown. In this present study, the levels of IL-16 in the plasma and bone marrow supernatants and mRNA expression of pro-IL-16, caspase-3 and T-bet in the peripheral blood mononuclear cells (PBMCs) and bone marrow mononuclear cells (BMMCs) of patients with ITP were determined.

Treatment with high-dose dexamethasone (HD-DXM) as a single-agent for 4 days has been widely recognized as the first-line therapy for ITP patients in need of clinical management. Previous studies showed that HD-DXM could restore Th1/Th2 balance (), expand regulatory cells including Tregs and MDSCs (), suggesting the immunosuppressive function in recovery of ITP patients. However, the effects of HD-DXM on IL-16 expression remain unclear in ITP patients. Furthermore, we demonstrated changes in plasma levels of IL-16 and mRNA expression of pro-IL-16, caspase-3 and T-bet in PBMCs after HD-DXM, and these results may provide new insights into the mechanism for treatment of ITP with HD-DXM.

Materials and Methods

Patients and Controls

Adult primary ITP patients with active disease were enrolled between May 2015 and December 2016 at the Department of Hematology, Qilu Hospital, Shandong University, Jinan, China. Patients were diagnosed according to recent guidelines () including clinical histories, somatoscopy, complete blood count and smear examination of peripheral blood. Patients and controls with complications such as Graves' disease, diabetes, hypertension, cardiovascular diseases, nervous system disease, neurological diseases, pregnancy, active infection, or connective tissue diseases, such as systemic lupus erythaematous (SLE), were excluded. The study was permitted by the Medical Ethical Committee of Qilu Hospital, Shandong University. Informed consent was obtained from all patients and controls before enrollment in the study.

Bone marrow samples were obtained from 23 patients, and 20 were used for ELISA (5 men and 15 women; range 24–63 years, median age 45 years; platelet counts ranging from 0 to 23 × 109/L, median count 9 × 109/L) and 14 for RT-PCR (4 men and 10 women; range 26–62 years, median age 41 years; platelet counts ranging from 0 to 23 × 109/L, median count 9 × 109/L). Peripheral blood samples were obtained from 64 patients, and among them, 21 received single-agent HD-DXM therapy. The peripheral blood samples were obtained before HD-DXM therapy and 28 days after HD-DXM administration for ELISA and RT-PCR. Complete response (CR) was defined as a platelet count ≥ 100 × 109/L and an absence of bleeding. Response (R) was defined as a platelet count ≥ 30 × 109/L, with at least a 2-fold increase from baseline, and an absence of bleeding. No response (NR) was defined as a platelet count < 30 × 109/L, less than a 2-fold increase from baseline, or bleeding (). The main clinical characteristics of these patients are presented in Table 1. Among the peripheral blood samples, 52 were used for ELISA (18 men and 34 women; range 19–64 years, median age 42 years; platelet counts ranging from 1 to 26 × 109/L, median count 10 × 109/L) and 33 for RT-PCR (12 men and 20 women; range 19–69 years, median age 41 years; platelet counts ranging from 1 to 26 × 109/L, median count 10 × 109/L) and 33 for RT-PCR (12 men and 20 women; range 19–69 years, median age 41 years; platelet counts ranging from 1 to 26 × 109/L, median count 10 × 109/L).

Table 1

Patient NO.Course of disease (month)Bleeding symptomsResponsePlatelet counts(× 109)Counts
BeforeAfter
10(10d)PTCR1144
23ECR2092
30(3d)PT, GHCR7195
40(16d)NoNR2320
55PT, EPCR7131
60(3 days)PT, GHCR1158
710NoCR27135
89NoNR611
91PT, ECR1875
107.5PTCR11195
112PT, EPCR8141
121PT, GHCR1102
135PTCR12107
141ECCR5195
1524NoR1431
160.5PT, GUH, GHCR7203
1712PT, ECR1044
184EC, GHCR4156
199NONR1016
204.5ECCR9159
2114GUHCR17174
Median49135
Male: 7Median Age:51y (range 39–63)
Female:14Median Age:36y (range 19–64)

Clinical characteristics of active ITP patients treated with HD-DMX.

The healthy adult control group consisted of 38 blood donors, and 26 of the samples were used for ELISA (10 men and 16 women; range 23–66 years, median age 41 years; platelet counts ranging from 105 to 263 × 109/L, median count 161 × 109/L) and 19 for RT-PCR (6 men and 13 women; range 23–68 years, median age 42 years; platelet counts ranging from 105 to 290 × 109/L, median count 156 × 109/L) In addition, there were 10 bone marrow donors, and 10 samples were for ELISA test (3 men and 7 women; range 24–63 years, median age 45 years; platelet counts ranging from 110 to 300 × 109/L, median count of 172 × 109/L) and 9 for RT-PCR (3 men and 6 women; range 24–63 years, median age 45 years; platelet counts ranging from 110 to 295 × 109/L, median count of 172 × 109/L).

Sample Preparation

The peripheral blood or bone marrow samples were kept in heparin anticoagulant vacutainer tubes for no more than 2 h before isolation. Cell-free (platelet- and mononuclear cell-free) plasma or cell-free bone marrow supernatant samples were prepared using a standardized two-step separation method (700 g for 10 min and 1,300 g for 20 min) as described previously to avoid the affection from cell lysis then settled in −80°C until test (, ). PBMCs or BMMCs were isolated by density gradient centrifugation using Ficoll-Paque (Pharmacia Diagnostic, Uppsala, Sweden) and stored at −80°C until RNA isolation.

Enzyme-Linked Immunosorbent Assays

Cell-free plasma IL-16 was measured using commercial Quantikine enzyme-linked immunosorbent assay (ELISA) kits (R&D systems, Minneapolis, MN, USA) according to the manufacturer's instructions. The detection range for IL-16 is 31.2–2,000 pg/mL (sensitivity is 13.4 pg/mL). The differences in bone marrow or plasma IL-16 levels between patients and healthy controls were compared using Mann-Whitney U-test. The plasma IL-16 levels before and after treatment were compared used paired t-test and Wilcoxon signed-rank test.

RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction Analysis

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and converted to cDNA using PrimeScriptTM RT Master Mix (Perfect Real Time; Takara, Japan) according to the manufacturer's instructions. The mRNA expression of IL-16, Caspase-3, T-bet and β-actin (endogenous control) was quantified using SYBR Green Real-time PCR Master Mix (Toyobo, Japan) on an ABI PRISM 7,500 Sequence Detection System (Applied Bio-system, Foster City, CA, USA). The primers for all mRNA assays were intron spanning. The sequences of the amplification primers for human pro-IL-16, Caspase-3, T-bet, and β-actin are listed in Table 2. Each sample was analyzed in triplicate. The PCR amplification was performed for 40 cycles after initial denaturation (95°C, 5 min) with the following parameters: denaturation at 95°C for 15 s, annealing at 60°C (pro-IL-16, Caspase-3, T-bet, and β-actin) for 15 s and extension at 72°C for 45 s, with temperature transition rates of 20°C/s. Fluorescence signals were acquired after extension at 72°C. ABI Sequence Detection System software version (PE Applied Biosystems, Warrington, UK) was used to measure the cycle number at which fluorescence emission crossed the automatically determined Ct value. Because all steps were performed with equal efficiencies, the relative mRNA expression level of the target gene in each patient was calculated using the comparative cycle time (Ct) method (). Briefly, the Ct values of the targets were corrected by subtracting the Ct value of β-actin from these values, which generated the ΔCt value. From this ΔCt value, the relative expression level for each target gene compared to β-actin was calculated using the following formulation: Relative mRNA expression = 2−−xCt. Differences in mRNA expression between patients and controls were analyzed using the Mann-Whitney U-test. Differences in mRNA expression between pre-treatment and post-treatment samples were compared using Wilcoxon signed-rank test. The correlation between pro-IL-16, Caspase-3, and T-bet mRNA expression and plasma IL-16 level was determined using the linear regression test. Statistical analyses were performed at a 2-tailed significance level of 0.05.

Table 2

GenePrimer sequence(5′-3′)Annealing temperature (°C)Product (bp)
IL-16(F) 5′-ATGCCCGACCTCAACTCC-3′
(R) 5′-CTAGGAGTCTCCAGCAGC−3′60389
Caspase-3(F)5′-GGGGATCGTTGTAGAAGTCTAACT-3′
(R)5′-GCATACAAGAAGTCGGCCTCCACT-3′60159
T-bet(F)5′-CATTGCCGTGACTGCCTACC-3′
(R)5′-GATGCTGGTGTCAACAGATGTG-3′60121
β-actin(F)5′- TTGCCGACAGGATGCAGAA−3′
(R)5′- GCCGATCCACACGGAGTACT−3′60101

Primers and conditions for the qRT-PCR experiments performed in this study.

Results

Response to HD-DXM Treatment

Out of the 21 patients, 18 (6 males and 12 females, median age 41 years, range 19–64 years) responded effectively to the HD-DXM therapy according to the standard definition (). In these responders, platelet counts after treatment ranged from 31 to 203 × 109/L, with a median count of 135 × 109/L, as shown in Table 1. No hemorrhage or other complications were apparent after treatment.

Concentration of Il-16 in the Bone Marrow Supernatant and Plasma of Patients With Active ITP and Controls

The concentration of IL-16 in the bone marrow supernatants of ITP patients with active disease was significantly higher compared with that of the healthy controls (mean ± SEM: 1686 ± 195.6 (n = 19) vs. 287.1 ± 62.27 (n = 9), P = 0.0002, Mann-Whitney U-test) (Figure 1A).

Figure 1

The level of IL-16 in the plasma of ITP patients with active disease was significantly higher than that of healthy controls (mean ± SEM: 187.7 ± 24.06 (n = 52) vs. 57.14 ± 4.344 (n = 26), P < 0.0001, Mann-Whitney U-test) (Figure 1B).

Further experiments were performed to investigate the possible effects of HD-DXM on the activity of IL-16 in ITP patients. The level of IL-16 in the plasma of ITP patients was detected before and 7 days after single-agent HD-DMX therapy for 4 days. The post-treatment plasma IL-16 level decreased significantly relative to that of pre-treatment level (mean ± SEM: 222.9 ± 33.09 (n = 21) vs. 90.17 ± 13.36 (n = 21), P = 0.0003, paired t-test) (Figure 1C). The level of IL-16 in the plasma of ITP patients before (P < 0.0001) and after (P = 0.0143) HD-DXM treatment was significantly higher than that of healthy controls, 57.14 ± 4.344 (n = 26), Mann-Whitney U-Test) (Figure 1D). The level of IL-16 in bone marrow supernatants was also downregulated after 4-day HD-DXM therapy (mean ± SEM: 1646.16 ± 578.11 (n = 7) vs. 1358.07 ± 433.79 (n = 7), P = 0.016, paired t-test) (Figure 1E).There was no correlation between IL-16 levels in the bone marrow supernatants or plasma and platelet count (data not shown).

mRNA Expression Levels of Pro-IL-16, Caspase-3 and T-Bet in ITP Patients and Controls

To elucidate the elevated plasma concentration of IL-16 in patients with active ITP, we determined the mRNA expression of pro-IL-16, caspase-3, and T-bet. Previous studies have demonstrated that high mRNA expression of caspase-3 is necessary for the processing and activation of pro-IL-16 (). Therefore, we determined caspase-3 mRNA expression in our study. Several studies have demonstrated that IL-16 could skew immune responses toward a Th1 response (, ). Therefore, T-bet mRNA expression was also analyzed in our study to further evaluate the relationship between IL-16 and Th1 deviation in ITP Patients. Relative expression of mRNAs was calculated using 2−ΔCT, and then the means were compared using t-test or Mann-Whitney U-test depending on the variance.

In accordance with the concentration of IL-16 in the bone marrow supernatants, the pro-IL-16 mRNA expression of BMMCs in patients with active ITP was significantly up-regulated compared with that of healthy controls (1.317 ± 0.3074 (n = 14) vs. 0.1182 ± 0.7577 (n = 9), P = 0.0012); caspase-3 mRNA were significantly higher in ITP patients compared with that in healthy controls (0.1194 ± 0.0797 (n = 14) vs. 0.006919 ± 0.001468 (n = 9), P = 0.0298) (Figure 2A).

Figure 2

Consistent with the plasma IL-16 level, the relative amount of mRNA of pro-IL-16 and caspase-3 of PBMCs in patients with active ITP was 0.09917 ± 0.03048 (n = 33, P < 0.0001) and 0.07495 ± 0.03843 (n = 33, P < 0.0001) relative to that in healthy controls (0.02230 ± 0.006397 and 0.009746 ± 0.001849, respectively; n = 19). However, both pro-caspase 3 and active caspase 3 protein levels have no significant difference in ITP patients compared with healthy control (Supplemental Figure). Our previous study has shown that T-bet mRNA expression was statistical higher in patients with active ITP than that in normal controls (), which was in accordance with our present results where T-bet mRNA expression was significantly higher in patients with active ITP than that in controls (0.02148 ± 0.01098% (n = 33) vs. 0.002748 ± 0.0005696 (n = 19), P < 0.0001) (Figure 2B). Pro-IL-16, Caspase-3 and T-bet mRNA expression after 4 days of treatment with HD-DMX as a single agent compared with that before treatment was significantly decreased, although the corresponding values were not statistically higher than those of healthy controls (Figure 2C).

Correlation of Plasma IL-16 Level With Pro-IL-16, Caspase-3 and T-Bet mRNA Levels in ITP Patients

The correlation between the plasma IL-16 concentration and pro-IL-16, caspase-3 and T-bet mRNA levels was analyzed in ITP patients. The results demonstrated that the mRNA levels of the three detected factors were positively correlated with plasma IL-16 concentration (r2 = 0.5846, P < 0.0001, r2 = 0.3980, P < 0.0001, and r2 = 0.3145, P = 0.0001 for pro-IL-16, caspase-3, and T-bet, respectively; linear regression; Figures 2D–F.

Taken together, in this study we demonstrated that the IL-16 levels in the bone marrow supernatants and plasma of adult ITP patients with active disease were significantly higher than those in healthy controls. The mRNA expression of IL-16, caspase-3 and T-bet in PBMCs and BMMCs were statistically higher than the corresponding mRNA expression in healthy controls. Single-agent HD-DMX treatment for 4 days decreased the plasma IL-16 level and downregulated mRNA expression of IL-16, caspase-3, and T-bet in ITP patients PBMCs. Furthermore, the plasma IL-16 levels were positively correlated with pro-IL-16, caspase-3, and T-bet mRNA expression.

Discussion

Our results provide evidence that IL-16 contributes to the development of ITP. The mechanism by which IL-16 promotes ITP requires a considerable amount of work to be fully understood. IL-16 is a special cytokine with two isoforms, namely, N-IL-16 and C-IL-16, and both of these isoforms have been shown to have modulatory functions for growth and activation of immune cell (). Elevation of C-IL-16 levels at sites of inflammation may contribute to Th1 advantage, in consistent with the previously reported role of this protein in other Th1-associated immune diseases (, ). Lynch,et al. demonstrated that IL-16 preferentially induces Th1 cell migration with help from CCR5. Th1 subset specificity is attributable to an increase in IL-16 binding (). Recently, our team had demonstrated that in ITP patients, CCR5 expression in PBMCs of patients with active ITP was significantly higher than in PBMCs of healthy controls. These results may explain how C-IL-16 alters the Th1/Th2 balance in ITP patients (). N-IL-16 is located both in the cytolymph, as a substrate for mature IL-16 following caspase-3 dissociation, and in the cyteblast where it functions to weaken the cleavage of p27Kip1, a pivotal cell-cycle molecules (). Meanwhile,the IL-16 expression was significantly down-regulated by HD-DXM therapy. We suppose the role of decreased IL-16 in the pathogenesis of ITP might including: reducing the production of proinflammatory cytokines by monocytes (); decreasing the generation of GP-specific antibody and correcting the imbalance of Th1/Th2 differentiation (),().

Increasing evidence has shown that an abnormally strong Th1 response plays a central role in the pathogenesis of chronic ITP (, ). T-bet is a T-box family transcription factor whose expression is primarily limited to the immune system. It is present in early developing Th1 cells but is absent in developing Th2 cells (). We also found high levels of T-bet mRNA expression of ITP patients and further determined that plasma IL-16 levels positively correlated with Th1 levels in these patients.

ITP is an organ-specific autoimmune disorder; complex interactions among antigen-presenting cells, T cells and B cells are pivotal to its pathogenesis. In particular, B cells not only produce immunoglobulin but also play an important immunoregulatory role in the pathophysiology of ITP (). A study reported that IL-16 is necessary for B lymphocytes to attract dendritic cells and Th1 cells (). A novel monoclonal anti-IL-16 antibody called 14.1, that combines with IL-16 and induces a conformational change in the IL-16 PDZ domain has been recently reported (). When incubated with CD4+ cells, the 14.1 antibody was shown to reduce the Th1-type inflammatory response. In our future study, we will use an in vitro study system to test and verify if the anti-IL-16 antibody can be used to treat adult ITP.

Our data suggest that IL-16 plays an important role in the pathogenesis of ITP by polarization of Th1. Further, by modulating the abnormal IL-16 level associated with the Th1 imbalance via treatment with pulsed HD-DXM provided us with new insights into the immune regulatory mechanisms for the treatment of ITP.

Statements

Ethics statement

This study was carried out in accordance with the recommendations of Medical Ethical Committee of Qilu Hospital, Shandong University with written informed consent from all subjects. All subjects gave written informed consent in accordance with the Declaration of Helsinki. The protocol was approved by the Medical Ethical Committee of Qilu Hospital, Shandong University.

Author contributions

JP and XW designed research, analyzed data, and wrote the paper. LL, YW, and XL performed research, analyzed data. QF and YH performed research and wrote the paper. CM and CG evaluated the data and corrected the paper. MH reviewed the manuscript. All authors read and approved the final manuscript.

Acknowledgments

This work was supported by grants from the Major Research plan of the National Natural Science Foundation of China (91442204), National Natural Science Foundation of China (81770133, 81770114 and 81800112), National Natural Science Foundation for Distinguished Young Scholars of China (81125002), State Key Clinical Specialty of China for Blood Disorders, Natural Science Foundation of Shandong Province (ZR2017PH022, ZR2017PH041) and Tai Shan Scholar Foundation.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2019.00451/full#supplementary-material

References

  • 1.

    BerchtoldPWengerM. Autoantibodies against platelet glycoproteins in autoimmune thrombocytopenic purpura: their clinical significance and response to treatment. Blood. (1993) 81:1246–50.

  • 2.

    SempleJWMilevYCosgraveDModyMHornsteinABlanchetteVet al. Differences in serum cytokine levels in acute and chronic autoimmune thrombocytopenic purpura: relationship to platelet phenotype and antiplatelet T-cell reactivity. Blood. (1996) 87:4245–4.

  • 3.

    PanitsasFPTheodoropoulouMKouraklisAKarakantzaMTheodorouGLZoumbosNCet al. Adult chronic idiopathic thrombocytopenic purpura (ITP) is the manifestation of a type-1 polarized immune response. Blood. (2004) 103:2645–7. 10.1182/blood-2003-07-2268

  • 4.

    LiuBZhaoHPoonMCHanZGuDXuMet al. Abnormality of CD4(+)CD25(+) regulatory T cells in idiopathic thrombocytopenic purpura. Eur. J. Haematol. (2007) 78:139–43. 10.1111/j.1600-0609.2006.00780.x

  • 5.

    YuJHeckSPatelVLevanJYuYBusselJBet al. Defective circulating CD25 regulatory T cells in patients with chronic immune thrombocytopenic purpura. Blood. (2008) 112:1325–8. 10.1182/blood-2008-01-135335

  • 6.

    ZhangJMaDZhuXQuXJiCHouM. Elevated profile of Th17, Th1 and Tc1 cells in patients with immune thrombocytopenic purpura. Haematologica. (2009) 94:1326–9. 10.3324/haematol.2009.007823

  • 7.

    OlssonBAnderssonPOJernåsMJacobssonSCarlssonBCarlssonLMet al. T-cell-mediated cytotoxicity toward platelets in chronic idiopathic thrombocytopenic purpura. Nat Med. (2003) 9:1123–4. 10.1038/nm921

  • 8.

    YaoRLinYLiQZhouXPanXBaoYet al. Downregulation of T-bet/GATA-3 ratio induced by IL-11 treatment is responsible for Th1/Th2 balance restoration in human immune thrombocytopenic purpura (ITP). J Thrombosis Thrombol. (2014) 38:183–9. 10.1007/s11239-013-1036-3

  • 9.

    ShanNNZhuXJPengJQinPZhuangXWWangHCet al. Interleukin 18 and interleukin 18 binding protein in patients with idiopathic thrombocytopenic purpura. Br J Haematol. (2009) 144:755–61. 10.1111/j.1365-2141.2008.07520.x

  • 10.

    LiuXGRenJYuYSunLShiYQinPet al. Decreased expression of interleukin-27 in immune thrombocytopenia. British J Haematol. (2011) 153:259–67. 10.1111/j.1365-2141.2011.08614.x

  • 11.

    SunTZhangDYangYZhangXLvCFuRet al. Interleukin 35 may contribute to the loss of immunological self-tolerance in patients with primary immune thrombocytopenia. Br J Haematol. (2015) 169: 278–85. 10.1111/bjh.13292

  • 12.

    CruikshankWKornfeldHBermanJChuppGKeaneJCenterD. Biological activity of interleukin-16. Nature. (1996) 382:501–2.

  • 13.

    BaierMBannertNWernerALangKKurthR. Molecular cloning, sequence, expression, and processing of the interleukin 16 precursor. Proce Natl Acad Sci USA. (1997) 94:5273–77.

  • 14.

    ZhangYCenterDMWuDMCruikshankWWYuanJAndrewsDWet al. Processing and activation of pro-interleukin-16 by caspase-3. J Biol Chem. (1998) 273:1144–9. 10.1074/jbc.273.2.1144

  • 15.

    RichmondJTuzovaMCruikshankWCenterD. Regulation of cellular processes by interleukin-16 in homeostasis and cancer. J Cell Physiol. (2014) 229:139–47. 10.1002/jcp.24441

  • 16.

    ZhangYKornfeldHCruikshankWWKimSReardonCCCenterDM. Nuclear translocation of the N-terminal prodomain of interleukin-16. J Biol Chem. (2001) 276:1299–303. 10.1074/jbc.M008513200

  • 17.

    WilsonKCCruikshankWWCenterDMZhangY. Prointerleukin-16 contains a functional CcN motif that regulates nuclear localization. Biochemistry. (2002) 41:14306–12. 10.1021/bi020163v

  • 18.

    ChuppGLWrightEAWuDVallen-MashikianMCruikshankWWCenterDMet al. Tissue and T cell distribution of precursor and mature IL-16. J Immunol. (1998) 161:3114–9.

  • 19.

    WuDMZhangYParadaNAKornfeldHNicollJCenterDMet al. Processing and release of IL-16 from CD4+ but not CD8+ T cells is activation dependent. J Immunol. (1999) 162:1287–93.

  • 20.

    LimKGWanHCBozzaPTResnickMBWongDTCruikshankWWet al. Human eosinophils elaborate the lymphocyte chemoattractants. IL-16 (lymphocyte chemoattractant factor) and RANTES. J Immunol. (1996) 156:2566–70.

  • 21.

    LorentzASchwengbergSSellgeGMannsMPBischoffSC. Human intestinal mast cells are capable of producing different cytokine profiles: role of IgE receptor cross-linking and IL-4. J Immunol J Immunol. (2000) 164:43–8. 10.4049/jimmunol.164.1.43

  • 22.

    RumsaengVCruikshankWWFosterBPrussinCKirshenbaumASDavisTAet al. Human mast cells produce the CD4+ T lymphocyte chemoattractant factor, IL-16. J Immunol. (1997) 159:2904–10.

  • 23.

    ElssnerADoseffAIDuncanMKoturMWewersMD. IL-16 is constitutively present in peripheral blood monocytes and spontaneously released during apoptosis. J Immunol. (2004) 172:7721–25. 10.4049/jimmunol.172.12.7721

  • 24.

    KaserADunzendorferSOffnerFARyanTSchwabeggerACruikshankWWet al. A role for IL-16 in the cross-talk between dendritic cells and T cells. J Immunol. (1999) 163:3232–8.

  • 25.

    KaserADunzendorferSOffnerFALudwiczekOEnrichBKochROet al. B lymphocyte-derived IL-16 attracts dendritic cells and Th cells. J Immunol. (2000) 165:2474–80. 10.4049/jimmunol.165.5.2474

  • 26.

    KramerMFMackBRaspG. Immunohistological expression of interleukin 16 in human tonsils. Arch Otolaryngol. (2001) 127:1120–5. 10.1001/archotol.127.9.1120

  • 27.

    CruikshankWWBermanJSTheodoreACBernardoJCenterDM. Lymphokine activation of T4+ T lymphocytes and monocytes. J Immunol. (1987) 138:3817–23.

  • 28.

    QiJCWangJMandadiSTanakaKRoufogalisBDMadiganMCet al. Human and mouse mast cells use the tetraspanin CD9 as an alternate interleukin-16 receptor. Blood. (2006) 107:135–42. 10.1182/blood-2005-03-1312

  • 29.

    CenterDMKornfeldHCruikshankWW. Interleukin-16. Int J Biochem Cell Biol. (1997) 29:1231–4. 10.1016/S1357-2725(97)00053-8

  • 30.

    MathyNLScheuerWLanzendörferMHonoldKAmbrosiusDNorleySet al. Interleukin-16 stimulates the expression and production of pro-inflammatory cytokines by human monocytes. Immunology. (2000) 100:63–9. 10.1046/j.1365-2567.2000.00997.x

  • 31.

    SkundricDSCaiJCruikshankWWGvericD. Production of IL-16 correlates with CD4+ Th1 inflammation and phosphorylation of axonal cytoskeleton in multiple sclerosis lesions. J Neuroinflamm. (2006) 3:13. 10.1186/1742-2094-3-13

  • 32.

    MeagherCBeilkeJArreazaGMiQSChenWSalojinKet al. Neutralization of interleukin-16 protects nonobese diabetic mice from autoimmune type 1 diabetes by a CCL4-dependent mechanism. Diabetes. (2010) 59:2862–71. 10.2337/db09-0131

  • 33.

    JernåsMHouYStrömbergCélind FShaoLNookaewIWangQet al. Differences in gene expression and cytokine levels between newly diagnosed and chronic pediatric ITP. Blood. (2013) 122:1789–92. 10.1182/blood-2013-05-502807

  • 34.

    GuoCChuXShiYHeWLiLWangLet al. Correction of Th1-dominant cytokine profiles by high-dose dexamethasone in patients with chronic idiopathic thrombocytopenic purpura. J Clin Immunol. (2007) 27:557–62. 10.1007/s10875-007-9111-1

  • 35.

    HouYFengQXuMLiGSLiuXNShengZet al. High-dose dexamethasone corrects impaired myeloid-derived suppressor cell function via Ets1 in immune thrombocytopenia. Blood. (2016) 127:1587–97. 10.1182/blood-2015-10-674531

  • 36.

    ProvanDStasiRNewlandACBlanchetteVSBolton-MaggsPBusselJBet al. International consensus report on the investigation and management of primary immune thrombocytopenia. Blood. (2010) 115:168–86. 10.1182/blood-2009-06-225565

  • 37.

    RodeghieroFStasiRGernsheimerTMichelMProvanDArnoldDMet al. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group. Blood. (2009) 113:2386–93. 10.1182/blood-2008-07-162503

  • 38.

    GoihlARolleAMKähneTReinholdAWrengerSReinholdD. Methodologic issues in the measurement of interleukin-16 in clinical blood samples using immunoassays. Cytokine. (2012) 58:1–5. 10.1016/j.cyto.2011.12.012

  • 39.

    ReinholdDBankUBühlingFJunkerUKekowJSchleicherEet al. A detailed protocol for the measurement of TGF-beta1 in human blood samples. J Immunol Methods. (1997) 209:203–6. 10.1016/S0022-1759(97)00160-9

  • 40.

    MeijerinkJMandigersCvan de LochtLTönnissenEGoodsaidFRaemaekersJ. A novel method to compensate for different amplification efficiencies between patient DNA samples in quantitative real-time PCR. J Mol Diagnos. (2001) 3:55–61. 10.1016/S1525-1578(10)60652-6

  • 41.

    CooperNBusselJ. The pathogenesis of immune thrombocytopaenic purpura. Br J Haematol. (2006) 133:364–74. 10.1111/j.1365-2141.2006.06024.x

  • 42.

    CruikshankWWLimKTheodoreACCookJFineGWellerPFet al. IL-16 inhibition of CD3-dependent lymphocyte activation and proliferation. J Immunol. (1996) 157:5240–8.

  • 43.

    PinsonneaultSEl BassamSMazerBCruikshankWWLabergeS. IL-16 inhibits IL-5 production by antigen-stimulated T cells in atopic subjects. J Allergy Clinl Immunol. (2001) 107:477–82. 10.1067/mai.2001.112373

  • 44.

    ShanNNHuYHouMGaoJWangXLiuXet al. Decreased Tim-3 and its correlation with Th1 cells in patients with immune thrombocytopenia. Thrombosis Res. (2014) 133:52–56. 10.1016/j.thromres.2013.10.029

  • 45.

    TheodoreACCenterDMNicollJFineGKornfeldHCruikshankWW. CD4 ligand IL-16 inhibits the mixed lymphocyte reaction. J Immunol. (1996) 157:1958–64.

  • 46.

    LynchEAHeijensCAHorstNFCenterDMCruikshankWW. Cutting edge: IL-16/CD4 preferentially induces Th1 cell migration: requirement of CCR5. J Immunol. (2003) 171:4965–8. 10.4049/jimmunol.171.10.4965

  • 47.

    LiuZWangMZhouSMaJShiYPengJet al. Pulsed high-dose dexamethasone modulates Th1-/Th2-chemokine imbalance in immune thrombocytopenia. J Translt Med. (2016) 14:301. 10.1186/s12967-016-1064-9

  • 48.

    CenterDMCruikshankWWZhangY. Nuclear pro-IL-16 regulation of T cell proliferation: p27(KIP1)-dependent G0/G1 arrest mediated by inhibition of Skp2 transcription. J Immunol. (2004) 172:1654–60. 10.4049/jimmunol.172.3.1654

  • 49.

    SzaboSJKimSTCostaGLZhangXFathmanCGGlimcherLH. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. (2000) 100:655–69. 10.1016/S0092-8674(00)80702-3

  • 50.

    HallGCullenESawmynadenKArnoldJFoxSCowanRet al. Structure of a potential therapeutic antibody bound to interleukin-16 (IL-16): Mechanistic Insights And New Therapeutic Opportunities. J Biol Chem. (2016) 291:16840–8. 10.1074/jbc.M115.709303

Summary

Keywords

adult immune thrombocytopenia, high-dose dexamethasone, Interleukin-16, caspase-3, Th1 polarization

Citation

Wang X, Li L, Wang Y, Li X, Feng Q, Hou Y, Ma C, Gao C, Hou M and Peng J (2019) High-Dose Dexamethasone Alters the Increase in Interleukin-16 Level in Adult Immune Thrombocytopenia. Front. Immunol. 10:451. doi: 10.3389/fimmu.2019.00451

Received

02 September 2018

Accepted

19 February 2019

Published

18 March 2019

Volume

10 - 2019

Edited by

Ann Marie Reed, Duke University, United States

Reviewed by

Zhe-Xiong Lian, South China University of Technology, China; Lei Zhang, Chinese Academy of Medical Sciences and Peking Union Medical College, China

Updates

Copyright

*Correspondence: Jun Peng Ming Hou

This article was submitted to Autoimmune and Autoinflammatory Disorders, a section of the journal Frontiers in Immunology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics