Abstract
Our knowledge of pathogens and symbionts is heavily biased toward phyla containing species that are straightforward to isolate in pure culture. Novel bacterial phyla are often represented by a handful of strains, and the number of species interacting with eukaryotes is likely underestimated. Identification of predicted pathogenesis and symbiosis determinants such as the Type III Secretion System (T3SS) in the genomes of “free-living” bacteria suggests that these microbes participate in uncharacterized interactions with eukaryotes. Our study aimed to test this hypothesis on Verrucomicrobium spinosum (phylum Verrucomicrobia) and to begin characterization of its predicted T3SS. We showed the putative T3SS structural genes to be transcriptionally active, and that expression of predicted effector proteins was toxic to yeast in an established functional screen. Our results suggest that the predicted T3SS genes of V. spinosum could encode a functional T3SS, although further work is needed to determine whether V. spinosum produces a T3SS injectisome that delivers the predicted effectors. In the absence of a known eukaryotic host, we made use of invertebrate infection models. The injection or feeding of V. spinosum to Drosophila melanogaster and Caenorhabditis elegans, respectively, was shown to result in increased mortality rates relative to controls, a phenomenon exaggerated in C. elegans mutants hypersensitive to pathogen infection. This finding, although not conclusively demonstrating pathogenesis, suggests that V. spinosum is capable of pathogenic activity toward an invertebrate host. Symbiotic interactions with a natural host provide an alternative explanation for the results seen in the invertebrate models. Further work is needed to determine whether V. spinosum can establish and maintain interactions with eukaryotic species found in its natural habitat, and whether the predicted T3SS is directly involved in pathogenic or symbiotic activity.
Introduction
For anthropocentric reasons, bacteria are often conceptually divided into free-living and host-associated organisms. However, we know that different members of the same bacterial phylum can exhibit a multitude of lifestyles (free-living, pathogen, symbiont), and even that a single species can engage in different kinds of relationships with different hosts. It is also clear that bacterial phyla containing known pathogens and symbionts are enormously over-represented in our culture collections and sequence databases (Martiny and Field, ), whereas our knowledge of many novel phyla is limited to a handful of strains. The relatively obscure bacterium Verrucomicrobium spinosum (phylum Verrucomicrobia) was isolated from a lake in northern Germany (Schlesner, ), and its most interesting feature until now has been its unusual cellular morphology, featuring wart-like cellular protrusions (Schlesner, ) and a compartmentalized cell plan shared with the planctomycetes (Lee et al., ). For two decades, V. spinosum has been regarded as a free-living, non-pathogenic microbe, but its genome sequence contains a predicted Type III secretion system (T3SS; Pallen et al., ). T3SS is a hallmark of bacteria–eukaryote interactions, chiefly known for its role as a pathogenesis factor, delivering toxic effector proteins via direct cell-to-cell contact with eukaryotic cells, but also involved in symbioses (Galán and Wolf-Watz, ). It has been suggested that “free-living” organisms possessing predicted T3SS may participate in uncharacterized interactions with eukaryotes (Pallen et al., ). Our study aimed to test this hypothesis on Verrucomicrobium spinosum and to begin characterization of its predicted T3SS. We achieved our aims by generating experimental data on the transcriptional activity and protein–protein interactions of T3SS genes and their gene products, respectively. We also demonstrated that V. spinosum can kill two different model invertebrate hosts.
Results
V. spinosum possesses and expresses predicted type III secretion system genes
The V. spinosum genome contains all required structural components for a functional T3SS (Figure 1; Table A1 in Appendix). The V. spinosum T3SS genes are found in a cluster with strikingly similar organization to other T3SS gene clusters, particularly the well-characterized T3SS found in Yersinia species, and the T3SS of desulfovibrios and related organisms (Heidelberg et al., ; Pallen et al., ). All essential categories of T3SS structural proteins were identified, including membrane anchors (VspC, VspQ), candidate needle proteins (VspF1, VspF2), needle protein chaperones (VspE, VspG), and an ATPase (VspN; Table A1 in Appendix). Importantly, we found that several of these genes were actively transcribed. Transcription of predicted outer and inner bacterial membrane anchors of the T3SS, and candidate needle proteins, was detected by RT-PCR (Figure 2) under standard growth conditions (described in Materials and Methods). Furthermore, specialized cytoplasmic chaperones are usually required for the stability of the T3SS, and the efficient translocation of T3SS components and effectors (Galán and Wolf-Watz, ). We demonstrated a physical association between one needle protein (VspF1) and one chaperone (VspE; Table A2 in Appendix) by yeast two-hybrid screening, thus supporting a functional interaction.
Figure 1
Figure 2
Expression of predicted V. spinosum T3SS effector proteins suppresses growth of yeast
We next used a yeast functional screen (Lesser and Miller, ) to experimentally confirm the toxicity of predicted T3SS effector proteins from V. spinosum. Expression of T3SS effectors, but not other bacterial proteins, causes growth inhibition of Saccharomyces cerevisiae (Lesser and Miller, ; Slagowski et al., ). We identified three candidate effectors, based on their proximity to the T3SS structural gene cluster, sequence similarity to known T3SS effectors, and/or sequence properties reported to be characteristic of T3SS effectors (Schechter et al., ). Two of these, open reading frame (ORF) 05930 (p = 7.9 e 10−17; t-test) and ORF04374 (p = 3.3 e 10−7; t-test), showed a significant inhibition of growth under inducing conditions (Figure 3). Expression of control V. spinosum genes showed no such effect. While we have not directly demonstrated that the predicted T3SS secretes these predicted effectors, our data suggest that injection of these effectors into eukaryotic cells would be toxic, similar to other known T3SS effectors.
Figure 3
V. spinosum increases mortality of D. melanogaster
We next performed standard infection assays (Schneider et al., ) with V. spinosum in Drosophila melanogaster. Drosophila is an established model organism for examining T3SS-mediated pathogenesis (Brandt et al., ). Although non-pathogenic bacteria can elicit an immune response when injected into D. melanogaster (Lemaitre et al., ), they have no effect on fly mortality (Schneider et al., ). Wild-type (Oregon R) flies infected with V. spinosum died more quickly than flies injected with buffer alone (Figure 4), with approximately 40% survival after 20 days, compared to 85% survival for negative control buffer-injected flies (p = <1.0 × 10−4). A similar effect observed using wild-type Salmonella typhimurium was shown to be dependent on the T3SS (Brandt et al., ).
Figure 4
V. spinosum increases mortality of C. elegans
We also examined the effect of V. spinosum exposure on the mortality of Caenorhabditis elegans. Sterile mutant worms [fer-15(b26);fem-1(hc17)] exposed to living V. spinosum exhibited increased mortality relative to control worms feeding on Escherichia coli (Figure 5A), whereas heat-killed V. spinosum cells had no such effect (Figure A1A in Appendix). This suggested a direct and adverse interaction between living V. spinosum and the worm rather than a non-specific mortality increase due to provision of a nutritionally inferior diet or similar non-specific effect. V. spinosum-induced mortality was increased (Figure 5B) in a worm deletion mutant [fshr-1(ok778)] previously shown to be hypersensitive to pathogen infection by multiple agents (Powell et al., ). Using a multi-copy extrachromosomal array that overexpresses fshr-1 (Cho et al., ), we were able to completely reverse V. spinosum-associated death in fshr-1(ok778) mutants (Figure 5B). In fact, overexpression of fshr-1 substantially reduced mortality of fshr-1(ok778) mutants exposed to V. spinosum to levels below that observed for wild-type, similar to our observations with the known pathogens, S. aureus, and E. faecalis (Figures A1B,C in Appendix). In contrast, fshr-1 expression levels do not correlate to life expectancy on a non-pathogenic strain (Figure A1D in Appendix), indicating that the effects of fshr-1 on survival are specific to pathogen exposure (Powell et al., ).
Figure 5
Can we predict the natural eukaryotic host of V. spinosum?
Phylogenetic analysis of structural T3SS proteins has shown most bacteria possessing T3SS to cluster according to their specific interaction type, such as plant pathogen, obligate intracellular animal pathogen, or extracellular animal pathogen (Troisfontaines and Cornelis, ). In an attempt to predict the nature of any uncharacterized V. spinosum–eukaryote interaction, we conducted phylogenetic analysis of YscN-like sequences (the T3SS ATPase from Yersinia) from V. spinosum, all available free-living bacteria carrying predicted T3SS genes, and reference pathogens and symbionts (Figure 6). The V. spinosum YscN appeared most closely related to those from strains of three deltaproteobacteria: Lawsonia intracellularis, Desulfovibrio piger and Desulfovibrio vulgaris. This cluster was recovered with analysis of some, but not all, additional T3SS genes (data not shown). L. intracellularis is an obligate intracellular pathogen and causes proliferative enteritis in pigs (Kroll et al., ). Members of the genus Desulfovibrio are anaerobic sulfate-reducing bacteria and include both commensals and pathogens of the human gastrointestinal tract (Gibson et al., , ; Willis et al., ; Zinkevich and Beech, ; Loubinoux et al., ; Goldstein et al., ), as well as free-living environmental bacteria. Specifically, strains of D. piger and D. vulgaris are human intestinal commensals and D. piger also acts as an occasional human opportunistic pathogen. Genes predicted to encode T3SS in the L. intracellularis and D. vulgaris genomes have been described previously (Heidelberg et al., ; Pallen et al., ), and the T3SS of L. intracellularis has recently been linked to pathogenesis in the porcine host (Alberdi et al., ). There are no reports of infection of invertebrate models with these organisms, so it is not clear whether their host range could extend to invertebrates.
Figure 6
Discussion
We have begun to address two questions, using Verrucomicrobium spinosum as a test case. The first question is whether predicted T3SS genes without established function in “free-living” bacteria have the potential to encode a functional T3SS, i.e., an injectisome that translocates effector proteins into a eukaryotic host cell. Our results showed that the predicted T3SS genes of V. spinosum are transcriptionally active and identify a candidate chaperone for one of two predicted T3SS needle proteins. We also demonstrated that expression of V. spinosum proteins inhibits growth in an established yeast functional screen for T3SS effectors. Although the growth inhibition appears modest (Figure 3), use of this screen with characterized virulence proteins from a known pathogen (Shigella flexneri) showed that growth inhibition was variable (up to 50% compared to controls; Slagowski et al.,
The second question is whether V. spinosum can interact with eukaryotes. The results of our infection studies in two different model invertebrates suggest that it can. In particular, the increased mortality of C. elegansfshr-1 deletion mutants exposed to V. spinosum, relative to wild-type worms, strongly argues for a pathogenic interaction in this model. However, we cannot presently extrapolate this result to the natural host(s) of V. spinosum, given that mechanisms of bacterial pathogenesis (e.g., T3SS) are also used to initiate and maintain symbiotic relationships (Viprey et al.,
Another obvious goal is determination of the role of the predicted V. spinosum T3SS in the mortality observed in invertebrate infection models. The major hurdle to this work is that the development of genetic tools for V. spinosum is still in its infancy. Although a method for random transposon mutagenesis of the V. spinosum genome has been recently described (Domman et al.,
With the rapid development of sequencing technology, bacterial genome sequencing has revealed predicted pathogenesis/symbiosis determinants in several organisms not previously known to interact with eukaryotes (Pallen et al.,
Materials and Methods
Bioinformatic predictions and phylogenetic analysis
The V. spinosum genome sequence (accession ABIZ00000000) and the sequences of reference genomes were obtained from GenBank. Protein structure was predicted using the Phyre server (Kelley and Sternberg,
Bacterial strains and cultivation conditions
Verrucomicrobium spinosum type strain DSM 4136 was grown in liquid M13 medium (Schlesner,
RNA isolation and RT-PCR
Ten milliliters of V. spinosum culture was collected by centrifugation and frozen at −80°C for 5 min. Cells were thawed, 250 μl TriZol reagent was added, and RNA isolation performed as recommended by the manufacturer. Pellets were re-suspended and incubated for 15 min at 55°C in 100 μl RNase-free water, DNase-treated, and subsequently passed through an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed using the iScript cDNA synthesis kit (Bio-rad) according to the manufacturer’s instructions. PCR targeting VspC (ORF05910), VspQ (ORF05897), VspF1 (ORF05907), and VspF2 (ORF05908) was performed using V. spinosum cDNA or gDNA as the nucleic acid template. Reaction mixtures consisted of 1 × PCR buffer (NEB), 1.5 mM MgCl2, 10 μM each primer (Table A3 in Appendix), 200 μM each dNTP, 0.2 U Taq DNA polymerase, 30 ng of cDNA in a 50-μl volume. Reaction conditions consisted of an initial denaturation step of 95°C for 3 min followed by 35 repeat cycles of 95°C for 10 s, 62°C for 10 s, and 72°C for 20 s, and a single final extension step at 72°C for 5 min.
Yeast two-hybrid screens
Open reading frames were PCR-amplified from V. spinosum genomic DNA (gDNA). PCR was performed in a mixture of 1 × iProof High-Fidelity DNA polymerase PCR reaction mix (Bio-Rad), 25 μM each primer, and approximately 30 ng of V. spinosum gDNA in a final volume of 50 μl. Reaction conditions consisted of an initial denaturation step of 98°C for 30 s followed by 30 cycles of 98°C for 10 s, 54–60°C (see Table A3 in Appendix for primer sequences and annealing temperatures) for 10 s and 72°C for 1 min, followed by a single final extension step of 72°C for 5 min. PCR products were gel-purified using a QIAquick gel extraction kit (Qiagen), and cloned into pENTR/SD/D-TOPO (Invitrogen). E. coli NEB5α chemically competent cells (NEB) were transformed with the resulting constructs to generate entry clones. Correct sequence and orientation of each ORF was confirmed by DNA sequencing of entry clones. ORF’s were transferred to pDEST22 (Prey) and pDEST32 (Bait) vectors (Invitrogen) by LR recombination and specific protein–protein interactions were tested using the ProQuest Two-Hybrid System (Invitrogen), according to the manufacturer’s instructions.
Yeast T3SS effector screen
Putative T3SS effectors were selected for yeast genetic screening (Lesser and Miller,
Saccharomyces cerevisiae InvSc1 clones containing expression plasmids were grown in 5 ml non-inducing media (SM-ura + glucose) until culture had an OD600 of approximately 1.0. Cultures were normalized and inoculated into induction media (SM-ura + galactose) so that an OD600 of 0.05 was obtained. Tubes were incubated for 48 h at 30°C and the OD600 recorded. The final OD600 recorded was the average of two replicate cultures of 12 individual clones for each putative T3SS effector or control.
Fly experiments
Survival assays in D. melanogaster were performed as previously described (Schneider et al.,
Worm experiments
Strains were maintained according to standard procedures (Stiernagle,
Statements
Acknowledgments
This research was supported by the United States National Science Foundation (EPS-0447681). We would like to thank members of the Thorsness Lab in the Department of Molecular Biology, University of Wyoming, for assistance with experiments performed in yeast.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
References
1
AbascalF.ZardoyaR.PosadaD. (2005). ProtTest: selection of best-fit models of protein evolution. Bioinformatics21, 2104–2105.10.1093/bioinformatics/bti263
2
AlberdiM. P.WatsonE.McAllisterG. E.HarrisJ. D.PaxtonE. A.ThomsonJ. R.SmithD. G. (2009). Expression by Lawsonia intracellularis of type III secretion system components during infection. Vet. Microbiol.139, 298–303.10.1016/j.vetmic.2009.06.022
3
AltschulS. F.GishW.MillerW.MyersE. W.LipmanD. J. (1990). Basic local alignment search tool. J. Mol. Biol.215, 403–410.10.1006/jmbi.1990.9999
4
BrandtS. M.DionneM. S.KhushR. S.PhamL. N.VigdalT. J.SchneiderD. S. (2004). Secreted bacterial effectors and host-produced Eiger/TNF drive death in a Salmonella-infected fruit fly. PLoS Biol.2, e418.10.1371/journal.pbio.0020418
5
ChoS.RogersK. W.FayD. S. (2007). The C. elegans glycopeptide hormone receptor ortholog, FSHR-1, regulates germline differentiation and survival. Curr. Biol.17, 203–212.10.1016/j.cub.2006.12.027
6
DerrienM.VaughanE. E.PluggeC. M.de VosW. M. (2004). Akkermansia muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. Int. J. Syst. Evol. Microbiol.54, 1469–1476.10.1099/ijs.0.02873-0
7
DommanD. B.StevenB. T.WardN. L. (2011). Random transposon mutagenesis of Verrucomicrobium spinosum DSM 4136(T). Arch. Microbiol.193, 307–312.10.1007/s00203-010-0666-5
8
EdgarR. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res.32, 1792–1797.10.1093/nar/gkh180
9
GalánJ. E.Wolf-WatzH. (2006). Protein delivery into eukaryotic cells by type III secretion machines. Nature444, 567–573.10.1038/nature05272
10
GibsonG. R.CummingsJ. H.MacfarlaneG. T. (1991). Growth and activities of sulphate-reducing bacteria in gut contents of healthy subjects and patients with ulcerative colitis. FEMS Microbiol. Lett.86, 103–112.10.1111/j.1574-6968.1991.tb04799.x
11
GibsonG. R.CummingsJ. H.MacfarlaneG. T.AllisonC.SegalI.VorsterH. H.WalkerA. R. (1990). Alternative pathways for hydrogen disposal during fermentation in the human colon. Gut31, 679–683.10.1136/gut.31.6.679
12
GoldsteinE. J. C.CitronD. M.PerainoV. A.CrossS. A. (2003). Desulfovibrio desulfuricans bacteremia and review of human Desulfovibrio infections. J. Clin. Microbiol.41, 2752–2754.10.1128/JCM.41.6.2752-2754.2003
13
GuindonS.GascuelO. (2003). A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol.52, 696–704.10.1080/10635150390235520
14
HeidelbergJ. F.SeshadriR.HavemanS. A.HemmeC. L.PaulsenI. T.KolonayJ. F.EisenJ. A.WardN.MetheB.BrinkacL. M.DaughertyS. C.DeboyR. T.DodsonR. J.DurkinA. S.MadupuR.NelsonW. C.SullivanS. A.FoutsD.HaftD. H.SelengutJ.PetersonJ. D.DavidsenT. M.ZafarN.ZhouL.RaduneD.DimitrovG.HanceM.TranK.KhouriH.GillJ.UtterbackT. R.FeldblyumT. V.WallJ. D.VoordouwG.FraserC. M. (2004). The genome sequence of the anaerobic, sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough. Nat. Biotechnol.22, 554–559.10.1038/nbt959
15
KelleyL. A.SternbergM. J. E. (2009). Protein structure prediction on the web: a case study using the Phyre server. Nat. Protoc.4, 363–371.10.1038/nprot.2009.2
16
KrollJ. J.RoofM. B.HoffmanL. J.DicksonJ. S.HarrisD. L. (2005). Proliferative enteropathy: a global enteric disease of pigs caused by Lawsonia intracellularis. Anim. Health Res. Rev.6, 173–197.10.1079/AHR2005109
17
LeeK. C.WebbR. I.JanssenP. H.SangwanP.RomeoT.StaleyJ. T.FuerstJ. A. (2009). Phylum Verrucomicrobia representatives share a compartmentalized cell plan with members of bacterial phylum Planctomycetes. BMC Microbiol.9, 5.10.1186/1471-2180-9-5
18
LemaitreB.ReichhartJ. M.HoffmannJ. A. (1997). Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc. Natl. Acad. Sci. U.S.A.94, 14614–14619.10.1073/pnas.94.26.14614
19
LesserC. F.MillerS. I. (2001). Expression of microbial virulence proteins in Saccharomyces cerevisiae models mammalian infection. EMBO J.20, 1840–1849.10.1093/emboj/20.8.1840
20
LoubinouxJ.BronowickiJ.PereiraI. A. C.MougenelJ.FaouA. E. (2002). Sulfate-reducing bacteria in human feces and their association with inflammatory bowel diseases. FEMS Microbiol. Ecol.40, 107–112.10.1111/j.1574-6941.2002.tb00942.x
21
MartinyJ. B. H.FieldD. (2005). Ecological perspectives on the sequenced genome collection. Ecol. Lett.8, 1334–1345.10.1111/j.1461-0248.2005.00837.x
22
PallenM. J.BeatsonS. A.BaileyC. M. (2005). Bioinformatics, genomics and evolution of non-flagellar type-III secretion systems: a Darwinian perspective. FEMS Microbiol. Rev.29, 201–229.10.1016/j.femsre.2005.01.001
23
PetroniG.SpringS.SchleiferK. H.VerniF.RosatiG. (2000). Defensive extrusive ectosymbionts of Euplotidium (Ciliophora) that contain microtubule-like structures are bacteria related to Verrucomicrobia. Proc. Natl. Acad. Sci. U.S.A.97, 1813–1187.10.1073/pnas.030438197
24
PowellJ. R.AusubelF. M. (2007). “Models of Caenorhabditis elegans infection by bacterial and fungal pathogens,” in Innate Immunity, Methods in Molecular Biology, Vol. 415, eds EwbankJ.VivierE. (Totowa, NJ: Human Press), 403–427.
25
PowellJ. R.KimD. H.AusubelF. M. (2009). The G protein-coupled receptor FSHR-1 is required for the Caenorhabiditis elegans innate immune response. Proc. Natl. Acad. Sci. U.S.A.106, 2782–2787.10.1073/pnas.0813048106
26
PrestonG. M. (2007). Metropolitan microbes: type III secretion in multihost symbionts. Cell Host Microbe2, 291–294.10.1016/j.chom.2007.10.004
27
SchechterL. M.VencatoM.JordanK. L.SchneiderS. E.SchneiderD. J.CollmerA. (2006). Multiple approaches to a complete inventory of Pseudomonas syringae pv. tomato DC3000 type III secretion system effector proteins. Mol. Plant Microbe Interact.19, 1180–1192.10.1094/MPMI-19-1180
28
SchlesnerH. (1987). Verrucomicrobium spinosum gen. nov., sp. nov.: a fimbriated prosthecate bacterium. Syst. Appl. Microbiol.10, 54–56.
29
SchneiderD. S.AyresJ. S.BrandtS. M.CostaA.DionneM. S.GordonM. D.MaberyE. M.MouleM. G.PhamL. N.Shirasu-HizaM. M. (2007). Drosophila eiger mutants are sensitive to extracellular pathogens. PLoS Pathog.3, e41.10.1371/journal.ppat.0030041
30
SlagowskiN. L.KramerR. W.MorrisonM. F.LaBaerJ.LesserC. F. (2008). A functional genomic yeast screen to identify pathogenic bacterial proteins. PLoS Pathog.4, e9.10.1371/journal.ppat.0040009
31
StiernagleT. (2006). “Maintenance of C. elegans,” in WormBook (The C. elegans Research Community). 10.1895/wormbook.1.101.1, Available at: http://www.wormbook.org. [accessed February 11, 2006].
32
SugiuraN. (1978). Further analysts of the data by akaike’s information criterion and the finite corrections. Commun. Stat. Theory Methods7, 13.10.1080/03610927808827599
33
TroisfontainesP.CornelisG. R. (2005). Type III secretion: more systems than you think. Physiology (Bethesda)20, 326–339.10.1152/physiol.00011.2005
34
VandekerckhoveT. T.WillemsA.GillisM.CoomansA. (2000). Occurrence of novel verrucomicrobial species, endosymbiotic and associated with parthenogenesis in Xiphinema americanum-group species (Nematoda, Longidoridae). Int. J. Syst. Evol. Microbiol.50, 2197–2205.10.1099/00207713-50-6-2197
35
VipreyV.Del GrecoA.GolinowskiW.BroughtonW. J.PerretX. (1998). Symbiotic implications of type III protein secretion machinery in Rhizobium. Mol. Microbiol.28, 1381–1389.10.1046/j.1365-2958.1998.00920.x
36
WhelanS.GoldmanN. (2001). A general empirical model of protein evolution derived from multiple protein families using a maximum-likelihood approach. Mol. Biol. Evol.18, 691–699.
37
WillisC. L.CummingsJ. H.NealeG.GibsonG. R. (1997). Nutritional aspects of dissimilatory sulfate reduction in the human large intestine. Curr. Microbiol.35, 294–298.10.1007/s002849900257
38
ZinkevichV. V.BeechI. B. (2000). Screening of sulfate-reducing bacteria in colonoscopy samples from healthy and colitic human gut mucosa. FEMS Microbiol. Ecol.34, 147–155.10.1111/j.1574-6941.2000.tb00764.x
Appendix
Table A1
| Open reading frame | Description | Top BLASTP match | Required for type III secretion? |
|---|---|---|---|
| ORF02659 | Type III secretion chaperone DspF family | ZP_02197308.1 Vibrio campbellii AND4 hypothetical protein [Identities = 38/136 (27%), Positives = 57/136 (41%), Gaps = 0/136 (0%)] (4e-06) | No |
| ORF02982 | Type III secretion chaperone CesT family | YP_002436649.1 Desulfovibrio vulgaris str. “Miyazaki F” Tir chaperone family protein [Identities = 41/138 (29%), Positives = 59/138 (42%), Gaps = 3/138 (2%)] (2e-08) | No |
| ORF03096 | Type III secretion chaperone CesT family | YP_002436233.1 Desulfovibrio vulgaris str. “Miyazaki F” Tir chaperone family [Identities = 43/139 (30%), Positives = 70/139 (50%), Gaps = 7/139 (5%)] (5e-07) | No |
| ORF03208 | Type III secretion chaperone, CesT family | ZP_03311875.1 Desulfovibrio piger ATCC 29098 hypothetical protein [Identities = 36/119 (30%), Positives = 58/119 (48%), Gaps = 4/119 (3%)] (5e-05) | No |
| ORF04373 | Type III secretion chaperone CesT family | YP_002680810.1 Pseudovibrio sp. JE062 type III secretion chaperone, CesT family [Identities = 33/123 (26%), Positives = 50/123 (40%), Gaps = 8/123 (6%)] (0.081) | No |
| ORF04377 | Type III secretion chaperone CesT family | YP_002680810.1 Pseudovibrio sp. JE062 type III secretion chaperone, CesT family [Identities = 40/144 (27%), Positives = 57/144 (39%), Gaps = 7/144 (4%)] (0.007) | No |
| ORF04807 | Type III secretion chaperone CesT family | gb|AAY36239.1| Pseudomonas syringae pv. syringae B728a type III chaperone protein ShcM [Identities = 29/111 (26%), Positives = 50/111 (45%), Gaps = 9/111 (8%)] (0.002) | No |
| ORF05889 | Type III secretion chaperone CesT family | ZP_02197308.1 Vibrio campbellii AND4 hypothetical protein AND4_08621 [Identities = 37/129 (28%), Positives = 66/129 (51%), Gaps = 0/129 (0%)] (5e-10) | No |
| ORF05893 | Type III secretion protein YscU/HrpY | ZP_01259729.1 Vibrio alginolyticus translocation protein in type III secretion [Identities = 155/339 (45%), Positives = 237/339 (69%), Gaps = 0/339 (0%; 9e-97) | Yes |
| ORF05894 | Type III secretion protein SpaR/YscT/HrcT | NP_798053.1 Vibrio parahaemolyticus type III secretion apparatus protein SpaR/YscT/HrcT [Identities = 106/237 (44%), Positives = 155/237 (65%), Gaps = 3/237 (1%)] (6e-50) | Yes |
| ORF05895 | Type III secretion protein HrpO family (YscS/HrcS/SctS/EscS) | ZP_01550017.1 Stappia aggregata Type III secretory pathway, component EscS [Identities = 48/89 (53%), Positives = 67/89 (75%), Gaps = 0/89 (0%)] (2e-20) | Yes |
| ORF05896 | Type III secretion apparatus protein YscR/HrcR | ZP_02195905.1 Vibrio campbellii translocation protein in type III secretion [Identities = 133/215 (61%), Positives = 170/215 (79%), Gaps = 0/215 (0%)] (4e-70) | Yes |
| ORF05897 | Type III secretion apparatus protein YscQ/HrcQ/SpaO | YP_001444923.1 Vibrio harveyi ATCC BAA-1116 type III secretion system protein [Identities = 86/293 (29%), Positives = 131/293 (44%), Gaps = 25/293 (8%)] (1e-15) | Yes |
| ORF05898 | Putative T3SS needle length determinant | YP_436215.1 Hahella chejuensis KCTC 2396 hypothetical protein HCH_05109 [Identities = 27/88 (30%), Positives = 51/88 (57%), Gaps = 5/88 (5%)] (4e-05) | No |
| ORF05899 | Type III secretion protein O | ABM29998.1 Desulfovibrio vulgaris spp. vulgaris DP4 type III secretion YscO family protein [Identities = 57/155 (36%), Positives = 88/155 (56%), Gaps = 0/155 (0%)] (8e-11) | No |
| ORF05900 | Type III secretion apparatus H + transporting two-sector ATPase YscN | YP_594915.1 Lawsonia intracellularis PHE/MN1-00 type III secretion system ATPase [Identities = 307/435 (70%), Positives = 357/435 (82%), Gaps = 0/435 (0%)](4e-179) | Yes |
| ORF05901 | Type III secretion apparatus protein HrpE/YscL family | AAO18079.1 Photorhabdus luminescens LscL [Identities = 65/200 (32%), Positives = 118/200 (59%), Gaps = 11/200 (5%)] (1e-26) | Yes |
| ORF05904 | Type III secretion apparatus lipoprotein YscJ/HrcJ | ZP_01769285.1 Burkholderiapseudomallei 305 type III secretion apparatus lipoprotein, YscJ/HrcJ family [Identities = 101/245 (41%), Positives = 143/245 (58%), Gaps = 17/245 (6%)] (5e-44) | Yes |
| ORF05909 | Type III secretion apparatus protein YscD/HrpQ family | ABC30002.1 Hahella chejuensis KCTC 2396 putative type III export protein YscD [Length = 446 Identities = 83/330 (25%), Positives = 145/330 (43%), Gaps = 24/330 (7%)] (2e-15) | Yes |
| ORF05910 | Type III secretion outer membrane pore YscC/HrcC family | YP_434425.1 Hahella chejuensis KCTC 2396 putative type III secretion [Identities = 179/568 (31%), Positives = 295/568 (51%), Gaps = 40/568 (7%)] (5e-69) | Yes |
| ORF05911 | Type III secretion chaperone CesT family | YP_961197.1 Desulfovibrio vulgaris spp. vulgaris DP4 TIR chaperone family protein [Identities = 36/127 (28%), Positives = 63/127 (49%), Gaps = 13/127 (10%)](2.9) | No |
| ORF05912 | Type III secretion protein LcrD/AscV/YscV | NP_863517.1 Yersinia enterocolitica LcrD [Identities = 388/692 (56%), Positives = 537/692 (77%), Gaps = 17/692 (2%)] (0.0) | Yes |
| ORF05915 | Type III secretion chaperone SycN family | ZP_01259739.1 Vibrio alginolyticus 12G01 putative type III secretion protein [Identities = 40/123 (32%), Positives = 61/123 (49%), Gaps = 5/123 (4%)] (2e-04) | No |
| ORF05917 | Type III secretion regulator YopN/LcrE/InvE/MxiC | YP_961203.1 Desulfovibrio vulgaris spp. vulgaris DP4 type III secretion regulator YopN/LcrE/InvE/MxiC [Identities = 93/246 (37%), Positives = 136/246 (55%), Gaps = 18/246 (7%)] (2e-28) | No |
| ORF05919 | Putative Type III secretion system protein EscC | YP_002932398.1 Edwardsiella ictaluri 93-146 EscC [Identities = 89/356 (25%), Positives = 154/356 (43%), Gaps = 70/356 (19%)] (3e-08) | No |
| ORF05921 | Type III secretion low calcium response chaperone LcrH/SycD/SpaT | ZP_01985138.1 Vibrioharveyi HY01 type III secretion low calcium response chaperone LcrH/SycD [Identities = 52/149 (34%), Positives = 91/149 (61%), Gaps = 0/149 (0%)] (4e-21) | No |
| ORF05929 | Type III secretion chaperone CesT family | YP_001906486.1 Erwiniatasmaniensis Et1/99 Potential ORFB-specific chaperone, encodes a homolog of virulence/avirulence effector proteins secreted via the type III pathway [Identities = 35/107 (32%), Positives = 55/107 (51%), Gaps = 3/107 (2%)] (1e-08) | No |
| ORF05931 | Type III secretion chaperone CesT family | YP_002680810.1 Pseudovibrio sp. JE062 type III secretion chaperone, CesT family [Identities = 31/124 (25%), Positives = 59/124 (47%), Gaps = 2/124 (1%)] (1e-05) | No |
| ORF05932 | Type III secretion chaperone CesT family | YP_595407.1 Lawsonia intracellularis PHE/MN1-00 hypothetical protein LI1032 [Identities = 42/132 (31%), Positives = 65/132 (49%), Gaps = 3/132 (2%)] (1e-08) | No |
| ORF05933 | Type III secretion chaperone CesT family | YP_961179.1 Desulfovibrio vulgaris spp. vulgaris DP4 TIR chaperone family protein [Identities = 32/111 (28%), Positives = 54/111 (48%), Gaps = 5/111 (4%)] (3e-07) | No |
| ORF06015 | Type III secretion chaperone CesT family | YP_434498.1 Hahella chejuensis KCTC 2396 hypothetical protein HCH_03318 [Identities = 35/141 (24%), Positives = 61/141 (43%), Gaps = 7/141 (4%)] (0.001) | No |
Type III Secretion System structural genes and chaperones in the V. spinosum genome, predicted on the basis of primary sequence similarity (BLASTP comparison) and domain structure.
Table A2
| Bait/prey pair | HIS3 induction | B-Galactosidase induction | Interaction | |||
|---|---|---|---|---|---|---|
| SC− | SC− | SC− | SC− | X-Gal assay | ||
| Leu− | Leu− | Leu− | Leu− | |||
| Trp− | Trp− | Trp− | Trp− | |||
| His+ | His+ | His+ | His+ | |||
| 10 mM | 25 mM | 50 mM | 100 mM | |||
| 3AT | 3AT | 3AT | 3AT | |||
| pEXP32Krev1/pEXPRalGDS-wt (control strong positive interaction) | + | + | + | + | Blue | Strong |
| pEXP32Krev1/pEXPRalGDS-m1 (control weak positive interaction) | + | + | + | + | Blue | Weak |
| pEXP32Krev1/pEXPRalGDS-m2 (control negative interaction) | − | − | − | − | White | No |
| pEXP32VspF1/pEXP22VspF2 | − | − | − | − | White | No |
| pEXP32VspF1/pEXP22VspE | + | + | + | + | Blue | Strong |
| pEXP32VspF1/pEXP22VspG | − | − | − | − | White | No |
| pEXP32VspF2/pEXP22VspF2 | − | − | − | − | White | No |
| pEXP32VspF2/pEXP22VspE | − | − | − | − | White | No |
| pEXP32VspF2/pEXP22VspG | − | − | − | − | White | No |
Results of yeast two-hybrid screening to detect protein:protein interactions between putative needle proteins and putative chaperones.
Table A3
| Gene product | Open Reading frame | Oligonucleotide primers | Primer binding positions | Primer annealing temp.°C | |
|---|---|---|---|---|---|
| Forward primer (5′→3′) | Reverse primer (5′→3′) | ||||
| VspC | ORF05910 | AAGACCAAGAACACCCGCCAGATA | AAG AAG CGC TGT TTG CGC TCA TTC | 1595f-1698r | 62 |
| VspQ | ORF05897 | AAGGTGCCTGTGAGGTGCTGATTT | GCG GGA TCG CTC ATG ATG AAT TGT | 567f-666r | 62 |
| VspF1 | ORF05908 | AGCTCACTGAATATCTCGGCACCT | TTTCAGCCTGATCAATGCTGTGGG | 71f-190r | 62 |
| VspF2 | ORF05907 | ACGAAGAAACCACCCAGGTGATGA | TGGATCGCTTTCACAAGGTTGGAG | 83f-221r | 62 |
| VspF1 | ORF05908 | CAC CAT GAC AGA CAT TGA TAC | TCA GTC GTT TTG TTT ATC CCC | 17f-235r | 60 |
| VspF2 | ORF05907 | CAC CAT GGC AAT TGA CTT TG | CTA ACG AAG GTT GCT GAC AG | 16f-239r | 60 |
| VspG | ORF05906 | CAC CAT GAT CCC CGT CGA T | TCA TAG AAA GTT GCG TTT GGG | 15f-388r | 60 |
| VspE | ORF05905 | CAC CAT GAG CGT ACC TCT TG | TCA ACC GCC GCG GCT GAG | 16f-439r | 60 |
| ORF05930 | CAC CAT GCA CAA GAT TTC CG | TCA GTC CCC GAT CTT GTC CG | 16f-2044r | 58 | |
| ORF05930 | CCATA ATG CAC AAG ATT TCC G | GTC CCC GAT CTT GTC CGA C | 16f-2046r | 58 | |
| ORF01842 | CCATA ATG CCT CCT ATT TC | CCT GGG GGA GTC CGG TC | 14f-560r | 56 | |
| ORF04374 | CCATA ATG AAT AGC TTC C | CAA GAG GAT GAT CGA TG | 13f-1070r | 56 | |
| ORF03840 | CCATA ATG AAA ATC TCT AGC G | GTCCG CGG AGC GCA AAG | 16f-662r | 56 | |
| ORF04373 | CCATA ATG ATC GAC GAC TC | GGCGC AGA GAT AGT GCG | 14f-434r | 58 | |
| ORF05921 | CCATA ATG CCG ACG GGC | TGA CTC GGA AGT GGC GG | 12f-497r | 56 | |
Oligonucleotide primers used in this study.
Figure A1

Caenorhabditis elegans survival assays. Each experiment comprised approximately 100 worms. (A) Wild-type worms (N2) exposed to live V. spinosum died faster than worms exposed to E. coli, according to log-rank analysis (p = 3.71 e−7), whereas worms exposed to heat-killed V. spinosum died no faster than worms exposed to E. coli (p = 0.319). (B) When exposed to S. aureus, worm mutants hypersensitive to pathogens (fshr-1) died faster than N2 wild-type worms (p = 9.66 e−15). fshr-1(ok778) worms over-expressing wild-type fshr-1 from a multi-copy transgenic array died more slowly than N2 wild-type worms (p = 0.00114). (C) When exposed to E. faecalis, worm mutants hypersensitive to pathogens (fshr-1) died faster than N2 wild-type worms (p = 3.69 e−5). fshr-1(ok778) worms over-expressing wild-type fshr-1 from a multi-copy transgenic array died more slowly than N2 wild-type worms (p = 0.000799). (D) When exposed to E. coli, there was no difference in the mortality rate between wild-type worms, fshr-1(ok778) mutants (p = 0.541, relative to wild-type), and fshr-1(ok778) mutants over-expressing wild-type fshr-1 from a transgenic multi-copy array (p = 0.169, relative to wild-type).
Summary
Keywords
Verrucomicrobia, genome, eukaryotic host
Citation
Sait M, Kamneva OK, Fay DS, Kirienko NV, Polek J, Shirasu-Hiza MM and Ward NL (2011) Genomic and Experimental Evidence Suggests that Verrucomicrobium spinosum Interacts with Eukaryotes. Front. Microbio. 2:211. doi: 10.3389/fmicb.2011.00211
Received
21 June 2011
Accepted
30 September 2011
Published
18 October 2011
Volume
2 - 2011
Edited by
Frank T Robb, University of California, USA
Reviewed by
Garry Myers, University of Maryland, USA; Nils-Kaare Birkeland, University of Bergen, Norway
Copyright
© 2011 Sait, Kamneva, Fay, Kirienko, Polek, Shirasu-Hiza and Ward.
This is an open-access article subject to a non-exclusive license between the authors and Frontiers Media SA, which permits use, distribution and reproduction in other forums, provided the original authors and source are credited and other Frontiers conditions are complied with.
*Correspondence: Naomi L. Ward, Department of Molecular Biology, University of Wyoming, Dept 3944, 1000 E. University Avenue, Laramie, WY 82071, USA. e-mail: nlward@uwyo.edu
†Present address: Michelle Sait, Moredun Research Institute, Pentlands Science Park, Bush Loan, Edinburgh, Midlothian, UK; Natalia V. Kirienko, Department of Molecular Biology, Massachusetts General Hospital, Boston, MA, USA; Department of Genetics, Harvard Medical School, Boston, MA, USA; Mimi M. Shirasu-Hiza, Department of Genetics and Development, Columbia University Medical Center, New York, NY, USA.
This article was submitted to Frontiers in Evolutionary and Genomic Microbiology, a specialty of Frontiers in Microbiology.
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.