Abstract
Human settlement of Madagascar traces back to the beginning of the first millennium with the arrival of Austronesians from Southeast Asia, followed by migrations from Africa and the Middle East. Remains of these different cultural, genetic, and linguistic legacies are still present in Madagascar and other islands of the Indian Ocean. The close relationship between human migration and the introduction and spread of infectious diseases, a well-documented phenomenon, is particularly evident for the causative agent of leprosy, Mycobacterium leprae. In this study, we used whole-genome sequencing (WGS) and molecular dating to characterize the genetic background and retrace the origin of the M. leprae strains circulating in Madagascar (n = 30) and the Comoros (n = 3), two islands where leprosy is still considered a public health problem and monitored as part of a drug resistance surveillance program. Most M. leprae strains (97%) from Madagascar and Comoros belonged to a new genotype as part of branch 1, closely related to single nucleotide polymorphism (SNP) type 1D, named 1D-Malagasy. Other strains belonged to the genotype 1A (3%). We sequenced 39 strains from nine other countries, which, together with previously published genomes, amounted to 242 genomes that were used for molecular dating. Specific SNP markers for the new 1D-Malagasy genotype were used to screen samples from 11 countries and revealed this genotype to be restricted to Madagascar, with the sole exception being a strain from Malawi. The overall analysis thus ruled out a possible introduction of leprosy by the Austronesian settlers and suggests a later origin from East Africa, the Middle East, or South Asia.
Introduction
Leprosy was declared to be eliminated by the government of Madagascar in 2010, but the disease remains a public health problem, with more than 1,000 new cases reported annually since 2007 (; ; ). This is certainly an underestimate. Social exclusion and stigmatization are still common in Madagascar (), where approximately 25% of the new cases manifest with grade 2 disabilities, indicating late diagnosis (; ). Despite an efficient leprosy control program, the Comoros are still considered a highly endemic area, with a constant average of 400 new cases documented annually for an average population of 400,000 inhabitants since 2008 and 275 new cases in 2018 (; ). However, the relapse rate is low and only 1.8% of new cases present with grade 2 disability (; ). In the last report of the drug resistance surveillance network, resistance to rifampicin (rpoB), dapsone (folP1), and quinolones (gyrA) was observed only in three primary cases between 2009 and 2015 in Madagascar (; ). No information is currently available for the Comoros.
Leprosy is mainly caused by the non-cultivable pathogen Mycobacterium leprae and, to a lesser extent, Mycobacterium lepromatosis (). The M. leprae genotyping system is characterized by four single nucleotide polymorphism (SNP) types (1–4) and 16 SNP subtypes (A–P) divided into eight branches (; ). In Madagascar and the Comoros, little is known about the genetic background of circulating M. leprae strains. Two epidemiological studies reported the presence of the genotype 1D in Madagascar, but only seven isolates were studied so far (; ). No information is available about the strains currently circulating in the Comoros. Although our inability to cultivate the pathogen in vitro has hampered research, recently developed methods allow the sequencing of leprosy bacilli DNA directly from human samples (; ; ).
Despite Madagascar’s proximity to mainland Africa, the genetic, cultural, and archeological evidence indicate that the Malagasy and the Comorans, the inhabitants of Madagascar and the Comoros, respectively, are of mixed African, Indonesian, and Middle Eastern ancestry (; ; ; , ). As with several other infectious diseases (), leprosy also exemplifies the correlation between the dissemination of pathogens and human migrations (). However, establishing the origin of M. leprae in an admixed population such as the Malagasy requires comprehensive molecular characterization of the pathogen.
In this investigation, we aimed to characterize the genetic background and predict the origin of the M. leprae strains circulating in Madagascar and the Comoros using whole-genome sequencing (WGS).
Materials and Methods
Ethics Statement
This study was carried out under the ethical consent of the WHO Global Leprosy Programme surveillance network. All subjects gave written informed consent in accordance with the Declaration of Helsinki.
Patients and Clinical Samples From Madagascar and the Comoros
A total of 60 skin biopsies from 51 suspected leprosy cases from Madagascar (n = 48) and the Comoros (n = 3), collected between 2013 and April 2017, were obtained from the Leprosy National Reference Laboratory [Centre d’Infectiologie Charles Mérieux (CICM), Antananarivo, Madagascar] and the Centre National de Référence des Mycobactéries et de la Résistance des Mycobactéries aux Antituberculeux (CNR MyRMA, Paris, France) for WGS characterization (Supplementary Table S1). Additionally, a total of 40 samples were collected after May 2017 at the Centre d’Infectiologie Charles Merieux from 40 suspected or diagnosed leprosy cases for molecular drug-susceptibility testing and genotyping (Supplementary Table S1).
Samples were collected at health facilities by medical staff (Supplementary Table S1). Three DNA extracts (B204, B171, and B191; Supplementary Table S1) from a previous investigation at the Institut Pasteur were also included ().
Additional Samples for Genotyping Screening
DNA samples were obtained from ongoing or previous studies (; , ) from countries where the M. leprae genotype 1D was previously reported—Nepal (n = 25), Venezuela (n = 15), Bangladesh (n = 11), Brazil (n = 5), Chad (n = 4), Antilles (n = 3), India (n = 1), and Congo (n = 1)—for genotyping by PCR and WGS (Supplementary Tables S2, S3). Additional samples from two Austronesian countries, Philippines (n = 18), and Indonesia (n = 5), were also included.
DNA Extractions
The choice of the DNA extraction method for the samples from Madagascar and Comoros was influenced by initial results obtained by Ziehl–Neelsen (ZN) staining and standard PCR previously performed on site (Supplementary Table S1). DNA extraction for initial screening at reference laboratories (CICM and CNR-MyRMA) was carried using the freeze–boiling method as previously described (). Around 50–100 mg of all previously characterized PCR- or ZN-positive skin biopsies were re-extracted using the host depletion (HD) method (; ). PCR- and ZN-negative biopsies and samples from the second screening step were extracted using the quicker total DNA extraction method (; ; Supplementary Table S1). For samples collected outside Madagascar and the Comoros, the DNA extraction methods used are described in Supplementary Table S2.
PCR Amplification of Specific Loci, Molecular Drug Resistance Screening, and Genotyping by PCR Sequencing
Detection of M. leprae was performed for the first and second screening (Supplementary Table S1) on all samples, as recommended (), using the M. leprae-specific repetitive element (RLEP) primers (Table 1). M. lepromatosis-specific PCR (primers LPM244) was performed on all samples that were negative for M. leprae (Table 1). To identify genotype-specific SNPs, primers were designed using the Primer3 web tool1 and are described in Table 1. For each sample, 5 μl of the starting materials, negative control (water) or positive control (M. leprae DNA strain Thai-53, NR19352) was used in 50 μl reactions using the Accustart PCR Mastermix (Quantabio, Beverly, MA, United States), and quality was assessed as previously described (). Amplification started with a 3 min initial denaturation step at 94°C, followed by 40 cycles of 30 s denaturation at 94°C, 30 s annealing at 58°C (all PCR primers in Table 1), and extension at 72°C for 30 s; final extension was then at 72°C for 5 min. Amplicon sequencing was done by Genewiz (United Kingdom) or Microsynth (Switzerland).
TABLE 1
| Primer name | Target | Purpose | Amplicon size (bp) | Primer sequence (5′–3′) | Nucleic acid modification between strains | References |
| RLEP-F | RLEP | Detection of M. leprae by | 450 | TGAGGCTTCGTGTGCTTTGC | – | |
| RLEP-R | RLEP | PCR | ATCTGCGCTAGA AGGTTGCC | – | ||
| RLEPq-F | RLEP | Detection of M. leprae by | 70 | GCAGTATCGTGTTAGTGAA | – | |
| RLEPq-R | RLEP | quantitative PCR | CGCTAGAAGGTTGCCGTATG | – | ||
| RLEPq-P | RLEP | FAM-TCGATGATCCGGCCGTCGGCG QSY | – | |||
| LPM244-F | hemN | Detection of | 244 | GTTCCTCCACCGACAAACAC | – | |
| LPM244-R | M. lepromatosis | TTCGTGAGGTACCGGTGAAA | – | |||
| rpoB-For | rpoB | Amplification of the drug | 255 | CTGATCAATATCCGTCCGGT | – | |
| rpoB-Rev | resistance-determining region of rpoB | CGACAATGAACCGATCAGAC | – | |||
| folP1-For | folP1 | Amplification of the drug | 254 | CTTGATCCTGACGATGCTGT | – | |
| folp1-Rev | resistance-determining region of folP1 | CCACCAGACACATCGTTGAC | – | |||
| gyrA-For | gyrA | Amplification of the drug | 225 | ATGGTCTCAAACCGGTACATC | – | |
| gyrA-Rev | resistance-determining region of gyrA | TACCCGGCGAACCGAAATTG | – | |||
| SNP-2921694-F | ml2446 | Specific to 1D-Malagasy | 169 | TGTATGAACGCTGGGCAGTA | A1015G | This study |
| SNP-2921694-R | genotype | TCAACCGGGTCACCATAGAT | ||||
| SNP-3016895-F | ml2535 | Specific to 1D genotype | 199 | GAGCCACTATTTCCCGACAA | C3541A | This study |
| SNP-3016895-R | outside Madagascar | CGTCGTCGATGAGCAAGTAA |
List of primers used in this study.
qPCR of RLEP, an M. leprae-Specific Region, Prior to WGS
All DNA samples extracted at EPFL were subjected to quantitative PCR (qPCR) analysis to detect M. leprae prior to WGS. The repetitive element RLEP was quantified using TaqMan® PCR amplification as described previously, with minor modifications (). A total of 3 μl of each purified DNA sample, or the positive control (DNA from Thai-53, NR-19352) or the negative control (water), was added to a total PCR reaction volume of 20 μl containing 10 μl of TaqPath ProAmp master mix (Thermo Fisher Scientific, MA, United States), 900 nM of each forward (RLEPq-F) and reverse (RLEPq-R) primer, and 250 nM of the hydrolysis probe (RLEPq-P) (Table 1). The reaction mixtures were prepared in triplicate and amplification started with an initial denaturation step of 10 min at 95°C, followed by 40 cycles of 15 s at 95°C and 1 min 60°C, using the QuantStudio 3 real-time PCR system (Thermo Fisher Scientific, MA, United States). Data analysis was performed with the Thermo Fisher Connect Cloud2, and the mean cycle threshold (Ct) was calculated for each sample. qPCR values were also used to evaluate the relative amount of M. leprae DNA in each sample and provide a GO/NO GO answer prior to WGS.
Library Preparation and Comparative Genomic Analysis
Up to 1 μg of DNA in 50 μl was fragmented to 300–400 bp by Adaptive Focused Acoustics on a Covaris S2 instrument (Covaris) using the manufacturer’s protocol. After a 1.8 × ratio cleanup using KAPA Pure beads (Roche, Switzerland), DNA library preparation was performed using the KAPA HyperPrep kit (Roche, Switzerland) and the KAPA dual indexes, as described elsewhere (). After the final amplification step, libraries were quantified using the Qubit dsDNA HS or BR Assay Kit (Thermo Fisher Scientific, MA, United States) and the fragment size assessed on a Fragment Analyzer (Advanced Analytical Technologies, Inc., Ankeny, IA, United States). Finally, libraries were multiplexed and sequenced using single-end reads on Illumina HiSeq 2500 or NextSeq instrument.
Raw reads were processed as described elsewhere (). The phylogenetic analysis was performed using a concatenated SNP alignment (Supplementary Table S3). Maximum parsimony (MP) trees were constructed in MEGAX () with the 72 new genomes from this study (Supplementary Table S2) and 170 previously published genomes (Supplementary Table S4; ; ) using 500 bootstrap replicates and M. lepromatosis as an outgroup. Sites with missing data were partially deleted (arbitrary 80% coverage cutoff), resulting in 4,040 variable sites used for the tree calculation. Dating analyses were done using BEAST2 (v2.5.2) (), as described previously (), with 234 genomes (Supplementary Table S5) and an increased chain length from 50 to 100 million. Briefly, the concatenated SNPs for each sample were used for tip dating analysis. Hypermutated strains and highly mutated genes associated with drug resistance were omitted, but sites with missing data as well as constant sites were included in the analysis, as previously described (). We included only unambiguous constant sites, i.e., loci where the reference base was called in all samples. Indel calling was done using Platypus v0.8.1 followed by manual curation ().
Genome-Wide Comparison
The SNPs and indels of the newly sequenced genomes from Madagascar and Comoros were compared to the 170 previously published genomes (Supplementary Table S3) and the 72 new genomes from this study (Supplementary Table S2). The impact of amino acid substitutions on protein function was predicted using the online tool Provean ().
M. leprae Enrichment of Libraries
To obtain enough M. leprae coverage, libraries from previously available DNA or DNA extracted using the total DNA extraction method (Supplementary Table S2) were target enriched for the M. leprae genome using a custom MYbaits Whole Genome Enrichment kit as described by . Approximately 1.5 μg of each DNA library was captured and pooled with another library of a similar Ct prior to enrichment. Hybridization was performed at 65°C for 48 h. Each enrichment was followed by a second amplification step as per the manufacturer’s recommendations.
Results
Retrospective PCR Screening and WGS of Strains From Madagascar and the Comoros
Among the 51 patients included retrospectively in this study, 17 were female and 32 were male (two unknown), ranging from 2 to 75 years in age (Supplementary Table S1). They originated from 14 of the 22 regions in Madagascar and the Comoros; their origins are shown in Figure 1 (Supplementary Table S1). Four patients were considered as recurrent cases, and two samples (first and second episodes) were available for only one patient, 02018. Initially, 30 out of 60 samples showed PCR and/or ZN positivity (Supplementary Table S1), for which DNA was re-extracted using the HD method prior to whole-genome quenching characterization. Among the 30 ZN- and PCR-negative samples re-extracted using total DNA extraction, 17 were positive by RLEP PCR (Supplementary Table S1). A second biopsy was available for 11 of 17 positive samples and DNA was re-extracted using the HD method (Supplementary Table S1). The 13 samples negative for M. leprae by PCR were also negative for M. lepromatosis. Most of the patients with negative PCR and ZN results presented with tuberculoid or paucibacillary leprosy forms, which are characterized by a low amount of bacteria in the skin. Additionally, two negative cases were children and one patient was sampled during a reaction stage. In both cases, the amount of bacteria was also considered low. Finally, one sample was collected for differential diagnosis from a child; the negativity was interpreted as indicating an unrelated disease.
FIGURE 1
All 41 HD-extracted DNA samples were considered for WGS (Supplementary Table S1). Initial screening showed that efficient WGS (coverage > 5) was achieved in all cases for samples with a qPCR Ct < 28, while only two out of six genomes were recovered in samples with a Ct > 28 (Supplementary Table S1). Md09041 was initially positive by PCR following tDNA extraction, but was negative after HD extraction. For this reason, five samples with a Ct > 28 were not prepared for WGS (Supplementary Table S1). One library failed the quality controls after amplification and was not sequenced. All other DNA extracts (n = 35) were sent for library preparation and sequencing (Supplementary Table S2). Three DNA extracts from our 2005 study (
Overall, a total of 33 genomes, from 27 patients (n = 30) from six regions of Madagascar and the Comoros (n = 3), were sequenced with more than 5 × average coverage of non-duplicated reads (Supplementary Tables S2, S6).
Genome-Wide Analysis of M. leprae Strains From Madagascar and the Comoros
Genotyping and Phylogeny
All the sequenced M. leprae strains from Madagascar and the Comoros belonged phylogenetically to branch 1 (Figure 2;
FIGURE 2

Phylogeography of Mycobacterium leprae strains. (A) Maximum parsimony tree of 241 genomes of M. leprae representing the nine branches and the 16 genotypes. Support values were obtained by bootstrapping 500 replicates. Branch lengths are proportional to nucleotide substitutions. The tree is rooted using Mycobacterium lepromatosis. The 1D-Malagasy genotype, discovered in this investigation, is shown in blue. Newly sequenced genomes are shown in red. (B) Zoom into branch 1 (genotypes 1A, 1B, 1D, and the 1D-Malagasy) and 2E of the maximum parsimony tree from (A). The 1D-Malagasy genotype is indicated with the dotted blue line and the strain from Malawi in bold red. (C) Global distribution of the genotypes from the branches 1 and 2E. Genotypes are colored as in (B). Strains from the canonical 1D are found in 12 countries, while the 1D-Malagasy is found only in Madagascar, the Comoros, and Malawi. The arrows indicate possible routes of leprosy introduction into Madagascar and Comoros with the estimated time frame.
Of all the 119 new samples from Madagascar (n = 30; Supplementary Table S1) and 10 other countries (n = 89; Supplementary Table S7) that were either whole-genome-sequenced or PCR-genotyped, the 1D-Malagasy genotype was restricted to Madagascar and the Comoros (30/119). The Malagasy genotype 1D is thus predominant in Madagascar, accounting for 97% of the strains present in 10 of the 14 regions in the country tested (Figure 1).
Aside from the Malagasy samples, 39 new M. leprae strains from eight countries, chosen for their proximity to Madagascar or based on the genotyping results previously obtained (
Dating
The most recent common ancestor (MRCA) of all the M. leprae strains from branch 1 is estimated to be 2,315 years old [95% highest posterior density (HPD) of 1,903–2,798 ya] and was probably derived from a genotype 2 strain (Supplementary Figures S1, S2). The divergence time of the MRCA of the 1D and 1D-Malagasy strains is 2,270 ya (95% HPD = 1,870–2,744 ya). The divergence time of the MRCA of the 1D-Malagasy strains is 1,132 ya, i.e., the ninth century C.E. (95% HPD = 878–1,417 ya), whereas inside the genotype 1A, the two strains from Madagascar seem to have appeared more recently, around the late 17th century (95% HPD = 175–494 ya; median = 322 ya) (Supplementary Figure S2).
Genome-Wide Analysis of the 1D-Malagasy Genotype
From the genome-wide comparison of the 33 new strains from Madagascar and Comoros with 209 other M. leprae genomes, 18 polymorphisms were found only in the Malagasy 1D subtype (Supplementary Table S8), including two missense mutations in protein coding sequences. One occurs in ml0242 (16G > T, Val6Phe), encoding an essential enzyme of the isoprenoid biosynthesis pathway, IspE or 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase. The mutation was predicted to be deleterious for the protein function (PROVEAN score, −4.393). The other mutation was found at the end of ml2446 (1015 A > G, Asn339Asp) encoding lipoprotein Q, LprQ. This mutation was predicted to be neutral (PROVEAN score, −2.163).
Interestingly, in all 1D-Malagasy strains, a single nucleotide insertion affects the stop codon of ml1328 (1581156 G > GT; Ter453fs), coding for the proteasome accessory factor A, PafA. In M. leprae, as in M. tuberculosis, pafA is part of a transcriptional unit with ml1329 (pafB) and ml1330 (pafC) (
Discussion
The African continent is home to multiple M. leprae genotypes, and this study brings additional complexity to the picture. In summary, branch 4 strains seem to be restricted to West Africa, whereas branches 2E, 2F, and 2H are present in East Africa, including Ethiopia (2E, 2F, and 2H) and Malawi (2E) (
The first record of humans in Madagascar is from the beginning of the first millennium with the arrival of Austronesians from the Sunda Islands, ∼4,000 mi. to the East of Madagascar (
Our data suggest that the subtype 1A was introduced into Madagascar and Comoros after East Africa entered the Indian trade route around 800 C.E., or when the East India Company began the slave trade with Madagascar in the 17th century (
There is a strikingly low strain diversity in Madagascar and the Comoros compared to other islands such as New Caledonia or the Antilles (
Statements
Data availability statement
The datasets generated for this study can be found in the NCBI Sequence Read Archive (SRA) under accession number PRJNA592722.
Ethics statement
This study was carried out under the ethical consent of the WHO Global Leprosy Programme surveillance network. All subjects gave written informed consent in accordance with the Declaration of Helsinki.
Author contributions
CA, SC, MR-A, J-LB, and EC designed the study. LR, FRR, BC, AC DD, RN, AA, FS, and AR collected the samples for this study. JS, MM, AG, CS, AA, and VJ collected the samples as part of other ongoing studies. CA, EL, FAR, PS, MT-C, TL-C, and TR performed DNA extraction, molecular screening, and WGS. SB-R and PB, and PS performed PCR sequencing. CA, AB, MR-A, and SC processed the experimental data. CA and AB performed the computational analysis. CA, AB, SC, EL, and EC drafted the manuscript. All authors discussed the results and commented on the manuscript.
Funding
This work was supported by the Fondation Raoul Follereau (SC), the Fondation AnBer (FAR), the Fondation Mérieux Lyon (MR-A), the Swiss National Science Foundation Grants IZRJZ3_164174 (SC) and P2ELP3_184476 (CA), the Heiser Program of the New York Community Trust for Research in Leprosy Grant Nos. P15-000827, P16-000976 and P18-000250 (JS, CS, MM, CA and SC), a Fulbright Scholar to Brazil award 2019–2020 (JS), CNPq fellowships Grant Nos. 428964/2016-8 and 313633/2018-5, CAPES PROAMAZONIA 3288/2013, and Brazil Ministry of Health 035527/2017 (CS), the Association de Chimiothérapie Anti-Infectieuse of the Société Française de Microbiologie, the European Union’s Horizon 2020 Research and Innovation Program under the Marie Skłodowska-Curie Grant No. 845479 (CA), the Q.M. Gastmann-Wichers Foundation (AG) and the R2STOP Research grant from effect:hope Canada and The Mission to End Leprosy, Ireland (AG, PS), and Leprosy Research Initiative Netherlands (PS). The CNR-MyRMA receives an annual grant from Santé Publique France (EL, EC). CA was also supported by a non-stipendiary European Molecular Biology Organization (EMBO) long-term fellowship (ALTF 1086-2018). PS was a recipient of the Ramalingaswami Fellowship from the Department of Biotechnology, Government of India.
Acknowledgments
We are grateful to all the patients and clinical staff who participated in the study. We thank Bastien Mangeat, Elisa Cora, and the team from the Gene Expression Core Facility at the Ecole Polytechnique Fédérale de Lausanne for Illumina sequencing and technical support as well as Emmanuel Baudoing and Johann Weber from the Lausanne Genomic Technologies Facility at Lausanne University. Thanks to Julia Rochard Libois and Christelle Koebel for sending samples to the Centre National de Référence des Mycobactéries et de la résistance des Mycobactéries aux Antituberculeux and Marc Monot for conserving the DNA samples from GMB, Institut Pasteur. We thank the technicians of the CNR-MyRMA. We thank the TLMIB staff (Rural Health Programme) for recruitment and sample collection in Bangladesh and Prof. Mary Jackson for her critical review of the manuscript. The following reagent was obtained through BEI Resources, NIAID, NIH: Genomic DNA from Mycobacterium leprae, Strain Thai-53, NR-19352.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2020.00711/full#supplementary-material
References
1
AvanziC.Del-PozoJ.BenjakA.StevensonK.SimpsonV. R.BussoP.et al (2016). Red squirrels in the British Isles are infected with leprosy bacilli.Science354744–747. 10.1126/science.aah3783
2
BenjakA.AvanziC.SinghP.LoiseauC.GirmaS.BussoP.et al (2018). Phylogenomics and antimicrobial resistance of the leprosy bacillus Mycobacterium leprae.Nat. Commun.9:352. 10.1038/s41467-017-02576-z
3
BurneyD. A.BurneyL. P.GodfreyL. R.JungersW. L.GoodmanS. M.WrightH. T.et al (2004). A chronology for late prehistoric Madagascar.J. Hum. Evol.4725–63. 10.1016/j.jhevol.2004.05.005
4
CambauE.SaundersonP.MatsuokaM.ColeS. T.KaiM.SuffysP.et al (2018). Antimicrobial resistance in leprosy: results of the first prospective open survey conducted by a WHO surveillance network for the period 2009-15.Clin. Microbiol. Infect.241305–1310. 10.1016/j.cmi.2018.02.022
5
ChoiY.ChanA. P. (2015). PROVEAN web server: a tool to predict the functional effect of amino acid substitutions and indels.Bioinform. Oxf. Engl.312745–2747. 10.1093/bioinformatics/btv195
6
CrowtherA.LucasL.HelmR.HortonM.ShiptonC.WrightH. T.et al (2016). Ancient crops provide first archaeological signature of the westward Austronesian expansion.Proc. Natl. Acad. Sci. U.S.A.1136635–6640. 10.1073/pnas.1522714113
7
DewarR. E.WrightH. T. (1993). The culture history of Madagascar.J. World Prehistory7417–466. 10.1007/BF00997802
8
FestaR. A.PearceM. J.DarwinK. H. (2007). Characterization of the Proteasome Accessory Factor (paf) Operon in Mycobacterium tuberculosis.J. Bacteriol.1893044–3050. 10.1128/JB.01597-06
9
GirmaS.AvanziC.BoboshaK.DestaK.IdrissM. H.BussoP.et al (2018). Evaluation of Auramine O staining and conventional PCR for leprosy diagnosis: a comparative cross-sectional study from Ethiopia.PLoS Negl. Trop. Dis.12:e0006706. 10.1371/journal.pntd.0006706
10
HanX. Y.SeoY.-H.SizerK. C.SchoberleT.MayG. S.SpencerJ. S.et al (2008). A new Mycobacterium species causing diffuse lepromatous leprosy.Am. J. Clin. Pathol.130856–864. 10.1309/AJCPP72FJZZRRVMM
11
HaskerE.BacoA.YounoussaA.MzembabaA.GrilloneS.DemeulenaereT.et al (2017). Leprosy on Anjouan (Comoros): persistent hyper-endemicity despite decades of solid control efforts.Lepr. Rev.88334–342.
12
HonapT. P.PfisterL.-A.HousmanG.MillsS.TararaR. P.SuzukiK.et al (2018). Mycobacterium leprae genomes from naturally infected nonhuman primates.PLoS Negl. Trop. Dis.12:e0006190. 10.1371/journal.pntd.0006190
13
Insitute of Medicine (2010). “Migration, mobility and health,” in Infectious Disease Movement in a Bordeless World, Ed.MackA. (Washington, DC: The National Academies Press).
14
KumarS.StecherG.LiM.KnyazC.TamuraK. (2018). MEGA X: molecular evolutionary genetics analysis across computing platforms.Mol. Biol. Evol.351547–1549. 10.1093/molbev/msy096
15
LavaniaM.JadhavR.TurankarR. P.SinghI.NigamA.SenguptaU. (2015). Genotyping of Mycobacterium leprae strains from a region of high endemic leprosy prevalence in India.Infect. Genet. Evol.36256–261. 10.1016/j.meegid.2015.10.001
16
LawlerA. (2014). Sailing Sinbad’s seas.Science3441440–1445. 10.1126/science.344.6191.1440
17
MonotM.HonoréN.GarnierT.AraozR.CoppéeJ.-Y.LacroixC.et al (2005). On the origin of leprosy.Science3081040–1042. 10.1126/science/1109759
18
MonotM.HonoréN.GarnierT.ZidaneN.SherafiD.Paniz-MondolfiA.et al (2009). Comparative genomic and phylogeographic analysis of Mycobacterium leprae.Nat. Genet.411282–1289. 10.1038/ng.477
19
Ortuno-GutierrezN.BacoA.BraetS.YounoussaA.MzembabaA.SalimZ.et al (2019). Clustering of leprosy beyond the household level in a highly endemic setting on the Comoros, an observational study.BMC Infect. Dis.19:501. 10.1186/s12879-019-4116-y
20
PhetsuksiriB.SrisungngamS.RudeeaneksinJ.BunchooS.LukebuaA.WongtrungkapunR.et al (2012). SNP genotypes of Mycobacterium leprae isolates in Thailand and their combination with rpoT and TTC genotyping for analysis of leprosy distribution and transmission.Jpn. J. Infect. Dis.6552–56.
21
PierronD.HeiskeM.RazafindrazakaH.RakotoI.RabetokotanyN.RavololomangaB.et al (2017). Genomic landscape of human diversity across Madagascar.Proc. Natl. Acad. Sci. U.S.A.114E6498–E6506. 10.1073/pnas.1704906114
22
PierronD.RazafindrazakaH.PaganiL.RicautF.-X.AntaoT.CapredonM.et al (2014). Genome-wide evidence of Austronesian–Bantu admixture and cultural reversion in a hunter-gatherer group of Madagascar.Proc. Natl. Acad. Sci. U.S.A.111936–941. 10.1073/pnas.1321860111
23
RaharolahyO.RamarozatovoL. S.RanaivoI. M.SendrasoaF. A.AndrianarisonM.AndrianariveloM. R.et al (2016). A case of fluoroquinolone-resistant leprosy discovered after 9 years of Misdiagnosis.Case Rep. Infect. Dis.2016:4632369. 10.1155/2016/4632369
24
RatsimbaharisonA.EllisS. (2010). Madagascar: A Short History.Chicago, IL: University of Chicago Press.
25
ReibelF.ChauffourA.BrossierF.JarlierV.CambauE.AubryA. (2015). New insights into the geographic distribution of Mycobacterium leprae SNP genotypes determined for isolates from Leprosy cases diagnosed in Metropolitan France and French Territories.PLoS Negl. Trop. Dis.9:e0004141. 10.1371/journal.pntd.0004141
26
RimmerA.PhanH.MathiesonI.IqbalZ.TwiggS. R. F.Wgs500 Consortiumet al (2014). Integrating mapping-, assembly- and haplotype-based approaches for calling variants in clinical sequencing applications.Nat. Genet.46912–918. 10.1038/ng.3036
27
SchuenemannV. J.AvanziC.Krause-KyoraB.SeitzA.HerbigA.InskipS.et al (2018). Ancient genomes reveal a high diversity of Mycobacterium leprae in medieval Europe.PLoS Pathog.14:e1006997. 10.1371/journal.ppat.1006997
28
SchuenemannV. J.SinghP.MendumT. A.Krause-KyoraB.JägerG.BosK. I.et al (2013). Genome-wide comparison of medieval and modern Mycobacterium leprae.Science341179–183. 10.1126/science.1238286
29
SelandE. H. (2013). Networks and social cohesion in ancient Indian Ocean trade: geography, ethnicity, religion.J. Glob. Hist.8373–390. 10.1017/S1740022813000338
30
SinghP.BenjakA.CaratS.KaiM.BussoP.AvanziC.et al (2014). Genome-wide re-sequencing of multidrug-resistant Mycobacterium leprae Airaku-3.Clin. Microbiol. Infect.20O619–O622. 10.1111/1469-0691.12609
31
SinghP.BenjakA.SchuenemannV. J.HerbigA.AvanziC.BussoP.et al (2015). Insight into the evolution and origin of leprosy bacilli from the genome sequence of Mycobacterium lepromatosis.Proc. Natl. Acad. Sci. U.S.A.1124459–4464. 10.1073/pnas.1421504112
32
SuttelsV.LenaertsT. (2016). Epidemiology and spatial exploratory analysis of leprosy in the district of Toliara, Madagascar.Lepr. Rev.87305–313.
33
ThomasJ. H. (2014). Merchants and maritime marauders: the East India compagny and the problem of piracy in the eighteenth century.Gt. Circ.3683–107.
34
Tió-ComaM.AvanziC.VerhardE. M.PierneefL.HooijA.van BenjakA.et al (2020). Detection of new Mycobacterium leprae subtype in Bangladesh by genomic characterization to explore transmission patterns.medRxiv10.1101/2020.03.05.20031450
35
Tió-ComaM.WijnandsT.PierneefL.SchillingA. K.AlamK.RoyJ. C.et al (2019). Detection of Mycobacterium leprae DNA in soil: multiple needles in the haystack.Sci. Rep.9:3165. 10.1038/s41598-019-39746-6
36
TrumanR. W.AndrewsP. K.RobbinsN. Y.AdamsL. B.KrahenbuhlJ. L.GillisT. P. (2008). Enumeration of Mycobacterium leprae Using Real-Time PCR.PLoS Negl. Trop. Dis.2:e328. 10.1371/journal.pntd.0000328
37
VolzE. M.SiveroniI. (2018). Bayesian phylodynamic inference with complex models.PLoS Comput. Biol.14:e1006546. 10.1371/journal.pcbi.1006546
38
WHO SEARO/Department of Control of Neglected Tropical Diseases (2017). A Guide for Surveillance of Antimicrobial Resistance in Leprosy: 2017 Update.
39
WHO (2019). Global Leprosy Update, 2018: Moving Towards a Leprosy- Free World.Geneva: WHO.
40
WoodsS. A.ColeS. T. (1989). A rapid method for the detection of potentially viable Mycobacterium leprae in human biopsies: a novel application of PCR.FEMS Microbiol. Lett.53305–309.
41
YuanS.ChanH. C. S.FilipekS.VogelH. (2016). PyMOL and inkscape bridge the data and the data visualization.Struct. Lond. Engl.19932041–2042. 10.1016/j.str.2016.11.012
Summary
Keywords
leprosy, Mycobacterium leprae, Madagascar, Comoros, genomics, phylogeography
Citation
Avanzi C, Lécorché E, Rakotomalala FA, Benjak A, Rapelanoro Rabenja F, Ramarozatovo LS, Cauchoix B, Rakoto-Andrianarivelo M, Tió-Coma M, Leal-Calvo T, Busso P, Boy-Röttger S, Chauffour A, Rasamoelina T, Andrianarison A, Sendrasoa F, Spencer JS, Singh P, Dashatwar DR, Narang R, Berland J-L, Jarlier V, Salgado CG, Moraes MO, Geluk A, Randrianantoandro A, Cambau E and Cole ST (2020) Population Genomics of Mycobacterium leprae Reveals a New Genotype in Madagascar and the Comoros. Front. Microbiol. 11:711. doi: 10.3389/fmicb.2020.00711
Received
30 December 2019
Accepted
26 March 2020
Published
11 May 2020
Volume
11 - 2020
Edited by
Iain Sutcliffe, Northumbria University, United Kingdom
Reviewed by
Geprge Michael Taylor, University of Surrey, United Kingdom; Susanna J. Sabin, Arizona State University, United States
Updates

Check for updates
Copyright
© 2020 Avanzi, Lécorché, Rakotomalala, Benjak, Rapelanoro Rabenja, Ramarozatovo, Cauchoix, Rakoto-Andrianarivelo, Tió-Coma, Leal-Calvo, Busso, Boy-Röttger, Chauffour, Rasamoelina, Andrianarison, Sendrasoa, Spencer, Singh, Dashatwar, Narang, Berland, Jarlier, Salgado, Moraes, Geluk, Randrianantoandro, Cambau and Cole.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Emmanuelle Cambau, emmanuelle.cambau@aphp.frStewart T. Cole, stewart.cole@pasteur.fr; stewart.cole@epfl.ch
†These authors have contributed equally to this work
‡Present address: Andrej Benjak, Department for BioMedical Research, University of Bern, Bern, Switzerland
This article was submitted to Evolutionary and Genomic Microbiology, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.