Abstract
Marine Group II (MGII) archaea (Poseidoniales) are the most abundant surface marine planktonic archaea and are widely distributed in both coastal and pelagic waters. The factors affecting their distribution and activity are poorly understood. MGII archaea have the metabolic potential to utilize algae-derived organic matter and are frequently observed in high abundance during or following phytoplankton blooms, suggesting that they are key players of the marine food web. In this study, we studied interactions between MGII archaea and the diverse taxa of phytoplankton in the northern coast of South China Sea. Non-metric multidimensional scaling and cluster analyses demonstrated distinct MGII community patterns in the Pearl River plume (PRP) and the open regions of the northern South China Sea (ONSCS), with MGIIb dominating the former and MGIIa and MGIIb showing remarkable variations in the latter for the same sampling season. Nevertheless, positive correlations (Pearson correlation: R > 0.8 and P < 0.01) in absolute abundances of ribosomal RNA (rRNA)-derived complementary DNA and rRNA genes from network analyses were found between MGII archaea and phytoplankton (cyanobacteria, haptophytes, and stramenopiles in both PRP and ONSCS) among different particle size fractions, indicating their intrinsic relationships under changing environmental conditions. The results of this study may shed light on the multiple interactions between co-existing species in the micro-niches of different oceanic regions.
Introduction
Planktonic archaea are one of the fundamental life forms in the ocean and play essential roles in ecological function and biogeochemical cycles. They amount up to ∼1.3 × 1028 cells, in the same order of magnitude as the bacteria in seawater (). The major archaeal group Marine Group II (MGII) is widely distributed in the global ocean (; ; ) and has relatively higher biomass in the surface waters than in the deep waters of the open ocean (; ; ; ; ; ; ). MGII archaea are recently named Candidatus Poseidoniales at the order level, which comprises two major family-level groups, namely, MGIIa (Candidatus Poseidonaceae) and MGIIb [Candidatus Thalassarchaeaceae, previously named as Thalassarchaea ()], each comprising of numerous ecologically and metabolically diverse subclades or genera (; ).
Aquatic phytoplankton is one of the most important co-existing microorganisms with MGII archaea; the latter are presumed to consume the organic substrates released by the former (; ; ). MGII were observed to co-exist with a variety of phytoplankton such as dinophyta, chlorophyta, bacillariophyta, and cyanobacteria in the Pearl River mouth (; ). They were also found to co-occur with green algae (chlorophyta)-Micromonas pusilla and Bathycoccus, haptophyta-Phaeocystis, and cryptophyta-Teleaulax or in a delayed phase with diatom-Chaetoceros and rhaphidophyta-Heterosigma in other coastal waters (; ; ; ). All MGIIa and nearly half of MGIIb genomes possess the archaeal flagella gene operon. It is suggested that flagella are used by these archaea to attach to phytoplankton cells (; ). Chitinase, glycoside hydrolase, and protease expressed by MGII archaea may have the function of cracking high-molecular-weight organic matters such as oligosaccharide agarose or agaropectin from intact phytoplankton biomass (; ; ; ; ; ).
Most of the above-mentioned co-occurrence studies were based on the relative abundances of MGII archaea and phytoplankton. It is unclear how the diverse subgroups of MGII archaea interact with specific phytoplankton types in the coastal waters (; ; ), and thus the potential phytoplankton control on the distribution of MGII archaeal populations in coastal waters is still elusive.
The ribosomal RNA (rRNA) gene has been proven to be effective for characterizing the phylogenetic and taxonomic structure of microbial assemblages, and the rRNA has been widely applied to characterize active microbes in a mixed community (; ). Here, we used phytoplankton 23S rRNA gene primers and newly designed MGII-specific 16S rRNA gene primers to quantify rRNA gene/rRNA-derived complementary DNA (cDNA) abundances of phytoplankton (including both cyanobacteria and chloroplasts of microbial eukaryotes) taxa and MGII archaea subgroups, respectively, in the Pearl River plume (PRP) and the open regions of the northern South China Sea (ONSCS). Quantitative real-time PCR (qPCR) and sequencing were performed on both DNA and RNA samples. Features of the free-living (FL) and the particle-associated (PA) subcommunities were compared. We applied network analysis to explore the potential effect of the phytoplankton population on MGII archaea distribution and niche speciation.
Materials and Methods
Seawater Sample Collection and Physicochemical Analyses
Surface seawater (5 m) sampling and hydrographic profiling (water depth, temperature, and salinity) were conducted in the PRP and ONSCS areas (Figure 1) using a conductivity–temperature–depth (CTD) rosette sampler (model SBE 9-11 Plus; Sea-Bird Electronics, Inc., Bellevue, WA, United States) equipped with 12-L Niskin sample bottles.
FIGURE 1
Around 2–4 L seawater was filtered with a vacuum of at most 100 Mbar through 2.7 μm (Glass Microfiber Membrane, Whatman 1823-047) and then 0.22 μm (Nitrocellulose Membrane, Millipore GSWP04700) pore-sized membrane filters to collect PA and FL microorganisms, respectively. Filters were preserved within 20 min of collection in liquid nitrogen till nucleic acid extraction. Filtrates were transferred into 50 ml centrifuge tubes and preserved at −20°C for nutrient analysis.
The concentration of NH4+ was analyzed by the indophenol blue spectrophotometric method (); the NO3–, NO2–, PO43–, and SiO32– were measured with a four-channel continuous-flow Technicon AutoAnalyzer 3 (AA3; Bran-Lube GmbH, Norderstedt, Germany).
Nucleic Acid Extraction and Complementary DNA Generation
The filtered membranes for simultaneous extraction and purification of DNA and RNA follow the method introduced by using the Fast DNA SPIN Kit for Soil (MP Biomedicals, Solon, OH, United States). Briefly, filtered membranes were cut into pieces to a Lysing Matrix E tube and frozen overnight at −80°C. A sodium phosphate buffer and MT buffer were then applied to lysate cells frozen in the tube. Cellular proteins were removed using a protein precipitation solution. The remaining DNA/RNA were collected using a binding matrix suspension and spin™ filter (total DNA can be diluted with DNase/pyrogen-free water). The filtrate (containing RNA) of spin™ filter was removed and transferred to a new centrifuge tube for further RNA purification. This was done by adding isopropanol and sodium acetate to precipitate RNA from the solution. The RNA precipitant was washed with 70% ethanol and resuspended in 100 μl of RNase-free water for storage ().
The raw RNA was subjected to DNA digestion by Recombinant DNase I (RNase-free, Takara, 2270B) and further purified by using the RNeasy MinElute Cleanup Kit (Qiagen, 74204). The residual DNA in purified RNA was quantified by qPCR analysis with primers Bac331F: TCCTACGGGAGGCAGCAGT and Bac797R: GGACTACCAGGGTATCTAATCCTGTT () and was below the detection limit. cDNA was synthesized by using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, 6210A) with random hexamer primers.
Microbial Ribosomal RNA and Ribosomal RNA Gene Quantification
QPCR analyses were performed on a QuantStudio5 (Thermo Fisher Scientific, Inc., Waltham, MA, United States) by using the QuantStudio5™ Design and Analysis Software v1.5.1. The primers targeting phytoplankton 23S rRNA genes were A23SrVF1: 5′-GGACARAAAGACCCTATG-3′ and A23SrVR1: 5′-AGATCAGCCTGTTATCC-3′ (). The newly designed primers Ar-559F: THTTATTGGGCCTAAAACGTCCG and MGII-771R: TATCTA ATCCGGTTCGTGCCCCT were used to target MGII archaeal 16S rRNA genes (see Supplementary Material). The qPCR reaction volume was 10 μl containing 5 μl of TB Green™ Premix Ex Taq™ II (Takara, PR820A), 0.4 μM of each primer, and 1 μl of template DNA/cDNA. Thermal cycling consisted of initial denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s, annealing at 55°C for 45 s, and extension at 72°C for 60 s. QPCR was conducted in triplicates for each sample. The quantification standard was generated with a series of 10-fold diluted purified plasmid DNA (103–108 copies/μl) with cloned rRNA genes, which were amplified from a collection of the PRP and ONSCS water samples (Figure 1) by using primers A23SrVF1/A23SrVR1 and Ar-559F/MGII-771R, respectively (). The R2 values of the qPCR standard curves were greater than 0.99, and the efficiency was 90–100%. QPCR results were discarded when the melt curves showed an evidence of primer dimers. Finally, we normalized the number of the rRNA (cDNA)/rRNA gene to copies per liter.
Sequencing and Taxonomic Classification
High-throughput amplicon sequencing targeting the phytoplankton 23S rRNA and archaeal 16S rRNA genes was conducted to investigate the proportional changes of phytoplankton taxa and MGII archaea in archaeal communities, respectively. Specifically, a nest-PCR approach using primers A23SrVF1 and A23SrVR1 for the first round and the primers A23SrVF2: 5′-CARAAAGACCCTATGMAGCT-3′ and A23SrVR2: 5′-TCAGCCTGTTATCCCTAG-3′ for the second round (; ) was performed to amplify phytoplankton plastid 23S rRNA genes from both DNA and cDNA samples. Archaeal V4–V5 16S rRNA genes were amplified by using primers 524F10extF: 5′-TGYCAGCCGCCGCGGTAA-3′ and Arch958RmodR: 5′-YCCGGCGTTGAVTCCAATT-3′ (). Sequencing was conducted by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China) according to the standard protocols of the Illumina MiSeq platform.
The raw sequences with average quality scores lower than 20 were filtered, and primer sequences were cut off by using USEARCH11 (). The resulting sequences of 200 bases and longer were dereplicated and denoised by chimera filtering, and zero-radius operational taxonomic units (ZOTUs) were obtained. The taxonomies of representative ZOTUs for the 16S rRNA gene were assigned against the Silva 138.1 database by using the RDP classifier implemented in QIIME v1.9.1 with a bootstrap cutoff of 80% (; ). The ZOTU representatives of the MGII 16S rRNA gene were selected in TBtools () and taxonomically classified by searching against a custom database (Supplementary Table 1) by using BLASTn (similarity > 95% and E-value < 10––5; NCBI-blast-2.10.0+1). Phytoplankton taxonomies as Class/Order names were assigned to the 23S rRNA gene ZOTUs by using BLASTn (similarity > 90% and E < 10–5) against the Silva 138.1 LSU database because the annotation of most 23S rRNA sequences is not accurate enough at the genus level (). The accuracy of taxonomic classification was verified to the neighbor-joining phylogenetic tree in MEGA7 (; Supplementary Figure 2).
Statistical and Ecological Analyses
The ZOTU sequence numbers were normalized to an equal number by subsampling in QIIME for a later statistical and ecological analysis (). The alpha diversity of each sample was calculated by using Mothur-1.35.1 (). Non-metric multidimensional scaling (NMDS) was carried out to delineate community structure differences among samples based on the Bray–Curtis similarity matrix at the ZOTU level. The phytoplankton community structure differences affecting the MGII community was interpreted in the Mantel test based on the Bray–Curtis similarity matrix (Pearson, permutation = 999) at the ZOTU level by using the “vegan” R package ().
The responses of the relative abundance of MGII archaeal and phytoplankton ZOTUs to the PRP and ONSCS areas were further determined using the linear discriminant analysis effect size (LEfSe) method2 with default parameters (). “envfit” was used to compare and interpret the effects of environmental factors on the phytoplankton and MGII compositions with the Monte Carlo permutation test (permutation = 999) by using the “vegan” R package ().
iCAMP analysis was performed to unify niche and neutral perspectives on governing community structure based on MGII ZOTU relative abundances, phylogenetic tree, and environmental factors (). The cluster analysis of phytoplankton and MGII genera proportions was performed by using TBtools ().
The absolute abundances of phytoplankton or MGII genera/ZOTUs were calculated from each genus/ZOTU proportion multiplied by the total qPCR abundances in phytoplankton and MGII, respectively. Outlier tests were analyzed in LOF before doing a regression analysis of the total qPCR abundances (). Pearson correlations in phytoplankton and MGII ZOTUs’ absolute abundances and environmental factors were analyzed in RStudio (). The rRNA/rRNA gene abundances of MGII and phytoplankton were defined as the absolute abundances retrieved from cDNA/DNA.
The top 40 MGII ZOTUs of highest relative abundance and present in over half of the sequencing samples were selected for network analysis. The Pearson correlations (R2 > 0.64 and P < 0.01) of phytoplankton and MGII ZOTUs’ absolute abundances and environmental factors were visualized in Cytoscape 3.2.1 (). The hub ZOTUs of networks were identified based on the degree using CytoHubba ().
Nucleotide Sequence Accession Numbers
The raw reads generated in this project have been deposited at NCBI under the umbrella project number PRJNA748026.
Results
Physicochemical Characteristics
The water depths of the sites ranged from 15 to 86 m in the PRP and ranged from 37 to 200 m in the ONSCS except for two deep ocean sites S21 (1307 m) and S38 (1604 m). The temperature varied from 26.9 to 27.7°C in the PRP surface water and from 27.3 to 30.2°C in the ONSCS surface water (Supplementary Table 5). Except that NH4+ (0.0–1.8 μmol/L) was low in all samples, the concentrations of other nutrients were significantly (unpaired t-test: P < 0.001) higher in the PRP region (NO3–: 1.05–1.44 μmol/L, NO2–: 0.6–1.02 μmol/L, PO43–: 0.04–1.17 μmol/L, and SiO32–: 2.70–6.91 μmol/L) than that in the ONSCS region (NO3–: 0.45–0.87 μmol/L, NO2–: 0.00–0.11 μmol/L, PO43–: 0.00–0.19 μmol/L, and SiO32–: 1.04–4.62 μmol/L) (Supplementary Table 5 and Supplementary Figure 3).
Abundances of Phytoplankton and Marine Group II Archaea Ribosomal RNA Sequences
In all samples, the phytoplankton rRNA gene and rRNA (cDNA) absolute abundances were 0.9–3.0 orders of magnitude higher than those of MGII archaea. Significantly higher abundances of phytoplankton and MGII were associated with the FL fractions than the PA fractions (paired one-tailed t-test: P < 0.01), except for the phytoplankton rRNA gene in the PRP (Supplementary Figure 4 and Supplementary Table 6). Both phytoplankton [one-way analysis of variance (ANOVA): P < 0.01] and MGII rRNA genes in PA fractions (one-way ANOVA: P < 0.01) had significantly higher abundance in the PRP than in the ONSCS, while in FL fractions, similar abundances existed between the two geographical locations. The abundances of both phytoplankton and MGII rRNA were significantly (t-test: P < 0.01) higher than that of the rRNA genes in FL fractions, but no significant difference was found in PA fractions.
Significant positive correlations were found between MGII and phytoplankton abundances in the PA-rRNA, PA-rRNA (cDNA), and FL-rRNA gene samples (P < 0.01, R2 > 0.64; Supplementary Figures 5A–C). The positive relationships between MGII and phytoplankton abundances in FL-RNA gene samples were less obvious, which may be due to the narrow distribution of abundances between the samples for both MGII archaea and phytoplankton (Supplementary Figures 5B,D).
Community Structures and Potential Activities of Phytoplankton and Marine Group II Archaea
High-throughput amplicon sequencing targeting the phytoplankton and archaeal rRNA genes using the Illumina MiSeq platform was conducted to investigate the proportional changes of phytoplankton and MGII in archaeal communities. A total of 1,966,449 high-quality archaeal 16S rRNA sequences from 34 DNA and 28 RNA samples and 532,756 high-quality phytoplankton 23S rRNA sequences from 34 DNA and 33 RNA samples were obtained (Supplementary Tables 7, 8). Coverage estimation suggests that most sequence diversity in samples was captured (>97.8%). No significant differences of the MGII Shannon index were found in PRP-PA, PRP-FL, ONSCS-PA, and ONSCS-FL fractions for both rRNA genes and rRNA (Supplementary Table 8). The NMDS tests were carried out to delineate any ZOTU differences among sequencing samples (Figure 2).
FIGURE 2
The samples of the PRP and ONSCS can be well distinguished based on MGII and phytoplankton ZOTUs compositions. Multiple ZOTUs had similar trends in rRNA gene and rRNA samples, such as Synechococcus-ZOTU2, ZOTU4, Cerataulina-ZOTU9, MGIIb-O1-ZOTU7, -ZOTU14, and MGIIb-O2-ZOTU29, which were more abundant in the PRP than in the ONSCS. Prochlorococcus-ZOTU1, -ZOTU3, -ZOTU22, MGIIa-M-ZOTU11, MGIIb-N1-ZOTU3, and MGIIa-L1-ZOTU4 were more abundant in the ONSCS (Figure 2).
Nutrients (NO3–, NO2–, PO43–, and SiO32–) and temperature may have significantly (P < 0.05) shaped phytoplankton and MGII archaea community structures and potential activities between the PRP and ONSCS samples (Figure 2C). Meanwhile, the Synechococcus-ZOTU2, ZOTU4, Cerataulina-ZOTU9 may have shaped (P < 0.05) MGII archaea community structures and potential activities and the Prochlorococcus-ZOTU1, -ZOTU3, -ZOTU22 may have affected (P < 0.05) MGII archaea potential activities (Figure 2D).
Marine Group II and phytoplankton community structures have similar (Pearson: P < 0.05) changes in the PRP-PA-rRNA, PRP-FL-rRNA, and ONSCS-PA-rRNA genes (Supplementary Figure 6). The positive relationships between MGII and phytoplankton ZOTUs were closer for the PRP-FL-rRNA gene (Pearson: R = 0.90, P < 0.05) than for the PRP-PA-rRNA gene (Pearson: R = 0.72, P < 0.05); and these positive relationships were closer for the ONSCS-PA-rRNA gene (Pearson: R = 0.49, P < 0.05) than for the ONSCS-FL-rRNA gene (Pearson: P > 0.05) (Supplementary Figure 6). MGII and phytoplankton potential activities only had positive relationships in PRP-PA-rRNA (Pearson: R = 0.90, P < 0.05) and PRP-FL-rRNA (Pearson: R = 0.90, P < 0.05) except in the ONSCS (Pearson: P > 0.05) (Supplementary Figure 7).
In the PRP area, cyanobacteria-Synechococcus (average 33.8% in the rRNA gene and 46.7% in rRNA, respectively), diatoms-Cerataulina, and diatoms-Thalassiosira were dominant abundant/activity phytoplankton in PA fractions, and the cyanobacteria-Synechococcus (average 60.6% in the rRNA gene and 66.1% in rRNA, respectively), haptophytes-Chrysochromulina, green algae-Picochlorum, and dinoflagellates-Dinophysis were the main phytoplankton in FL fractions (Figure 3). In the ONSCS area, the cyanobacteria-Prochlorococcus (average 16.5% in the rRNA gene and 28.9% in rRNA, respectively), haptophytes-Chrysochromulina, cyanobacteria-Synechococcus (average 12.1% in the rRNA gene and 16.8% in rRNA, respectively), dinoflagellates-Kryptoperidinium, diatoms-Eunotia, diatoms-Nannochloropsis, and haptophytes-Prymnesium were prevalent phytoplankton in PA fractions, and the cyanobacteria-Prochlorococcus (average 74.2% in the rRNA gene and 75.2% in rRNA, respectively) and cyanobacteria-Synechococcus (average 18.9% in the rRNA gene and 18.7% in rRNA, respectively) were abundant in FL fractions (Figure 3).
FIGURE 3
The main MGII genera in rRNA gene and rRNA fractions were illustrated in Figures 4A,B, respectively; the samples could be divided into the PRP and ONSCS areas based on the proportion of the MGII genus. In the PRP area, MGIIb (-O1, -O3, -O2, and -N1) were the most abundant/activity MGII in PA (average 90.5% in rRNA gene and 92.3% in rRNA, respectively) and FL (average 92.7% in rRNA gene and 94.7% in rRNA, respectively) fractions. In the ONSCS area, the MGIIa (-L1, -M, and -K1) and MGIIb (-N1 and -O3) were prevalent in PA (average 67.8% in the rRNA gene and 51.1% in rRNA, respectively) and FL (average 60.2% in the rRNA gene and 37.2% in rRNA, respectively) fractions.
FIGURE 4
Correlations Between Phytoplankton and Marine Group II Archaeal Zero-Radius Operational Taxonomic Units and Environmental Parameters
To investigate the potential impact of phototrophs on the distributions of those MGII in the PRP and ONSCS areas, the absolute abundance of phytoplankton and MGII ZOTUs fractions were used to build the PRP-PA-rRNA gene, PRP-FL-rRNA gene, ONSCS-PA-rRNA gene, and ONSCS-FL-rRNA gene networks after filtering the low-abundance ZOTUs (R2 > 0.64 and P < 0.01; Figure 5). The rRNA (cDNA) abundance of phytoplankton and MGII ZOTUs were used to build the PRP-PA-rRNA, PRP-FL-rRNA, ONSCS-PA-rRNA, and ONSCS-FL-rRNA networks (R2 > 0.64; P < 0.01; Figure 6).
FIGURE 5
FIGURE 6
In the “PRP-PA-rRNA gene” network, only one negative and three positive relationships were found between three MGII (represented 12.7% of total MGII reads) and two phytoplankton ZOTUs (2.3% of total phytoplankton reads) (Figure 5A). The abundant MGIIb-O3-ZOTU5 constituting 11.4% of total MGII reads was positively correlated with a haptophytes-Chrysochromulina (ZOTU35) and negatively correlated to a haptophyte (ZOTU53) in abundance. In the “PRP-FL-rRNA gene” network, a total of 111 positive relationships were found between 16 MGII ZOTUs (69.4% of total MGII reads) and 12 phytoplankton ZOTUs (18.5% of total phytoplankton reads) (Figure 5B). Both MGIIa and MGIIb ZOTUs were included in this network with diverse cyanobacteria, haptophytes, and stramenopiles. High-proportion MGIIb (65.8% of total MGII reads) and minor MGIIa (3.6% of total MGII reads) ZOTUs had positive relationships with multiple phytoplankton. The most abundant MGII MGIIb-O1-ZOTU7 constituting 30.8% of total MGII reads was positively correlated with four cyanobacteria-Synechococcus ZOTUs, one haptophytes-Chrysochromulina ZOTU, and one haptophytes-Phaeocystis ZOTUs (Figure 5B). There were miscellaneous ZOTUs identified as hubs in the PRP-FL-rRNA gene network (analysis top 10 ZOTUs), which may play important roles and shape the MGII community, including one MGIIa-L1 ZOTU, one MGIIb-N1 ZOTU, two diatoms’ ZOTUs, three haptophytes’ ZOTUs, four cyanobacterial ZOTUs, and one stramenopile’s ZOTU (Figure 5B).
The difference in network complexity was also found in the RNA samples of the PRP area between the FL and the PA fractions (Figure 6A). Specifically, only five positive correlations were found in the PRP-PA-rRNA network, while 120 positive correlations were found in the PRP-FL-rRNA one. Both the PRP-PA-rRNA gene (taking 12.7% of MGII) and PRP-PA-rRNA (taking 2.4% of MGII) networks demonstrated that only low proportions of MGII had positive relationships with phytoplankton (Figures 5A, 6A). While in the PRP-FL-rRNA gene and PRP-FL-rRNA networks, there were high proportions of MGII positively connecting with phytoplankton (cyanobacteria, haptophytes, and stramenopiles). Especially, the abundant MGIIb-O1-ZOTU7 (taking 30.8 and 33.7% of total MGII reads in the PRP-FL-rRNA gene and PRP-FL-rRNA, respectively) was positively connected with diverse phytoplankton in the PRP-FL-rRNA gene network, but it was only positively connected with cyanobacteria-Synechococcus in the PRP-FL-rRNA network (Figures 5B, 6B). There were one MGIIa-M ZOTU, one MGIIb-O1 ZOTU, and eight cyanobacterial ZOTUs identified as hub ZOTUs in the PRP-FL-rRNA network (Figure 6B).
In the “ONSCS-PA-rRNA gene” network, a total of 271 positive relationships were found between 24 MGII ZOTUs (represented 71.4% of total MGII reads) and 18 phytoplankton ZOTUs (27.9% of total phytoplankton reads; Figure 5C). The high proportion of MGIIa (50.9% of total MGII reads) and relatively lower MGIIb (20.5% of total MGII reads) were positively connected with phytoplankton. Cyanobacteria, diatoms, green algae, haptophytes, and stramenopiles had positive relationships with mainly MGIIa ZOTUs MGIIa-L1-ZOTU4 (12.5% of total MGII reads), -L1-ZOTU9 (10.3% of total MGII reads), and -M-ZOTU11 (11.7% of total MGII reads) in this network. In the ONSCS-FL-rRNA gene fraction, a total of 38 positive relationships were found between 17 MGII ZOTUs (represented 27.4% of total MGII reads) and 8 phytoplankton ZOTUs (2.3% of total phytoplankton reads) (Figure 5D). Similar proportions of MGIIa (14.7% of total MGII reads) and MGIIb ZOTUs (12.6% of total MGII reads) were found to have positive relationships with phytoplankton. Four cyanobacterial ZOTUs, two dinoflagellates ZOTUs, one stramenopile’s ZOTU, and one haptophyte’s ZOTU were identified as the top 10 hub ZOTUs in the ONSCS-PA-rRNA gene network (Figure 5C).
Unlike the networks in the PRP area, the ONSCS-PA-rRNA network was more complex than the ONSCS-FL-rRNA network (Figures 6C,D). In the ONSCS-PA-rRNA network (Figure 6C), 11 MGII ZOTUs (70.5% of MGII) and 29 phytoplankton ZOTUs (49.3% of phytoplankton) had 279 positive correlations. Both of MGIIa (taking 28.2% of MGII) and MGIIb (42.3% of MGII) had high proportions that positively correlated with cyanobacteria, diatoms, haptophytes, and stramenopiles, such as the abundant MGIIa-L1-ZOTU4 (12.9% of MGII) and MGIIb-N1-ZOTU7 (34.9% of MGII). In the ONSCS-FL-rRNA network (Figure 6D), 15 MGII ZOTUs (87.8% of MGII) and 16 cyanobacterial ZOTUs (10.7% of phytoplankton) had 35 positive correlations. Compared to MGIIa (13.4% of MGII), the higher active abundance of MGIIb (34.2% of MGII) was positively correlated with phytoplankton. The dominating MGII ZOTU MGIIb-N1-ZOTU3 (28.8% of MGII) and MGIIa-L1-ZOTU4 (11.3% of MGII) had positive relationships with cyanobacteria. Five MGIIa ZOTUs, three MGIIb ZOTUs, one cyanobacterial ZOTU, and one diatom ZOTU were identified as the top 10 hub ZOTUs in the ONSCS-PA-rRNA network (Figure 6C), while three cyanobacterial ZOTUs in the ONSCS-FL-rRNA network was identified as the top 10 hub ZOTUs (Figure 6D).
Discussion
Factors Affecting the Abundance and Activity of Marine Group II Archaea in the Pearl River Plume and Open Regions of the Northern South China Sea Areas
The higher abundances of phytoplankton and MGII in the PRP than in the ONSCS area and the concentrations of nutrients were significantly higher in the PRP than in the ONSCS area, which might result from the high nutrient input from the river and estuary (Supplementary Figures 3, 4; ). Most PRP and ONSCS sites had higher MGII abundance in FL than the PA fraction (Supplementary Figure 4 and Supplementary Table 6, except in S45 and P0 sites), which might be due to the higher abundance of phytoplankton in FL than the PA fraction (Supplementary Figures 4, 5). This is different from the observation that MGII archaea prefer to attach to particles in the estuarine and coastal regions (; ).
The significant positive correlations (Supplementary Figure 5) between the abundance of MGII and phytoplankton in both PA and FL in the PRP and ONSCS surface waters support the notion that phytoplankton may have an important control on the MGII distribution (; ; ). As indicated by many genomic studies (; ; ; ; ; ), MGII archaea have metabolic potentials to attach to phytoplankton and utilize phytoplankton-derived organic matter. However, evidence is lacking that the phytoplankton would have to couple with MGII archaea for their growth.
The potential MGII activity based on RNA analysis has been poorly reported (; ; ). The MGII rRNA had a significantly higher abundance than the rRNA gene in PA and FL fractions (Supplementary Figure 4), indicating that the MGII cells were active. The MGII rRNA abundance was higher in FL than the PA fraction in most waters (Supplementary Table 6), suggesting that MGII tend to live in an FL lifestyle. In particular, the PA MGII have stronger correlations to phytoplankton than the FL MGII in the PRP and ONSCS (Supplementary Figure 5), which may be caused by increased capacity for surface adhesion, transcriptional regulation, and high molecular catabolism in the MGII genomes in PA fraction (). Stronger positive correlations of MGII archaeal and phytoplankton abundances were found in rRNA than in rRNA genes, suggesting that the growth of phytoplankton might stimulate the activity of the heterotrophic MGII archaea (; ).
Dispersal Limitation May Play an Important Role in Surface Marine Group II Assembly
MGIIa and MGIIb were found to partition in different niches and have varying metabolic characteristics, which indicate that the subgroups of MGII may represent distinct ecotypes (; ; ; ; ; ; ). Here, we found that the stochastic processes of dispersal limitation may be the most important factor in MGII community assembly (see Supplementary Material). Dispersal limitation means that the movement of MGII (colonization) in a new location is restricted (). This is revealed in the NMDS and cluster analysis of MGII communities (Figures 2C,D, 4A,B). Samples of the PRP and ONSCS can be well distinguished based on MGII and phytoplankton ZOTUs compositions. Multiple Synechococcus and MGIIb ZOTUs had similar trends in rRNA gene and rRNA samples and were more abundant in the PRP than in the ONSCS, while Prochlorococcus and MGIIa were more abundant in the ONSCS (Figures 2, 3). Synechococcus are much more abundant in nutrient-rich regions than in oligotrophic areas, but Prochlorococcus are the most abundant photosynthetic prokaryotes in the oligotrophic oceans (). Picocyanobacteria are major primary producers in the world’s oceans () and contribute to the marine DOM and particulate organic matter (POM) pool in the surface ocean (; ), indicating that Synechococcus and Prochlorococcus were important speciation drivers of MGII communities in the PRP and ONSCS.
The MGIIb genera are well adapted to environmental conditions in the PRP that is characterized by high concentrations of remineralized DOM from river inputs and phytoplankton bloom (; ; ). Generally, MGIIb MAGs encoded a higher fraction of peptidases and membrane transporters compared to MGIIa () and the MGIIb proportions increased in nutrient-enriched waters during winter (; ). The MGIIa genera (included: -L1, -M, and -K1) represented most of MGII in ONSCS. The MGIIb genera (included: -O1, -O2, and -O3) were the majority of MGII in the PRP (Figures 4A,B), which had relatively higher nutrients than the ONSCS (NO3–, NO2–, PO43–, and SiO32–; Supplementary Table 3), suggesting that MGIIb distribution may respond to high nutrient availability (Figure 2C). MGIIb encode a large number of peptidases and membrane transporters in their genomes, suggestive of the capacity for DOM and POM degradation (; ; ), which may help to maintain their ecological dominancy in the PRP.
Correlations Between Phytoplankton and Marine Group II Archaeal Zero-Radius Operational Taxonomic Units in the Pearl River Plume and Open Regions of the Northern South China Sea Areas
The network analyses were used to explore the potential interactions for phytoplankton and MGII archaea in PA and FL fractions from the near estuarine environment (PRP) to open oceans (ONSCS). An advantage of the absolute phytoplankton and MGII ZOTU abundances is that it may lead to less spurious correlations (; ).
Most of the interactions between phytoplankton and MGII archaea were positive relationships in all networks. This may be caused by the special metabolic potentials of MGII archaea, which can obtain and utilize the phytoplankton-derived organic carbon (; ; ; ; ; ). Similar patterns are found in rRNA genes and rRNA-based networks that the PRP-FL and ONSCS-PA networks were much larger and more complex than the PRP-PA and ONSCS-FL networks (Figures 5, 6). In the DOM/nutrient-rich PRP area (near estuary) (), more positive relationships of MGII and phytoplankton were found in FL than the PA fraction, in which MGII ZOTUs consisted of almost MGIIb, whereas in the DOM/nutrient-poor ONSCS area, more complex positive relationships of MGII and phytoplankton were found in PA than the FL fraction, consisting of over 50% MGIIa ZOTUs in the ONSCS-PA-rRNA gene network (Figure 5). This is coincident with the difference in genome characters that MGIIb genera have a greater capacity for DOM degradation and all MGIIa genera possess the archaeal flagella gene operon playing the function for cell adhesion (). The metabolic characteristic difference of MGII genera makes multiple MGIIb abundant in the nutrient-rich PRP area (Figure 4), and MGIIb tend to have an FL lifestyle that makes the networks in PRP-FL more complex than in the PRP-PA (Figures 5, 6).
The changes in phytoplankton populations and activities might cause the shift of the MGII population and activities between FL and PA fractions (Supplementary Figure 5). The dominant abundant/active phytoplankton were found in cyanobacteria, dinoflagellates, diatoms, green algae, and stramenopiles in the PRP and ONSCS areas (Figure 3). Multiple-hub ZOTUs in haptophytes, cyanobacteria, and stramenopiles indicate that the phytoplankton population was an important factor in the MGII distribution and activity in PRP-FL and ONSCS-PA networks (Figures 5, 6). The cyanobacteria were the only hub phytoplankton in the PRP-FL-rRNA and ONSCS-FL-rRNA networks, but some cyanobacteria with haptophytes consisted of the ONSCS-PA-rRNA network (Figure 6). The phytoplankton such as cyanobacteria and haptophytes can supply organic cofactors/siderophores; DMSP and glycolate (; ; ), which could be utilized by MGII, may influence the MGII communities and activities in the PRP and ONSCS areas.
Some MGII ZOTUs can live in both PA and FL lifestyles, which displayed similar relationships with phytoplankton in the PRP-FL-rRNA gene and ONSCS-PA-rRNA gene networks (Figure 5). For example, the abundant MGII ZOTUs MGIIa-L1-ZOTU4, MGIIa-M-ZOTU11, and MGIIb-N1-ZOTU3 were present in the PRP-FL-rRNA gene and ONSCS-PA-rRNA gene networks, which responded to various phytoplankton ZOTUs in cyanobacteria, haptophytes, and stramenopiles. The MGIIa-M may have the potential to attach to particular organic matter through the presence of archaeal flagellin and a high-affinity cytochrome bd oxidase in surrounding phytoplankton (; ; ). MGIIa-L1 have flagella genes and are increased with the blooms of the diatom at Port Hacking in spring (). The MGIIb-N1 have no flagella genes but have thrombospondin and flotillin genes, which may make them form cell aggregation (). The MGIIa-L1 and MGIIb-N1 genera have the potential to shift between different lifestyles to better utilize phytoplankton-derived organic matters and adapt to the environmental changes, making them widely distributed in the PRP and ONSCS areas.
Although the published genomic data have revealed some unique metabolic potentials of MGII, the physiological and biochemical characteristics of MGII diverse subgroups are still unknown, which need the pure cultures/enrichments to unscramble. The observation of syntrophic interactions within MGII and phytoplankton in the coastal surface water may provide valuable information for future research on this mysterious group of organisms that still resist being brought into pure culture.
Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Author contributions
SC, LF, and CZ developed the idea and designed the study. SC, JT, YC, and WW processed and analyzed the data. SC, LF, and CZ wrote the manuscript. All authors contributed to the article and approved the submitted version.
Funding
This work was financially supported by the National Natural Science Foundation of China (Nos. 91951120, 91851210, and 42141003), the State Key R&D project of China grant (No. 2018YFA0605800), the Shenzhen Key Laboratory of Marine Archaea Geo-Omics, Southern University of Science and Technology (No. ZDSYS201802081843490), the Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou) (No. K19313901), the Project of Educational Commission of Guangdong Province of China (No. 2020KTSCX123), and the Shanghai Sheshan National Geophysical Observatory (No. 2020Z01). Computation in this study was supported by the Centre for Computational Science and Engineering at the Southern University of Science and Technology.
Acknowledgments
We thank Fengfeng Zheng and Bu Xu for their assistant in data analysis, and Shengwei Hou for providing suggestions in improving the manuscript.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2021.785532/full#supplementary-material
References
1
AlderkampA.SintesE.HerndlG. J. (2006). Abundance and activity of major groups of prokaryotic plankton in the coastal North Sea during spring and summer.Aquat. Microb. Ecol.45237–246. 10.3354/ame045237
2
AltschulS. F.GishW.MillerW.MyersE. W.LipmanD. J. (1990). Basic local alignment search tool.J. Mol. Biol.215403–410. 10.1016/S0022-2836(05)80360-2
3
BeierS.RiversA. R.MoranM. A.ObernostererI. (2015). The transcriptional response of prokaryotes to phytoplankton-derived dissolved organic matter in seawater.Environ. Microbiol.173466–3480. 10.1111/1462-2920.12434
4
BerryD.WidderS. (2014). Deciphering microbial interactions and detecting keystone species with co-occurrence networks.Front. Microbiol.5:219. 10.3389/fmicb.2014.00219
5
BlazewiczS. J.BarnardR. L.DalyR. A.FirestoneM. K. (2013). Evaluating rRNA as an indicator of microbial activity in environmental communities: limitations and uses.ISME J.72061–2068. 10.1038/ismej.2013.102
6
BreunigM. M.KriegelH. P.NgR. T.SanderJ. (2000). “LOF: identifying density-based local outliers,” in Proceedings of the 2nd SIGMOD Record (ACM Special Interest Group on Management of Data) (Dallas, TX), 93–104. 10.1145/342009.335388
7
CaporasoJ. G.KuczynskiJ.StombaughJ.BittingerK.BushmanF. D.CostelloE. K.et al (2010). QIIME allows analysis of high-throughput community sequencing data.Nat. Methods7335–336. 10.1038/nmeth.f.303
8
ChenC.ChenH.ZhangY.ThomasH. R.FrankM. H.HeY.et al (2020). TBtools: an integrative toolkit developed for interactive analyses of big biological data.Mol. Plant131194–1202. 10.1016/j.molp.2020.06.009
9
ChenZ.LiY.PanJ. (2004). Distributions of colored dissolved organic matter and dissolved organic carbon in the Pearl River Estuary, China.Cont. Shelf Res.241845–1856. 10.1016/j.csr.2004.06.011
10
ChinC. H.ChenS. H.WuH. H.HoC. W.KoM. T.LinC. Y. (2014). cytoHubba: identifying hub objects and sub-networks from complex interactome.BMC Syst. Biol.8 Suppl 4(Suppl 4):S11. 10.1186/1752-0509-8-S4-S11
11
DaiJ.YeQ.WuY.ZhangM.ZhangJ. (2020). Simulation of enhanced growth of Marine Group II Euryarchaeota from the deep chlorophyll maximum of the Western Pacific Ocean: implication for upwelling impact on microbial functions in the photic zone.Front. Microbiol.11:571199. 10.3389/fmicb.2020.571199
12
DamashekJ.Okotie-OyekanA. O.GiffordS. M.VorobevA.MoranM. A.HollibaughJ. T. (2021). Transcriptional activity differentiates families of Marine Group II Euryarchaeota in the coastal ocean.ISME Commun.1:5. 10.1038/s43705-021-00002-6
13
DixonP. (2003). VEGAN, a package of R functions for community ecology.J. Veg. Sci.14927–930.
14
EdgarR. C. (2010). Search and clustering orders of magnitude faster than BLAST.Bioinformatics262460–2461. 10.1093/bioinformatics/btq461
15
FriedmanJ.AlmE. J. (2012). Inferring correlation networks from genomic survey data.PLoS Comput. Biol.8:e1002687. 10.1371/journal.pcbi.1002687
16
GalandP. E.Gutiérrez-ProvechoC.MassanaR.GasolJ. M.CasamayorE. O. (2010). Inter-annual recurrence of archaeal assemblages in the coastal NW Mediterranean Sea (Blanes Bay Microbial Observatory).Limnol. Oceanogr.552117–2125. 10.4319/lo.2010.55.5.2117
17
GontikakiE.ThorntonB.HuvenneV. A.WitteU. (2013). Negative priming effect on organic matter mineralisation in NE Atlantic slope sediments.PLoS One8:e67722. 10.1371/journal.pone.0067722
18
HeC.PanQ.LiP.XieW.HeD.ZhangC.et al (2020). Molecular composition and spatial distribution of dissolved organic matter (DOM) in the Pearl River Estuary, China.Environ. Chem.17240–251. 10.1071/EN19051
19
HugoniM.TaibN.DebroasD.DomaizonI.Jouan DufournelI.BronnerG.et al (2013). Structure of the rare archaeal biosphere and seasonal dynamics of active ecotypes in surface coastal waters.Proc. Natl. Acad. Sci. U.S.A.1106004–6009. 10.1073/pnas.1216863110
20
IversonV.MorrisR. M.FrazarC. D.BerthiaumeC. T.MoralesR. L.ArmbrustE. V. (2012). Untangling genomes from metagenomes: revealing an uncultured class of marine Euryarchaeota.Science335587–590. 10.1126/science.1212665
21
JiaoN.HerndlG. J.HansellD. A.BennerR.KattnerG.WilhelmS. W.et al (2011). The microbial carbon pump and the oceanic recalcitrant dissolved organic matter pool.Nat. Rev. Microbiol.8593–599. 10.1038/nrmicro2386
22
KarnerM. B.DelongE. F.KarlD. M. (2001). Archaeal dominance in the mesopelagic zone of the Pacific Ocean.Nature409507–510. 10.1038/35054051
23
KumarS.StecherG.TamuraK. (2016). MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets.Mol. Biol. Evol.331870–1874. 10.1093/molbev/msw054
24
LassakK.GhoshA.AlbersS. V. (2012). Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.Res. Microbiol.163630–644. 10.1016/j.resmic.2012.10.024
25
LiW. K. (1994). Primary production of prochlorophytes, cyanobacteria, and eucaryotic ultraphytoplankton: measurements from flow cytometric sorting.Limnol. Oceanogr.39169–175.
26
Lima-MendezG.FaustK.HenryN.DecelleJ.ColinS.CarcilloF.et al (2015). Determinants of community structure in the global plankton interactome.Science3481262073–1262073. 10.1126/science.1262073
27
LincolnS. A.WaiB.EppleyJ. M.ChurchM. J.SummonsR. E.DeLongE. F. (2014). Planktonic Euryarchaeota are a significant source of archaeal tetraether lipids in the ocean.Proc. Natl. Acad. Sci. U.S.A.1119858–9863. 10.1073/pnas.1409439111
28
LiuH.ZhangC. L.YangC.ChenS.CaoZ.ZhangZ.et al (2017). Marine Group II dominates planktonic archaea in water column of the Northeastern South China Sea.Front. Microbiol.8:1098. 10.3389/fmicb.2017.01098
29
MalinG. (2006). OCEANS: new pieces for the marine sulfur cycle jigsaw.Science314607–608. 10.1126/science.1133279
30
Martin-CuadradoA. B.Garcia-HerediaI.MoltóA. G.López-ÚbedaR.KimesN.López-GarcíaP.et al (2015). A new class of marine Euryarchaeota group II from the Mediterranean deep chlorophyll maximum.ISME J.91619–1634. 10.1038/ismej.2014.249
31
MassanaR.DeLongE. F.Pedros-AlioC. (2000). A few cosmopolitan phylotypes dominate planktonic archaeal assemblages in widely different oceanic provinces.Appl. Environ. Microbiol.661777–1787. 10.1128/AEM.66.5.1777-1787.2000
32
MeshcheryakovV. A.WolfM. (2016). Crystal structure of the flagellar accessory protein FlaH of Methanocaldococcus jannaschii suggests a regulatory role in archaeal flagellum assembly.Protein Sci.251147–1155. 10.1002/pro.2932
33
NadkarniM. A.MartinF. E.JacquesN. A.HunterN. (2002). Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set.Microbiology148(Pt 1)257–266.
34
NeedhamD. M.FuhrmanJ. A. (2016). Pronounced daily succession of phytoplankton, archaea and bacteria following a spring bloom.Nat. Microbiol.1:16005. 10.1038/nmicrobiol.2016.5
35
NeedhamD. M.FichotE. B.WangE.BerdjebL.CramJ. A.FichotC. G.et al (2018). Dynamics and interactions of highly resolved marine plankton via automated high-frequency sampling.ISME J.122417–2432. 10.1038/s41396-018-0169-y
36
NingD.YuanM.WuL.ZhangY.GuoX.ZhouX.et al (2020). A quantitative framework reveals ecological drivers of grassland microbial community assembly in response to warming.Nat. Commun.11:4717. 10.1038/s41467-020-18560-z
37
OksanenJ.BlanchetF. G.KindtR.LegendreP.MinchinP. R.O’HaraR. P.et al (2013). Package “vegan.” Community Ecology Package, Version 2. Available online at: https://CRAN.R-project.org/package=vegan(accessed 01 17, 2017).
38
OrellanaL. H.Ben FrancisT.KrügerK.TeelingH.MüllerM. C.FuchsB. M.et al (2019). Niche differentiation among annually recurrent coastal Marine Group II Euryarchaeota.ISME J.133024–3036. 10.1038/s41396-019-0491-z
39
OrsiW. D.SmithJ. M.LiuS.LiuZ.SakamotoC. M.WilkenS.et al (2016). Diverse, uncultivated bacteria and archaea underlying the cycling of dissolved protein in the ocean.ISME J.102158–2173. 10.1038/ismej.2016.20
40
OrsiW. D.SmithJ. M.WilcoxH. M.SwalwellJ. E.CariniP.WordenA. Z.et al (2015). Ecophysiology of uncultivated marine Euryarchaea is linked to particulate organic matter.ISME J.91747–1763. 10.1038/ismej.2014.260
41
PartenskyF.BlanchotJ.VaulotV. (1999). Differential distribution and ecology of Prochlorococcus and Synechococcus in oceanic waters: a review.Bioscience61743–749.
42
PiresA. C. C.ClearyD. F. R.AlmeidaA.CunhaÂDealtryS.Mendonça-HaglerL. C. S.et al (2012). Denaturing gradient gel electrophoresis and barcoded pyrosequencing reveal unprecedented archaeal diversity in mangrove sediment and rhizosphere samples.Appl. Environ. Microbiol.785520–5528. 10.1128/AEM.00386-12
43
QuastC.PruesseE.YilmazP.GerkenJ.SchweerT.YarzaP.et al (2013). The SILVA ribosomal RNA gene database project: improved data processing and web-based tools.Nucleic Acids Res.41D590–D596. 10.1093/nar/gks1219
44
RinkeC.RubinoF.MesserL. F.YoussefN.ParksD. H.ChuvochinaM.et al (2019). A phylogenomic and ecological analysis of the globally abundant Marine Group II archaea (Ca. Poseidoniales ord. nov.).ISME J.13663–675. 10.1038/s41396-018-0282-y
45
RStudio Team (2020). RStudio: Integrated Development Environment for R.Boston, MA: RStudio, PBC.
46
SantoroA. E.RichterR. A.DupontC. L. (2019). Planktonic marine archaea.Ann. Rev. Mar. Sci.11131–158. 10.1146/annurev-marine-121916-063141
47
SchlossP. D.WestcottS. L.RyabinT.HallJ. R.HartmannM.HollisterE. B.et al (2009). Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities.Appl. Environ. Microbiol.757537–7541. 10.1128/AEM.01541-09
48
SegataN.IzardJ.WaldronL.GeversD.MiropolskyL.GarrettW. S.et al (2011). Metagenomic biomarker discovery and explanation.Genome Biol.12:R60. 10.1186/gb-2011-12-6-r60
49
ShannonP.MarkielA.OzierO.BaligaN. S.WangJ. T.RamageD.et al (2003). Cytoscape: a software environment for integrated models of biomolecular interaction networks.Genome Res.132498–2504.
50
SherwoodA. R.PrestingG. G. (2007). Universal primers amplify a 23S rDNA plastid marker in eukaryotic algae and cyanobacteria.J. Phycol.43605–608. 10.1111/j.1529-8817.2007.00341.x
51
SieczkoA.MaschekM.PeduzziP. (2015). Algal extracellular release in river-floodplain dissolved organic matter: response of extracellular enzymatic activity during a post-flood period.Front. Microbiol.6:80. 10.3389/fmicb.2015.00080
52
SimsG. K.EllsworthT. R.MulvaneyR. L. (1995). Microscale determination of inorganic nitrogen in water and soil extracts.Commun. Soil Sci. Plant Anal.26303–316. 10.1080/00103629509369298
53
StoicaE.HerndlG. J. (2007). Contribution of Crenarchaeota and Euryarchaeota to the prokaryotic plankton in the coastal northwestern Black Sea.J. Plankton Res.29699–706. 10.1093/plankt/fbm051
54
TambaloD. D.Del BelK. L.BustardD. E.GreenwoodP. R.SteedmanA. E.HynesM. F. (2010). Regulation of flagellar, motility and chemotaxis genes in Rhizobium leguminosarum by the VisN/R-Rem cascade.Microbiology1561673–1685. 10.1099/mic.0.035386-0
55
TournierE.AmencL.PabloA. L.LegnameE.BlanchartE.PlassardC.et al (2015). Modification of a commercial DNA extraction kit for safe and rapid recovery of DNA and RNA simultaneously from soil, without the use of harmful solvents.MethodsX2182–191. 10.1016/j.mex.2015.03.007
56
TsujiY.YoshidaM. (2017). Biology of Haptophytes: Complicated Cellular Processes Driving the Global Carbon Cycle, 1st Edn. Amsterdam: Elsevier Ltd, 10.1016/bs.abr.2017.07.002
57
TullyB. J. (2019). Metabolic diversity within the globally abundant Marine Group II Euryarchaea offers insight into ecological patterns.Nat. Commun.10:271. 10.1038/s41467-018-07840-4
58
UronenP.KuuppoP.LegrandC.TamminenT. (2007). Allelopathic effects of toxic haptophyte Prymnesium parvum lead to release of dissolved organic carbon and increase in bacterial biomass.Microb. Ecol.54183–193. 10.1007/s00248-006-9188-8
59
WangY.PanJ.YangJ.ZhouZ.PanY.LiM. (2019). Patterns and processes of free-living and particle-associated bacterioplankton and archaeaplankton communities in a subtropical river-bay system in South China.Limnol. Oceanogr.65S161–S179. 10.1002/lno.11314
60
WendebergA.PrestonC.PernthalerJ.DeLongE.AmannR. (2002). Comparison of fluorescently labeled oligonucleotide and polynucleotide probes for the detection of pelagic marine bacteria and archaea.Appl. Environ. Microbiol.68661–667. 10.1128/AEM.68.2.661-667.2002
61
XieW.LuoH.MurugapiranS. K.DodsworthJ. A.ChenS.SunY.et al (2018). Localized high abundance of Marine Group II archaea in the subtropical Pearl River Estuary: implications for their niche adaptation.Environ. Microbiol.20734–754. 10.1111/1462-2920.14004
62
YoonT. H.KangH. E.KangC. K.LeeS. H.AhnD. H.ParkH.et al (2016). Development of a cost-effective metabarcoding strategy for analysis of the marine phytoplankton community.PeerJ4:e2115. 10.7717/peerj.2115
63
ZhangC. L.XieW.Martin-CuadradoA. B.Rodriguez-ValeraF. (2015). Marine Group II archaea, potentially important players in the global ocean carbon cycle.Front. Microbiol.6:1108. 10.3389/fmicb.2015.01108
64
ZhouJ.NingD. (2017). Stochastic community assembly: does it matter in microbial ecology?Microbiol. Mol. Biol. Rev.811–32. 10.1128/mmbr.00002-17
Summary
Keywords
MGII archaea, phytoplankton, South China Sea, coastal surface water, network
Citation
Chen S, Tao J, Chen Y, Wang W, Fan L and Zhang C (2022) Interactions Between Marine Group II Archaea and Phytoplankton Revealed by Population Correlations in the Northern Coast of South China Sea. Front. Microbiol. 12:785532. doi: 10.3389/fmicb.2021.785532
Received
29 September 2021
Accepted
14 December 2021
Published
25 January 2022
Volume
12 - 2021
Edited by
Yuanyuan Feng, Shanghai Jiao Tong University, China
Reviewed by
Peng Xing, Nanjing Institute of Geography and Limnology, Chinese Academy of Sciences (CAS), China; Man-Young Jung, Jeju National University, South Korea
Updates
Copyright
© 2022 Chen, Tao, Chen, Wang, Fan and Zhang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Lu Fan, fanl@sustech.edu.cnChuanlun Zhang, zhangcl@sustech.edu.cn
This article was submitted to Aquatic Microbiology, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.