Abstract
The Epichloƫ genus represents a significant group of above-ground endophytes extensively researched for their potential applications in agriculture and ecology. Additionally, Epichloƫ species synthesize bioactive alkaloids, which generally cause health problems in livestock and have detrimental effects on the performance of insect herbivores. Psathyrostachys lanuginosa serves as a valuable forage grass for livestock owing to its high nutritional value and resilience in adverse environmental conditions. Nevertheless, to date, no reports have documented Epichloƫ as endophytes of P. lanuginosa. In this study, four strains (PF5, PF9, QG2, and QG4) were isolated and identified through morphological, molecular, and phylogenetic analyses as endophytes of P. lanuginosa. Morphological analysis indicated colony characteristics and conidia features consistent with symbiotic Epichloƫ, with no significant differences observed in growth rates or conidia dimensions among the four strains. Phylogenetic analysis confirmed all strains as E. bromicola. Additionally, alkaloid biosynthetic genes were detected, revealing differences in the potential synthesis of peramine and indole diterpenoid alkaloids among strains from different geographic origins. However, all four E. bromicola strains exhibited similar potential for synthesizing ergot alkaloids, but not loline alkaloids. Overall, this study identified P. lanuginosa as a novel host for E. bromicola and provided insights into the alkaloid profiles of these strains, laying a solid foundation for the scientific and rational utilization of Epichloƫ resources.
1 Introduction
The interaction between plants and microorganisms is common in nature and plays a vital role in plant ecology and agriculture (). The endophytic genus EpichloĆ« consists of above-ground filamentous fungal endophytes known for their host specificity. EpichloĆ« primarily infects above-ground plant parts, such as seeds, stems, and sheaths, while it does not grow in the roots (). The grass family Poaceae is the sole documented host of EpichloĆ« to date. Host grasses infected with EpichloĆ« exhibit no discernible disease symptoms and serve as habitats for the endophyteās life cycle (). EpichloĆ« relies on host grasses for nutrients, while in turn, it contributes to the hostās resilience against external stressors. This mutualistic relationship between EpichloĆ« and host grasses underscores its ecological significance. Research on EpichloĆ« species gained scholarly attention in the late 1970s, particularly following findings on the production of alkaloids by EpichloĆ«, which could induce toxic reactions in herbivorous livestock. Subsequent research deepened our understanding of the relationship between EpichloĆ« and its host grasses, revealing the diverse effects of EpichloĆ« on its hosts and ecological roles. Furthermore, EpichloĆ« species have emerged as important agricultural microbial resources (). EpichloĆ« species employ various modes of transmission, including vertical and horizontal transmission. Vertical transmission occurs asexually through the seeds of the mother plant lineage, while horizontal transmission occurs sexually via ascospores. EpichloĆ« species transmitted horizontally may exhibit antagonistic characteristics with their hosts, leading to āchokeā or ācattailā disease (). Some EpichloĆ« species can be facultatively transmitted, utilizing both ascospores and seeds for transmission (; ). However, vertical transmission remains the predominant mode reported for EpichloĆ« species ().
The production of alkaloids by symbiotic Epichloƫ is a significant area of research within the field of endophytic fungi. Alkaloids play a crucial role in deterring herbivorous animals from consuming host grasses. Epichloƫ species can synthesize four types of alkaloids: peramine, ergot alkaloids, indole-diterpenes, and lolines (). These alkaloids exhibit varying degrees of toxicity to insects and livestock, with ergot alkaloids and indole-diterpenes being toxic to both, while peramine and lolines are toxic to insects but safe for livestock (; ; ; Philippe, 2016). Utilizing Epichloƫ for the improvement of plant germplasm has gained traction in recent years. Researchers have identified novel strains of Epichloƫ that impart robust insect resistance without causing harm to livestock. These strains have been introduced into various grasses or crops through artificial inoculation, thereby directly or indirectly assisting host grasses by producing alkaloids and influencing interspecific and intraspecific competition (; ; Li et al., 2014). Vertical transmission is essential for maintaining genetic stability and is a prerequisite for plant breeding (Becker and Leon, 1988). However, challenges such as host specificity limit the success of artificial inoculation with Epichloƫ species (). Psathyrostachys, a small genus within the family Poaceae, commonly known as the grass family, was described by . It includes several species of perennial grasses native to Asia, particularly China and Mongolia. These grasses are valued for their forage qualities and ability to withstand harsh environmental conditions, making them important resources for livestock grazing and soil stabilization in arid and semi-arid regions. So far, eight recognized species of Psathyrostachys, with two subspecies, have been identified, six of which were previously classified under the genera Hordeum and Elymus (; ). Among the species, P. lanuginosa has garnered attention due to its valuable biological characteristics, including early maturity, high quality, and stress resistance (). As aforementioned, Epichloƫ species have been identified as endophytic fungi of various grass plants, particularly those belonging to the family Poaceae. However, to date, Epichloƫ species have not been detected in P. lanuginosa. In the present study, we isolated and identified Epichloƫ strains as endophytes of P. lanuginosa using morphological keys and phylogenetic analysis. Furthermore, we conducted alkaloid profiling of four strains of Epichloƫ. This research contributes to our understanding of Epichloƫ species from a new host, P. lanuginosa, and expands our knowledge of the host diversity of Epichloƫ species.
2 Materials and methods
2.1 Collection of plant samples and isolation of endophytic fungi
Plant samples of P. lanuginosa were collected from Yulin, Shaanxi Province, China (N37°32ā²04ā³, E108°52ā²06ā³; August 2021) and Lanzhou, Gansu Province, China (N36°07ā²10ā³, E103°42ā²05ā³; August 2021). Following collection, the plant samples were promptly transported to the laboratory for microscopic assessment of EpichloĆ« species infection by staining the plant stalks with aniline blue (). Roughly 50% of the seeds obtained from the plant samples were allocated for propagation purposes, while the remaining were designated for the isolation of EpichloĆ« species. To achieve endophyte isolation, the seeds were subjected to surface sterilization using 70% ethanol for 3āmin, followed by treatment with a 5% sodium hypochlorite solution for an equivalent duration. The sterilized seeds were subsequently subjected to a triple wash with sterile water, and their surface moisture was removed by blotting with sterile filter paper. These sterilized seeds were then introduced into PDA media, which was supplemented with 100āμgāmLā1 of ampicillin and 50āμgāmLā1 of streptomycin sulfate. Finally, the PDA plates were wrapped with sealing film and incubated in darkness at a temperature of 22°C. Throughout this period, contaminated seeds were removed, and uncontaminated seeds were monitored until the emergence of endophytic fungi. Finally, four strains: PF5, PF9, QG2, and QG4 were obtained. Among them, strains PF5 and PF9 were isolated from the Psathyrostachys grown in Lanzhou, while strains QG2 and QG4 were isolated from the Psathyrostachys grown in Yulin.
2.2 Morphological examination
The morphological examination of endophytes was conducted on PDA plates. Using a sterile puncher, 0.4ācm diameter mycelial plugs were taken from a 30-day-old colony and placed in the center of the PDA medium. The plates were then sealed with sealing film and cultured at 22°C in the dark for 32ādays. After the incubation period, colony morphology was observed, recorded, and photographed, and a comparison was made to determine if there were any differences in colony morphology between the different strains. Similarly, the growth rate of the strains was measured using 0.4ācm diameter mycelia plug taken from the 30-day-old colonies. Each strain was tested on six replicate plates, which were then placed in the center of the PDA medium and cultured under dark conditions at both 22°C and 25°C, respectively. Weekly measurements of colony diameter were conducted for 8āweeks using the ācrossing methodā. The PDA medium was also used for observing and measuring conidia and the length of conidiogenous cells. After all the strains were cultured for 2 weeks, sterile coverslips were inserted into the PDA medium at a 45° angle, and the PDA plates were sealed with sealing film. Culture continued until the mycelia of strains grew to the surface of the coverslips. The coverslips were then removed, placed on a glass slide with a drop of toluidine blue solution, and examined using an automated upright fluorescence microscope (Olympus, BX63). Measurements of 50 conidia and 30 conidiogenous cells of each isolate were taken, including their width and length.
2.3 Phylogenetic analysis
Purified strains were cultured on PDA medium for 2 weeks, and the mycelium was collected into 2āmL tubes by gently scraping the surface of PDA plates with a sterile glass rod. The total DNA of the endophytic strains was extracted following the manufacturerās instructions using a fungal DNA extraction kit (Omega, Beijing, China). After extraction, the DNA was stored at -20°C until further use. Species identification of the fungal strains was conducted by direct sequencing of the housekeeping genes tefA and tubB using the extracted DNA with the highest concentration. The primer sets tef1-exon 5u-1 (GGCAGCGATAATCAGGATAG) and tef1-exon 1d-1 (GGGTAAGGACGAAAAGACTCA) were employed for tefA (), while tub2-exon 4u-2 (GTTTCGTCCGAGTTCTCGAC) and tub2-exon 1d-1 (GAGAAAATGCGTGAGATTGT) were used for tubB (). PCR reactions were performed in 25āμL volumes, consisting of 12.5āμL 2Ć SanTaq PCR Master Mix, 9.5āμL ddH2O, 1āμL DNA (40āngāμLā1), and 1āμL each of the forward and reverse primers (10āμM). The PCR protocol included an initial denaturation step at 94°C for 5āmin, followed by 34ācycles of denaturation at 94°C for 30ās, annealing at 55°C (tefA) or 45°C (tubB) for 30ās, extension at 72°C for 1āmin, and a final extension at 72°C for 10āmin, with a hold at 4°C. Sequencing of all PCR products was conducted by Shanghai Sangon Biology Engineering Technology and Service Co., Ltd. The obtained sequences were compared against published nucleotide sequences using Blast on the NCBI website to preliminarily determine their classification within the EpichloĆ« genus. Subsequently, the sequences were aligned with other EpichloĆ« species using MAFFT software (v. 7.505) (), and poorly aligned regions were removed with Gblocks v. 0.91b (Katoh and Standley, 2013). Substitutional saturation of the sequences was assessed using DAMBE software (), maximum-likelihood phylogenetic trees (ML) with substitution model TNeā+āG4 were constructed using IQ-tree software (v. 2.2.0) (), with a bootstrap value of 1,000. The EpichloĆ« species names, strain names, hosts, and accession numbers used for the construction of phylogenetic trees are listed in Table 1.
Table 1
| Epichloƫ species | Isolate | Host | tefA | tubB |
|---|---|---|---|---|
| E. amarillans | 906 | Agrostis perennans | AF457506 | ----- |
| ATCC 200744 | Agrostis hiemalis | AF231192 | ----- | |
| E4668 | Agrostis hyemalis | ----- | KF042042 | |
| 273 | Agrostis hiemalis | ----- | AF457466 | |
| E. aotearoae | e899 | Echinopogon ovatus | KP689565 | ----- |
| 829 | Echinopogon ovatus | AF323391 | ----- | |
| E. baconii | 9707 | Agrostis tenuis | KF811547 | KF811579 |
| ATCC76552 | Agrostis stolonifera | AF231193 | ----- | |
| E248 | Agrostis stolonifera | ----- | L06961 | |
| E242 | Agrostis capillaris | ----- | L78279 | |
| E. brachyelytri | ATCC 201560 | Brachyelytrum erectum | ----- | AF250736 |
| ATCC 201561 | Brachyelytrum erectum | ----- | AF062427 | |
| E. bromicola | 9633 | Bromus erectus | AY033359 | ----- |
| Rnj4301 | Elymus kamoji | DQ134034 | ----- | |
| T36 | Elymus tangutorum | MT905328 | ----- | |
| T29 | Elymus tangutorum | MT905321 | ----- | |
| T23 | Elymus tangutorum | MT905315 | ----- | |
| 1511 | Elymus dahuricus | KX219727 | ----- | |
| E7626 | Elymus dahuricus | MF838712 | ----- | |
| XE1-3B | Hordeum bogdanii | MW961392 | ----- | |
| NI_201203 | Elymus excelsus | KJ585717 | ----- | |
| NI_201201 | Elymus excelsus | KJ585716 | ----- | |
| B3 | Hordeum bogdanii | MW961387 | ----- | |
| AL0426/2 | Thinopyrum intermedium | ----- | KP689571 | |
| 303 | Leymus chinensis | ----- | JN819479 | |
| 229 | Leymus chinensis | ----- | JN819478 | |
| E501 | Bromus erectus | ----- | L78289 | |
| 8918/1 | Bromus benekenii | ----- | AY033369 | |
| Rnj4201 | Elymus kamoji | ----- | DQ134039 | |
| 362 | Hordelymus europaeus | ----- | AF457488 | |
| Ebo201558 | Bromus ramosus | ----- | KC936102 | |
| E502 | Bromus erectus | ----- | L78290 | |
| 0814/1 | Agropyron repens | ----- | GU325782 | |
| NI_201216 | Elymus tangutorum | ----- | KJ585739 | |
| NI_201302 | Elymus nutans | ----- | KJ585743 | |
| NI_201209 | Elymus tangutorum | ----- | KJ585735 | |
| 3635 | Hordeum brevisubulatum | ----- | AY137612 | |
| PF5 | Psathyrostachys lanuginosa | OR727355 | PP001830 | |
| PF9 | Psathyrostachys lanuginosa | OR750671 | PP001831 | |
| QG2 | Psathyrostachys lanuginosa | PP001834 | PP001832 | |
| QG4 | Psathyrostachys lanuginosa | PP001835 | PP001833 | |
| E. calamagrostidis | AL9618/1 | Calamagrostis villosa | MW283394 | MW283357 |
| AL0430/1 | Calamagrostis villosa | MW283393 | MW283356 | |
| AL0908 | Calamagrostis purpurea | ----- | MW283355 | |
| E. clarkii | ATCC 200742 | Holcus lanatus | AF231206 | ----- |
| E. elymi | ATCC 201551 | Elymus virginicus | KP689557 | KF042052 |
| ATCC 201553 | Elymus virginicus | AF457498 | ----- | |
| E56 | Elymus canadensis | ----- | L06962 | |
| E. festucae | ATCC90661 | Festuca rubra subsp. rubra | AF231210 | ----- |
| E2368 | Festuca rubra | ----- | KF042044 | |
| F11 | Festuca longifolia | ----- | AY722412 | |
| ATCC 90660 | Festuca rubra subsp. commutata | AF231214 | ----- | |
| E. festucae var. lolii | 135 | Lolium perenne | AF457540 | ----- |
| E. ftanensis | AL1614/1 | Calamagrostis arundinacea | MW283389 | MW283352 |
| AL2015/1 | Calamagrostis arundinacea | MW283391 | MW283354 | |
| AL1614/2 | Calamagrostis arundinacea | ----- | MW283353 | |
| E. glyceriae | ATCC 200747 | Glyceria striata | AF231216 | ----- |
| E277 | Glyceria striata | KP689560 | KF042046 | |
| E2772 | Glyceria striata | ----- | L78276 | |
| E. poae | BlaTG-1 | Bromus laevipes | JX679188 | ----- |
| * | Poa secunda subsp. juncifolia | JQ756452 | ----- | |
| AL0507 | Poa nemoralis | ----- | MW662267 | |
| * | Poa secunda subsp. juncifolia | ----- | JQ756453 | |
| E. scottii | DSM_111775 | Melica uniflora | MZ224336 | ----- |
| DSM_112488 | Melica uniflora | MZ224334 | ----- | |
| E. sinca | Rxy6106 | Elymus kamoji | FJ189478 | ----- |
| E. sinensis | MHLZU-FS57 | Festuca simensis | KX685662 | ----- |
| E. sylvatica | ATCC 200748 | Brachypodium sylvaticum | AF231218 | ----- |
| Brhs6402 | Brachypodium sylvaticum | EU709884 | ----- | |
| E354 | Brachypodium sylvaticum | ----- | L78278 | |
| E503 | Brachypodium sylvaticum | ----- | L78291 | |
| E. typhina | E348 | Phleum pratense | AF231227 | |
| 9636 | Poa trivialis | ----- | KF811578 | |
| POR46 | Lolium perenne | ----- | KY997148 |
Accession numbers for known tefA and tubB genes used for phylogenetic analysis.
*No isolate name was found in the corresponding literature; ----, Not used in this study.
2.4 Alkaloid gene profiling
PCR analysis was conducted to assess the presence of 35 genes associated with the biosynthesis of four major groups of alkaloids in all endophytic strains. Among the 35 genes, one gene is involved in peramine biosynthesis, 14 genes are involved in ergot alkaloid biosynthesis, 11 genes are involved in indole-diterpene biosynthesis, and 11 genes are involved in loline alkaloid biosynthesis. Additionally, the mating-type genes of the strains were also determined using PCR. Details of the 46 pairs of primers used are provided in Supplementary Table S1. PCR amplification was conducted in 25āμL reaction volumes. The protocol included an initial pre-denaturation step at 94°C for 1āmin, followed by 30ācycles of denaturation at 94°C for 15ās, annealing at 56°C for 30ās, and extension at 72°C for 1āmin. A final extension step at 72°C for 10āmin was performed, followed by holding at 4°C. Subsequently, PCR products were analyzed by 1.5% agarose gel electrophoresis to determine the presence of the target genes in the strains.
3 Results
3.1 Characteristics of endophytes from Psathyrostachys lanuginosa
A total of four endophytic fungal strains were recovered from surface-sterilized P. lanuginosa samples infected by EpichloĆ«. Strains PF5 and PF9 were obtained from P. lanuginosa in Lanzhou, while strains QG2 and QG4 originated from P. lanuginosa in Yulin. Although all strains exhibited typical traits of EpichloĆ« endophytic fungi, slight variations were observed. Overall, the colonies of the four endophytic fungi appeared white on the front with sparse outer aerial hyphae. The central region of the colonies was yellowish, gradually fading toward the edges. However, the colony edge of isolate QG2 was irregular compared to the other three strains, isolate PF5 had a slightly tougher colony texture, and isolate QG4 displayed an obvious growth circle (Figure 1). The colonies exhibited moderate growth rates on PDA at 22°C/25°C, reaching diameters of 11.29ā15.97/16.96ā19.89āmm (14ādays), 20.65ā29.40/31.26ā44.98āmm (28ādays), 26.45ā43.31/51.75ā61.78āmm (42ādays), and 30.74ā54.26/54.99ā65.15āmm (56ādays). Conidia shapes were predominantly oval and asymmetrical, with an average size of 3.5ā3.9āĆā1.8ā1.9āμm, and an average length of the conidiogenous cell of 10.2ā11.3āμm (Table 2). There were no significant differences observed in growth rate, length of conidiogenous cells, and conidia size among the four strains studied. The morphological characteristics of the other E. bromicola strains listed in Table 2 included a growth rate ranging from 0.88 to 1.29āmmādayā1, length of conidiogenous cells ranging from 8 to 29āμm, length of conidia ranging from 3.7 to 5.3āμm, and width of conidia ranging from 1.8 to 3.5āμm (Table 2). When compared to previously reported E. bromicola endophytes, the morphological features (growth rate, length of conidiogenous cells, and conidia size) of the four strains examined in this study were slightly smaller but still fell within the normal range.
Figure 1
Table 2
| Isolate | Host | Growth on PDA (mm/day) | Length of conidiogenous cell (μm) | Conidia Size (μm) | References | |
|---|---|---|---|---|---|---|
| Length | Width | |||||
| PF9 | Psathyrostachys lanuginosa | 1.23 ± 0.05a (25°C) | 12.3 ± 0.57a | 3.6 ± 0.07a | 1.8 ± 0.04a | This study |
| PF5 | 1.33 ± 0.04a (25°C) | 11.2 ± 0.53a | 3.9 ± 0.06a | 1.8 ± 0.03a | This study | |
| QG2 | 1.02 ± 0.09ab (25°C) | 10.9 ± 0.50a | 3.5 ± 0.07a | 1.8 ± 0.04a | This study | |
| QG4 | 1.17 ± 0.02a (25°C) | 10.2 ± 0.63a | 3.7 ± 0.09a | 1.9 ± 0.06a | This study | |
| Leymus chinensis | 1.7 ± 0.07 (25°C) | 29.0ā31.0 | 5.3 ± 0.1 | 3.5 ± 0.1 | ||
| E. bromicola | Bromus erectum | 2.29ā2.48 (24°C) | 8ā23 | 3.8 ± 0.4 | 2.0 ± 0.3 | |
| Bromus ramosus | 0.90 (24°C) | nt | 4.2 ± 0.5 | 2.0 ± 0.3 | ||
| Bromus ramosus | nt | nt | 3.7ā4.8 | 1.8ā2.3 | ||
| Hordeum bogdanii | 1.21 ± 0.1 | 14.0 ± 3.5 | 4.6 ± 0.4 | 2.7 ± 0.3 | ||
| Hordeum bogdanii | 0.99 ± 0.1 | 19.5 ± 5.7 | 5.0 ± 0.5 | 2.7 ± 0.3 | ||
| Hordeum brevisubulatum | 0.88 ± 0.01 (25°C) | 19.50 ± 1.06 | 5.17 ± 0.06 | 2.87 ± 0.17 | Chen et al. (2019) | |
| Hordelymus europaeus | 1.43ā1.67 (24°C) | 20.2 ± 4.7 | 4.2 ± 0.4 | 2.1 ± 0.2 | ||
Morphological characteristics of Epichloƫ bromicola endophytes.
The same lowercase letter indicates no significant difference (pā>ā0.05), and different lowercase letters indicate significant differences (pā<ā0.05); nt, not tested.
3.2 Phylogenetic relationships
The amplified PCR products yielded single peaks in the sequencing results, indicating that the four strains belong to non-hybrid species. This classification was further reinforced by the construction of maximum likelihood phylogenetic trees using tefA and tubB gene sequences. Specifically, strains PF5 and PF9 exhibited taxonomic congruence with strains QG2 and QG4. Phylogenetic analysis, employing 42 tefA gene sequences, revealed that all four strains formed a distinct clade with E. bromicola, supported by a bootstrap value of 96% (Figure 2). Similarly, in the phylogenetic analysis based on 43 tubB gene sequences, all strains grouped together with E. bromicola, with a bootstrap value of 98% (Figure 3). Thus, our investigation confirms the identification of the endophytic strains infecting P. lanuginosa as E. bromicola.
Figure 2
Figure 3
3.3 Alkaloid gene profiling
All four strains exhibited differences in alkaloid synthesis genes and mating-type genes, reflecting variations in alkaloid production among the four strains as shown in Table 3. While the synthesis genes for ergot and loline alkaloids were consistent across all strains, disparities were observed in the synthesis genes of peramine and indole-diterpene alkaloids (Table 3). Notably, all four strains exclusively contained the lolC gene within the genes responsible for loline alkaloid synthesis, suggesting a potential deficiency in synthesizing loline alkaloids. Among the 14 genes implicated in ergot alkaloid synthesis, all four strains possessed genes dmaW, easF, easE, easC, easD, easA, easG, cloA, lpsA, lpsB, and easH, while lacking genes lpsC, easO, and easP, which encode enzymes for a separate branch to ergonovine, lysergic acid alpha-hydroxylamide, and to ergine. Consequently, the four strains demonstrated potential for synthesizing chanolavine I (CC), D-lysergic acid, and ergovaline (ERV), albeit lacking the potential for synthesizing ergonovine (EN) or lysergic acid α-hydroxyethylamide (LAH). Within the eight domain structures of the peramine synthetase-encoding gene, ppzA (formly perA), all four strains harbored six domains, including ppzAāA1, ppzAāT1, ppzAāC, ppzAāA2, ppzAāM, and ppzAāT2. However, strains PF5 and PF9 possessed the ppzAāR domain (representing allele ppzA-1), while strains QG2 and QG4 harbored the ppzAāĪR domain (representing allele ppzA-2) in reverse. ppzA-āR means ppzA from which the R-domain was deleted, the implication of the deletion is that the final enzymatic step from the diketopiperazine to peramine is missing in the āR versions, such that pyrrolopyrazine-1,4-diones are produced instead of peramine. Recent studies have indicated its capacity to encode different metabolites and confer protective effects on the host (). Regarding the 11 genes within the IDT/LTM clusters, strains PF5 and PF9 contained nine of them, including idtG, idtB, idtM, idtC, idtS, idtP, idtO, idtF, and idtK, suggesting their potential to synthesize paspaline, terpendole I, paxilline (PAX), and terpendole K (TDK), but not lolitrem B (LTM) theoretically. Conversely, strains QG2 and QG4 only possessed three genes (idtM, idtS, and idtK) related to indole-diterpene synthesis, probably rendering them incapable of synthesizing any type of indole-diterpene alkaloids due to the absence of the pivotal gene idtG in the IDT/LTM cluster.
Table 3
| Gene | PF5 | PF9 | QG2 | QG4 | |
|---|---|---|---|---|---|
| Segments of ppzA Gene | ppzAāA1 | + | + | + | + |
| ppzAāT1 | + | + | + | + | |
| ppzAāC | + | + | + | + | |
| ppzAāA2 | + | + | + | + | |
| ppzAāM | + | + | + | + | |
| ppzAāT2 | + | + | + | + | |
| ppzAāR | ā | ā | + | + | |
| ppzAāĪR | + | + | ā | ā | |
| Loline (LOL) Genes | lolC | + | + | + | + |
| lolF | ā | ā | ā | ā | |
| lolD | ā | ā | ā | ā | |
| lolT | ā | ā | ā | ā | |
| lolA | ā | ā | ā | ā | |
| lolU | ā | ā | ā | ā | |
| lolO | ā | ā | ā | ā | |
| lolE | ā | ā | ā | ā | |
| lolN | ā | ā | ā | ā | |
| lolM | ā | ā | ā | ā | |
| lolP | ā | ā | ā | ā | |
| Ergot Alkaloid (EAS) Genes | dmaW | + | + | + | + |
| easF | + | + | + | + | |
| easE | + | + | + | + | |
| easC | + | + | + | + | |
| easD | + | + | + | + | |
| easA | + | + | + | + | |
| easG | + | + | + | + | |
| cloA | + | + | + | + | |
| lpsA | + | + | + | + | |
| lpsB | + | + | + | + | |
| easH | + | + | + | + | |
| lpsC | ā | ā | ā | ā | |
| easO | ā | ā | ā | ā | |
| easP | ā | ā | ā | ā | |
| IndoleāDiterpene (IDT/LTM) Genes | idtG | + | + | ā | ā |
| idtB | + | + | ā | ā | |
| idtM | + | + | + | + | |
| idtC | + | + | ā | ā | |
| idtS | + | + | + | + | |
| idtP | + | + | ā | ā | |
| idtQ | + | + | ā | ā | |
| idtF | + | + | ā | ā | |
| idtK | + | + | + | + | |
| idtE | ā | ā | ā | ā | |
| idtJ | ā | ā | ā | ā | |
| MatingāType Genes | mtAC | + | + | ā | ā |
| mtBA | ā | ā | + | + | |
Profiling of alkaloid genes to determine alkaloid chemotypes.
4 Discussion
In this study, we identified P. lanuginosa as a previously unreported host of Epichloƫ species, Four endophytic fungal strains of Epichloƫ were isolated from P. lanuginose from two distinct geographical locations, i.e., Yulin, Shaanxi Province and Lanzhou, Gansu Province, China. Morphological and phylogenetic analyses based on tefA and tubB sequences confirmed the taxonomic status of these four strains as E. bromicola. Furthermore, we elucidated the presence of alkaloid synthesis genes within these four E. bromicola strains. Epichloƫ bromicola exhibits a broad host range within the Poaceae family. Previous studies have identified this endophytic fungus in various grass species, including Hordeum (Iannone et al., 2015; ; Chen et al., 2019), Leymus (), Elymus (; ; ), Bromus (; ), and Agropyron (). In a study by , E. bromicola isolated from E. dahuricus revealed that all but one isolate out of 10 belonged to mating type A (MTA). Phylogenetic analysis of seven strains using tefA and tubB showed that six grouped together, while the seventh, the only mating type B (MTB) strain, grouped with those from E. kamoji, known to be sexual (). conducted a study where they isolated eight strains of E. bromicola from E. kamoji native to China. Among these strains, two were classified as MTA, while the remaining six were categorized as MTB. Similarly, analyzed E. bromicola from six different seed accessions, all of which were MTA. Furthermore, Chen et al. (2019) found that three E. bromicola isolates that were symbiotic with H. brevisubulatum, and all were MTA. These studies collectively suggest that mating type diversity is extremely low in E. dahuricus, H. bogdanii, and H. brevisubulata. In the current research, we found two MTA and two MTB isolates from P. lanuginosa. This discovery suggests the presence of a sexual population in P. lanuginosa. However, stromata were not observed on this host under natural conditions. This novel endophyte-grass combination raises questions about the widespread occurrence of this association and warrants further investigation. In some species with sexual Epichloƫ, stromata rarely form, and even if sexual reproduction is infrequent, it may still play a significant role in endophyte diversification.
Significant variation in alkaloid biosynthetic potential among E. bromicola isolates from different or the same hosts has been observed in previous studies (; Chen et al., 2019). This phenomenon was further supported in our study. We investigated the alkaloid biosynthesis gene profiles of four E. bromicola strains (PF5, PF9, QG2, QG4). All strains lacked genes necessary for loline alkaloid synthesis but possessed the potential to produce ergot and peramine alkaloids. Genetic polymorphisms within the ppzA gene results in differential peramine vs. pyrrolopyrazine-1,4-diones production among the strains (). Furthermore, PF5 and PF9 harbored genes potentially involved in indole-diterpene alkaloid biosynthesis, absent in QG2 and QG4 strains. The QG2 and QG4 strains lacked idtG required for paspaline production, suggesting limitations in synthesizing any type of indole-diterpene alkaloids. Similar observations were reported for E. bromicola isolated from Elymus dahuricus, highlighting remarkable intraspecific diversity within E. bromicola regarding its alkaloid biosynthetic potential (). This diversity appears to be influenced by both host plant species and genetic polymorphisms within the fungal population.
The genus Psathyrostachys, a perennial member of the Triticeae tribe, has primarily been investigated in the context of agricultural applications. Unlike common wheat (Triticum aestivum) with its A, B, and D genomes, or other Triticeae members with I, H, R, St, P, E, and W genomes, the entire Psathyrostachys genus possesses a distinct Ns genome (). This unique genetic makeup offers a valuable resource for the improvement of common wheat due to the presence of beneficial traits and genes (; ). For example, P. huashanica, is an endemic species found in Chinaās Qinling Mountains, exemplifies the potential of this genus. This species exhibits cold, drought, and barren tolerance, early maturity, high grain quality, and resistance to stripe rust, take-all, and scab (; ; ). These characteristics position it as a significant source of novel genetic diversity within Triticeae. Furthermore, distant hybridization techniques have enabled the successful transfer of superior high-molecular-weight (HMW) gliadin genes from the Psathyrostachys Ns genome into common wheat (). These findings underline the agricultural importance of Psathyrostachys, independent of its potential as a microbial resource. The present study unveils a novel symbiotic association between P. lanuginosa and E. bromicola, a finding with significant implications. While EpichloĆ« symbioses typically confer benefits to host grasses, no prior reports documented such interactions within Psathyrostachys (). The combination of Psathyrostachys, known for its exceptional traits, with an symbiotic EpichloĆ« raises the possibility of further enhanced performance, considering the well-documented benefits provided by EpichloĆ« symbioses in other grasses (). However, the absence of previous research on Psathyrostachys-EpichloĆ« interactions and the exclusion of growth and stress resistance evaluations in this study necessitate further investigation.
The study of EpichloĆ« species in grasses has emerged as a significant discipline in research history. Our understanding of EpichloĆ« species has evolved considerably over time, transitioning from early incidences of livestock poisoning to contemporary insights gained from diverse perspectives (). As our comprehension of EpichloĆ« species continues to advance, it also presents an increasing array of challenges. The utilization of EpichloĆ« species in plant breeding has been progressively adopted due to their host stress resistance traits and the detectability and facile screening of alkaloids synthesized by these endophytes. One strategy involves the inoculation of EpichloĆ« species that do not synthesize harmful alkaloids into other grass species, thereby generating novel germplasm with desirable attributes (). However, practical outcomes are often suboptimal. Firstly, the success rate of EpichloĆ« species inoculation is limited by their host specificity. This is influenced by factors such as inoculation technique, plant genotype, and EpichloĆ« strains, necessitating ongoing optimization and adjustment of inoculation methods (). Secondly, some materials successfully inoculated with EpichloĆ« species may exhibit poor performance, such as severe stunting (). Nonetheless, itās noteworthy that while some materials artificially inoculated with EpichloĆ« have demonstrated successful performance, there exists a potential barrier to transmission across generations due to incompatibility between certain EpichloĆ« species and specific grasses. Although the underlying mechanisms are not fully understood, this underscores the importance of exploring the compatibility of EpichloĆ« species with different grasses in future endeavors. Importantly, numerous successful cases demonstrate the utility of EpichloĆ« species in plant germplasm innovation. For instance, researchers have utilized renowned EpichloĆ« strains AR1, AR37, and NEA2 to cultivate numerous commercially viable grass cultivars, accounting for more than 70% of proprietary seed sales in New Zealand a decade ago (). Experimental manipulation of EpichloĆ« species through fungal culture and inoculation suggests that the degree of genetic similarity between native and novel host plants positively correlates with the likelihood of establishing a mutually beneficial symbiotic relationship (Simpson and Mace, 2012). To date, no reports have been found of EpichloĆ« species infecting cereal crops naturally. Given the significance of cereal crops, there is a growing interest in exploring EpichloĆ« species as a means to expedite the cultivation of novel cereal crop varieties with exceptional traits (). Several researchers have investigated the artificial inoculation of E. bromicola strains in cultivated barley, reporting notable successes such as enhancements in aboveground biomass, seed yield per plant, and growth period advancements. The E. bromicola strain utilized in these studies was isolated from wild barley and exhibited close genetic relatedness to cultivated barley (). Therefore, it is imperative to explore EpichloĆ« species in wild-related species of cultivated plants. The EpichloĆ« strains analyzed in this research were isolated from Psathyrostachys, a taxonomically related species to wheat. However, further experimentation is required to evaluate their alkaloid-producing capabilities in plants for potential application in artificial inoculation studies, which will be the primary focus of our forthcoming research.
5 Conclusion and future perspectives
In conclusion, we have identified P. lanuginosa as a previously unreported host of four endophytic fungal strains of Epichloƫ from two distinct geographical locations in China. Morphological and phylogenetic analyses confirmed the taxonomic status of these strains as E. bromicola, elucidating the presence of alkaloid synthesis genes within them. Epichloƫ bromicola exhibits a broad host range within the Poaceae family, with significant variation observed in alkaloid biosynthetic potential across different host species. Our investigation into the alkaloid biosynthesis gene profiles of four E. bromicola strains revealed variations in the presence of genes associated with alkaloid synthesis, suggesting intraspecific diversity influenced by both host plant species and genetic polymorphisms within the fungal population. Additionally, we underscore the agricultural significance of Psathyrostachys genus, highlighting its potential for genetic improvement of common wheat and its exceptional traits. The revelation of a novel symbiotic association between P. lanuginosa and E. bromicola prompts further exploration into the potential benefits of this interaction, emphasizing the need for future research to elucidate its implications for host grass performance. While challenges remain in optimizing Epichloƫ species inoculation and understanding the mechanisms underlying host compatibility, successful applications in plant breeding underscore the utility of these endophytes in generating novel germplasm with desirable attributes. As we continue to explore the diversity and applications of Epichloƫ species, further investigations into their interactions with different grass species and their potential for enhancing cereal crop varieties are warranted, with a particular focus on evaluating the alkaloid-producing capabilities of Epichloƫ strains isolated from wild-related species of cultivated plants. This comprehensive approach will advance our understanding of Epichloƫ biology and its agricultural applications, paving the way for the development of improved crop varieties with enhanced resilience and productivity.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary material.
Author contributions
TC: Funding acquisition, Investigation, Methodology, Writing ā original draft, Writing ā review & editing. TW: Methodology, Software, Writing ā review & editing. MD: Investigation, Writing ā review & editing. KM: Formal analysis, Investigation, Writing ā review & editing. CL: Funding acquisition, Project administration, Resources, Supervision, Writing ā review & editing. GB: Funding acquisition, Resources, Supervision, Writing ā review & editing.
Funding
The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This work was financially supported by the National Science Foundation of China (U21A20239 and 32001396), the Open Project of State Key Laboratory of Plateau Ecology and Agriculture, Qinghai University (2022-KF-02), the Science and Technology Planning Project of Gansu Province, China (Natural Science Foundation) (22JR5RA458), and Gansu Provincial Science and Technology Major Projects (22ZD6NA007).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisherās note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2024.1383923/full#supplementary-material
References
1
BaconC. W.PorterJ. K.RobbinsJ. D.LuttrellE. S. (1977). EpichloĆ« typhina from toxic tall fescue grasses. Appl. Environ. Microbiol.34, 576ā581. doi: 10.1128/aem.34.5.576-581.1977
2
BadenC. (1991). A taxonomic revision of Psathyrostachys (Poaceae). Nord. J. Bot.11, 3ā26. doi: 10.1111/j.1756-1051.1991.tb01790.x
3
BadenC.VonbothmerR.FlinkJ.JacobsenN. (1989). Intergeneric hybridization between Psathyrostachys and Hordeum. Nord. J. Bot.9, 333ā342. doi: 10.1111/j.1756-1051.1989.tb01008.x
4
BeckerY.GreenK. A.ScottB.BeckerM. (2018). Artificial inoculation of Epichloƫ festucae into Lolium perenne, and visualization of endophytic and epiphyllous fungal growth. Bioprotocol.8:2990. doi: 10.21769/BioProtoc.2990
5
BeckerH.LeonJ. (1988). Stability analysis in plant breeding. Plant Breed.101, 1ā23. doi: 10.1111/j.1439-0523.1988.tb00261.x
6
BerryD.MaceW.GrageK.WescheF.GoreS.SchardlC. L.et al. (2019). Efficient nonenzymatic cyclization and domain shuffling drive pyrrolopyrazine diversity from truncated variants of a fungal NRPS. PNAS116, 25614ā25623. doi: 10.1073/pnas.1913080116
7
BremD.LeuchtmannA. (2003). Molecular evidence for host-adapted races of the fungal endophyte EpichloĆ« bromicola after presumed host shifts. Evolution57, 37ā51. doi: 10.1554/0014-3820(2003)057[0037,MEFHAR]2.0.CO;2
8
BushL. P.WilkinsonH. H.SchardlC. L. (1997). Bioprotective alkaloids of grass-fungal endophyte symbioses. Plant Physiol.114, 1ā7. doi: 10.1104/pp.114.1.1
9
CaoZ. J.DengZ. Y.WangM. N.WangX. P.JingJ. X.ZhangX. Q.et al. (2008). Inheritance and molecular mapping of an alien stripe-rust resistance gene from a wheat-Psathyrostachys huashanica translocation line. Plant Sci.174, 544ā549. doi: 10.1016/j.plantsci.2008.02.007
10
CaradusJ.LovattS.BelgraveB. (2013). Adoption of forage technologies. In: Proceedings of the New Zealand Grassland Association. 39ā44.
11
ChenL.LiX. Z.LiC. J.SwobodaG. A.YoungC. A.SugawaraK.et al. (2015). Two distinct EpichloĆ« species symbiotic with Achnatherum inebrians, drunken horse grass. Mycologia107, 863ā873. doi: 10.3852/15-019
12
ChenT. X.SimpsonW. R.SongQ. Y.ChenS. H.LiC. J.AhmadR. Z. (2019). Identification of EpichloĆ« endophytes associated with wild barley (Hordeum brevisubulatum) and characterisation of their alkaloid biosynthesis. N. Z. J. Agric. Res.62, 131ā149. doi: 10.1080/00288233.2018.1461658
13
ChristensenM. J.BennettR. J.AnsariH. A.KogaH.JohnsonR. D.BryanG. T.et al. (2008). EpichloĆ« endophytes grow by intercalary hyphal extension in elongating grass leaves. Fungal Genet. Biol.45, 84ā93. doi: 10.1016/j.fgb.2007.07.013
14
ClayK.HolahJ. (1999). Fungal endophyte symbiosis and plant diversity in successional fields. Science285, 1742ā1744. doi: 10.1126/science.285.5434.1742
15
DereeperA.GuignonV.BlancG.AudicS.BuffetS.ChevenetF.et al. (2008). Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res.36, W465āW469. doi: 10.1093/nar/gkn180
16
DuW. L.WangJ.LuM.SunS. G.ChenX. H.ZhaoJ. X.et al. (2014). Characterization of a wheat-Psathyrostachys huashanica Keng 4Ns disomic addition line for enhanced tiller numbers and stripe rust resistance. Planta239, 97ā105. doi: 10.1007/s00425-013-1957-2
17
GroppeK.SteingerT.SandersI.SchmidB.WiemkenA.BollerT. (1999). Interaction between the endophytic fungus EpichloĆ« bromicola and the grass Bromus erectus: effects of endophyte infection, fungal concentration and environment on grass growth and flowering. Mol. Ecol.8, 1827ā1835. doi: 10.1046/j.1365-294x.1999.00772.x
18
GuerreP. (2015). Ergot alkaloids produced by endophytic fungi of the genus EpichloĆ«. Toxins.7, 773ā790. doi: 10.3390/toxins7030773
19
GundelP. E.RudgersJ. A.WhitneyK. D. (2017). Vertically transmitted symbionts as mechanisms of transgenerational effects. Am. J. Bot.104, 787ā792. doi: 10.3732/ajb.1700036
20
HareJ. D. (2011). Ecological role of volatiles produced by plants in response to damage by herbivorous insects. Annu. Rev. Entomol.56, 161ā180. doi: 10.1146/annurev-ento-120709-144753
21
HsiaoC.WangR. R. C.DeweyD. R. (1986). Karyotype analysis and genome relationships of 22 diploid species in the tribe triticeae. Can. J. Genet. Cytol.28, 109ā120. doi: 10.1139/g86-015
22
IannoneL. J.IrisarriJ. G. N.Mc CargoP. D.PerezL. I.GundelP. E. (2015). Occurrence of EpichloĆ« fungal endophytes in the sheep-preferred grass Hordeum comosum from Patagonia. J. Arid Environ.115, 19ā26. doi: 10.1016/j.jaridenv.2014.12.008
23
KangH. Y.WangY.FedakG.CaoW. G.ZhangH. Q.FanX.et al. (2011). Introgression of chromosome 3ns from Psathyrostachys huashanica into wheat specifying resistance to stripe rust. PLoS One6:e21802. doi: 10.1371/journal.pone.0021802
24
KatohK.StandleyD. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol.30, 772ā780. doi: 10.1093/molbev/mst010
25
LembiczM.GórzynskaK.LeuchtmannA. (2010). Choke disease caused by Epichloë bromicola in the grass Agropyron repens in Poland. Plant Dis.94:1372. doi: 10.1094/pdis-12-09-0810
26
LeuchtmannA.OberhoferM. (2013). The EpichloĆ« endophytes associated with the woodland grass Hordelymus europaeus including four new taxa. Mycologia105, 1315ā1324. doi: 10.3852/12-400
27
LeuchtmannA.SchardlC. L. (1998). Mating compatibility and phylogenetic relationships among two new species of EpichloĆ« and other congeneric European species. Mycol. Res.102, 1169ā1182. doi: 10.1017/s0953756298006236
28
LiC. J. (2005). Biological and ecological characteristics of Achnatherum inebrians/Neotyphodium endophyte symbiont. Lanzhou: Lanzhou University.
29
LiT.BlandeJ. D.GundelP. E.HelanderM.SaikkonenK. (2014). Epichloƫ endophytes alter inducible indirect defences in host grasses. PLoS One9:e101331. doi: 10.1371/journal.pone.0101331
30
LiW.JiY. L.YuH. S.WangZ. W. (2006). A new species of EpichloĆ« symbiotic with Chinese grasses. Mycologia98, 560ā570. doi: 10.3852/mycologia.98.4.560
31
LiC. J.WangZ. F.ChenT. X.NanZ. B. (2021). Creation of novel barley germplasm using an EpichloĆ« endophyte. Chin. Sci. Bull.66, 2608ā2617. doi: 10.1360/TB-2020-1587
32
MaD. F.FangZ. W.YinJ. L.ChaoK. X.JingJ. X.LiQ.et al. (2016). Molecular mapping of stripe rust resistance gene YrHu derived from Psathyrostachys huashanica. Mol. Breed.36:64. doi: 10.1007/s11032-016-0487-6
33
MinhB. Q.SchmidtH. A.ChernomorO.SchrempfD.WoodhamsM. D.von HaeselerA.et al. (2020). IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol.37, 1530ā1534. doi: 10.1093/molbev/msaa015
34
MoonC. D.GuillauminJ. J.RavelC.LiC. J.CravenK. D.SchardlC. L. (2007). New Neotyphodium endophyte species from the grass tribes Stipeae and Meliceae. Mycologia99, 895ā905. doi: 10.3852/mycologia.99.6.895
35
MoonC. D.MilesC. O.JƤrlforsU.SchardlC. L. (2002). The evolutionary origins of three new Neotyphodium endophyte species from grasses indigenous to the southern hemisphere. Mycologia94, 694ā711. doi: 10.1080/15572536.2003.11833197
36
NevskiS. (1934). āTribe XIVā in Flora of the USSR. Vol. 2. Ed. BenthH. (Springer), 469ā579.
37
O'KeeffeK. R.WheelerB. T.MitchellC. E. (2022). A microbial mutualist within host individuals increases parasite transmission between host individuals: evidence from a field mesocosm experiment. Front. Microbiol.13:824211. doi: 10.3389/fmicb.2022.824211
38
PhilippeG. (2016). Lolitrem B and indole diterpene alkaloids produced by endophytic fungi of the genus Epichloƫ and their toxic effects in livestock. Toxins.8:47. doi: 10.3390/toxins8020047
39
RobertsE.LindowS. (2014). Loline alkaloid production by fungal endophytes of fescue species select for particular epiphytic bacterial microflora. ISME J.8, 359ā368. doi: 10.1038/ismej.2013.170
40
SchardlC. L.FloreaS.PanJ.NagabhyruP.BecS.CalieP. J. (2013). The EpichloĆ«: alkaloid diversity and roles in symbiosis with grasses. Curr. Opin. Plant Biol.16, 480ā488. doi: 10.1016/j.pbi.2013.06.012
41
ShalevO.KarasovT. L.LundbergD. S.AshkenazyH.AyutthayaP. P. N.WeigelD. (2022). Commensal Pseudomonas strains facilitate protective response against pathogens in the host plant. Nat Ecol Evol.6, 383ā396. doi: 10.1038/s41559-022-01673-7
42
ShiC.AnS. Z.YaoZ. P.YoungC. A.PanaccioneD. G.LeeS. T.et al. (2017). Toxin-producing EpichloĆ« bromicola strains symbiotic with the forage grass Elymus dahuricus in China. Mycologia109, 847ā859. doi: 10.1080/00275514.2018.1426941
43
ShuY. C.AnJ. Z.JieF. (1991). The hybridization between Triticum aestivum and Psathyrostachys huashanica. J. Genet. Genomics18, 508ā512,
44
SiegelM. R.JarlforsU.LatchG. C. M.JohnsonM. C. (1987). Ultrastructure of Aremonium-coenophialum, Aremonium-lolii, and EpichloĆ«-typhina endophytes in host and nonhost Festuca and Lolium species of grasses. Can. J. Bot.65, 2357ā2367. doi: 10.1139/b87-320
45
SimpsonW. R.FavilleM. J.MoragaR. A.WilliamsW. M.McManusM. T.JohnsonR. D. (2014). EpichloĆ« fungal endophytes and the formation of synthetic symbioses in Hordeeae (=Triticeae) grasses. J. Syst. Evol.52, 794ā806. doi: 10.1111/jse.12107
46
SimpsonW.MaceW. (2012). Novel associations between EpichloĆ« endophytes and grasses: possibilities and outcomes[C]// EpichloĆ«, endophytes of cool season grasses: implications, utilization and biology. In: Proceedings of the 7th International Symposium on Fungal Endophytes of Grasses, Lexington, Kentucky, USA, 28 June to 1 July 2010. Samuel Roberts Noble Foundation. 35ā39.
47
SongM. L.ChaiQ.LiX. Z.YaoX.LiC. J.ChristensenM. J.et al. (2015). An asexual EpichloĆ« endophyte modifies the nutrient stoichiometry of wild barley (Hordeum brevisubulatum) under salt stress. Plant and Soil387, 153ā165. doi: 10.1007/s11104-014-2289-0
48
SongH.NanZ. B. (2015). Origin, divergence, and phylogeny of asexual Epichloƫ endophyte in Elymus species from Western China. PLoS One10:e0127096. doi: 10.1371/journal.pone.0127096
49
TintjerT.LeuchtmannA.ClayK. (2008). Variation in horizontal and vertical transmission of the endophyte EpichloĆ« elymi infecting the grass Elymus hystrix. New Phytol.179, 236ā246. doi: 10.1111/j.1469-8137.2008.02441.x
50
WhiteJ. F. (1997). Perithecial ontogeny in the fungal genus EpichloĆ«: An examination of the Clavicipitalean centrum. Am. J. Bot.84, 170ā178. doi: 10.2307/2446078
51
WhiteJ. F.KingsleyK. L.ZhangQ. W.VermaR.ObiN.DvinskikhS.et al. (2019). Review: endophytic microbes and their potential applications in crop management. Pest Manag. Sci.75, 2558ā2565. doi: 10.1002/ps.5527
52
XiaX. H. (2017). DAMBE6: new tools for microbial genomics, phylogenetics, and molecular evolution. J. Hered.108, 431ā437. doi: 10.1093/jhered/esx033
53
YiM.HendricksW. Q.KasteJ.CharltonN. D.NagabhyruP.PanaccioneD. G.et al. (2018). Molecular identification and characterization of endophytes from uncultivated barley. Mycologia110, 453ā472. doi: 10.1080/00275514.2018.1464818
54
ZhaoJ. X.JiW. Q.WuJ.ChenX. H.ChengX. N.WangJ. W.et al. (2010). Development and identification of a wheat-Psathyrostachys huashanica addition line carrying HMW-GS, LMW-GS and gliadin genes. Genet. Resour. Crop. Evol.57, 387ā394. doi: 10.1007/s10722-009-9477-4
55
ZhuM. J.RenA. Z.WenW.GaoY. B. (2013). Diversity and taxonomy of endophytes from Leymus chinensis in the Inner Mongolia steppe of China. FEMS Microbiol. Lett.340, 135ā145. doi: 10.1111/1574-6968.12083
Summary
Keywords
endophyte, Psathyrostachys lanuginosa, Epichloƫ bromicola, alkaloids, vertical transmission
Citation
Chen T, Wang T, Du M, Malik K, Li C and Bao G (2024) Discovery of Epichloƫ as novel endophytes of Psathyrostachys lanuginosa in China and their alkaloid profiling. Front. Microbiol. 15:1383923. doi: 10.3389/fmicb.2024.1383923
Received
08 February 2024
Accepted
13 May 2024
Published
23 May 2024
Volume
15 - 2024
Edited by
David Romero, National Autonomous University of Mexico, Mexico
Reviewed by
Irene Castano, Instituto Potosino de Investigación CientĆfica y Tecnológica (IPICYT), Mexico
Christopher Lewis Schardl, University of Kentucky, United States
Updates
Copyright
Ā© 2024 Chen, Wang, Du, Malik, Li and Bao.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Taixiang Chen, chentx@lzu.edu.cnGensheng Bao, baogensheng2008@hotmail.com
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.