ORIGINAL RESEARCH article

Front. Microbiol., 06 August 2025

Sec. Aquatic Microbiology

Volume 16 - 2025 | https://doi.org/10.3389/fmicb.2025.1615096

Multigene phylogeny, morphology, and pathogenicity uncover two novel Globisporangium species (Oomycota) from freshwater habitats in northwestern Iran

  • 1. Department of Plant Protection, Faculty of Agriculture, Azarbaijan Shahid Madani University, Tabriz, Iran

  • 2. East Azarbaijan Agricultural and Natural Resources Research and Education Centre, Plant Protection Research Department, Agricultural Research, Education and Extension Organization (AREEO), Tabriz, Iran

  • 3. Plankton and Microbial Ecology, Leibniz Institute for Freshwater Ecology and Inland Fisheries (IGB), Berlin, Germany

  • 4. Bermuda Institute of Ocean Sciences, St. George's, Bermuda

  • 5. Institute of Biochemistry and Biology, University of Potsdam, Potsdam, Germany

Abstract

During the study of oomycete biodiversity in aquatic environments of northwestern Iran (East Azarbaijan), four Globisporangium isolates were recovered from a river and irrigation canal. These isolates were identified based on multi-locus phylogenetic analyses (ITS, cox1, and cox2 genomic regions) and morphological features. As a result, two novel species were described, namely Globisporangium parvizense sp. nov. and G. sarabense sp. nov., both exhibiting unique sporangial structures and growth patterns. Pathogenicity assays on cucumber seedlings confirmed strains' high potential to cause root and crown rot. This research highlights the diversity of Globisporangium in Iranian freshwater habitats, providing insights into its taxonomy and phylogenetic relationships. Detailed morphological descriptions and illustrations are provided for these novel species.

1 Introduction

Pythium Pringsheim, nom. cons., sensu lato (s.l.) is a diverse and ecologically important genus within the phylum Oomycota (commonly known as water molds), comprising over 200 species (Uzuhashi et al., 2010; Derevnina et al., 2016). As a member of the kingdom Straminipila which also includes diatoms, brown algae, and slime molds (Mueller, 2011; Watkinson et al., 2015), Pythium s.l. shares phylogenetic affinities with other important plant pathogenic genera such as Albugo Roussel, Aphanomyces de Bary, Bremia Regel, Peronospora Corda, Phytophthora de Bary, Plasmopara Schroet., and Saprolegnia Nees. This genus is particularly notable for its wide distribution across both terrestrial and aquatic habitats and for its significant impact on agriculture, natural ecosystems, and even animal health (Robideau et al., 2011; Shreves et al., 2024; Masigol et al., 2025).

Pythium s.l. causes economic losses in vegetables, fruits, and ornamentals, resulting in damping-off, root and crown rot (Martin and Loper, 1999; Uzuhashi et al., 2010; Nzungize et al., 2012; Nguyen et al., 2022). Thriving in soil and aquatic agroecosystems, members of Pythium s.l. are frequently encountered in agricultural fields, nurseries, and greenhouses, where they persist in soil, water, plant debris, and even snow (Al-Sheikh and Abdelzaher, 2012; Chenari Bouket et al., 2015). Although capable of surviving in both aquatic and dryland environments (Barton, 1958; Abdelzaher and Kageyama, 2020), their motile zoospores, equipped with flagella, favor water for dispersal, which enhances their infectivity in moist conditions. Some species have even adapted to saline environments, further expanding their ecological range (Al-Sheikh and Abdelzaher, 2012).

Additionally, Pythium s.l. could be a potential threat to aquatic ecosystems, particularly when introduced into water by human activities (Abdelzaher and Kageyama, 2020). In fact, certain water-dwelling species such as Pythium insidiosum, could be responsible for severe infections in humans and dogs, causing “pythiosis,” a disease that affects cutaneous and vascular tissues (Hamlin et al., 2024). The ability of Pythium s.l. to infect multiple hosts across different ecosystems highlights its adaptability and pathogenic potential.

Given the ecological significance of Pythium, delineating its species boundaries is essential, as it lays the foundation for subsequent ecological and functional studies. In recent years, the taxonomy of Pythium s.l. has undergone significant transformations, primarily driven by advancements in molecular techniques (Villa et al., 2006). Molecular phylogenetic analyses revealed the paraphyletic nature of Pythium s.l., leading to proposals for its division into several distinct lineages. Initially, Lévesque and De Cock (2004) classified Pythium s.l. into 11 clades (A–K) based on phylogenetic data derived from the nuclear rDNA internal transcribed spacer region (ITS1–5.8S–ITS2) and the D1–D3 domains of the 28S rDNA. These clades were later reassessed through multigene phylogenetic analyses, which resulted in a revised classification that consolidated the original clades into 10 groups, with clade K reassigned to the newly established genus Phytopythium (Villa et al., 2006; Bala et al., 2010). Furthermore, Uzuhashi et al. (2015) proposed a major revision, restructuring Pythium s.l. into five distinct genera: Pythium sensu stricto (clades A–D), Globisporangium (clades E–G, I, and J), Elongisporangium (clade H), Ovatisporangium (clade K = Phytopythium), and Pilasporangium, which stands apart from the previously defined clades.

Several studies have focused on the isolation and identification of Pythium s.l. associated with aquatic ecosystems. In one of the earliest studies, Abdelzaher et al. (1995) reported Pythium group F from aquatic environments. Later, P. myriotylum, P. ultimum var. sporangiferum (Kageyama, 2010), and P. rishiriense (Rahman et al., 2015) were reported from water, soil and floating water from Rishiri Island, Japan. More novel Pythium species have been recently reported from different aquatic ecosystems in Japan (Uzuhashi et al., 2015; Abdelzaher and Kageyama, 2020), South Korea (Nam and Choi, 2019), and China (Chen and Zheng, 2019).

Although oomycetes have been studied in Iran for decades, the focus has traditionally been on plant pathogenic species in Peronosporomycetes (e.g., Pythium, Mostowfizadeh-Ghalamfarsa, 2015; Salmaninezhad and Mostowfizadeh-Ghalamfarsa, 2017, 2019, 2022, 2023; Salmaninezhad et al., 2022). Only recently, Saprolegniomycetes (Ghiasi et al., 2010; Masigol et al., 2018, 2019, 2020, 2022, 2023, 2025; Mirmazloomi et al., 2022) and, to a lesser extent, Peronosporomycetes (Ahadi et al., 2024) have been investigated taxonomically and ecologically in aquatic ecosystems. However, as research on aquatic oomycetes is still limited and geographically specific, this study aims to identify Globisporangium isolates from agroecosystems in East Azarbaijan province, Iran, using a combination of morphological analysis and multigene phylogeny, based on the nuclear rDNA ITS1-5.8S-ITS2 region and partial cytochrome C oxidase subunit I (cox1) and subunit II (cox2) sequences. Additionally, the potential pathogenicity of these isolates on cucumber, a common host plant of oomycetes, was evaluated.

2 Materials and methods

2.1 Sample collection and isolation

Sampling was conducted in the aquatic environments of East Azerbaijan Province, Iran (Table 1). Algae and roots of the grass species Cynodon dactylon were collected from a river and irrigation canal in 50 mL Falcon tubes and stored at 4°C prior to processing in the laboratory. Following surface sterilization for 1 min, tissue samples were cultured on NARF medium (Morita and Tojo, 2007) and incubated at 15°C for 5 days. Upon hyphal growth, a portion of the culture was transferred to WA medium (20.0 g/L agar) for purification using the hyphal tip method (Goh, 1999). Purified isolates were preserved on CMA medium in McCarthy vials at 10°C.

Table 1

IsolateIRAN culture collection accession numberMatrixEcosystemLocationLongitudeLatitude
AZFC-RA178-2-1IRAN 5217CRoot of Cynodon dactylonIrrigation waterEast A., Tabriz37°9′54.8″46°0′37.9″
AZFC-RA178-2-2IRAN 5344CRoot of Cynodon dactylonIrrigation waterEast A., Tabriz37°9′54.8″46°0′37.9″
AZFC-RA98-1-1IRAN 5173CAlgaeRiverEast A., Sarab37°6′24.6″47°6′15.9″
AZFC-RA98-1-2IRAN 5345CAlgaeRiverEast A., Sarab37°6′24.6″47°6′15.9″

Detailed information of isolates obtained in this study.

2.2 Morphological analysis

Growth patterns of the isolates were observed 2 weeks after inoculation on various agar media, including corn meal agar (CMA) (MIRMEDIA, Iran), potato dextrose agar (PDA) (Sigma Aldrich, Germany), malt extract agar (MEA) (DIFCO, USA), potato carrot agar (PCA) (Sigma Aldrich, Germany), and V8-juice agar (SIGMA, Germany) at 25°C. Morphological evaluations were performed on sexual and asexual structures produced on autoclaved hemp seeds and ryegrass pieces floating in sterile water from different sources (pond water, distilled water, tap water) (Martin, 1992). Twenty measurements were taken for each structure. Microscopic structures were photographed using a Nikon Eclipse Ti2 microscope with a digital camera system (Nikon, Japan). All purified cultures were deposited in the fungal culture collection of Azarbaijan Shahid Madani University, Tabriz, Iran (AZFC) and Iranian Research Institute of Plant Protection, Tehran, Iran (IRAN). Type specimens were also deposited in the herbarium of the Iranian Research Institute of Plant Protection.

The critical temperatures for growth were determined by incubating the strains on potato carrot agar (PCA) at 0, 2, 5, 10, 15, 20, 25, 30, 35, and 40°C. Descriptions were provided based on ex-type strains, and additional data for strains showing distinct morphological differences were included.

2.3 Phylogenetic analyses

Genomic DNA was extracted from 5-day-old CMA cultures using a modified manual procedure (Möller et al., 1992). Three genomic regions were targeted for amplification: the ITS-rDNA region, which contains the 5.8S nuclear ribosomal RNA gene and the internal transcribed spacers ITS1 and ITS2, and partial sequences of the mitochondrial cox1 and cox2 genes. These regions were amplified using specific primer pairs: ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al., 1990) for the ITS-rDNA region, FM55 (GGCATACCAGCTAAACCTAA) and FM52R (TTAGAATGGAATTAGCACAAC) (Martin, 2000) for the cox1 gene, and FM58 (CCACAAATTTCACTACATTGA) and FM66 (TAGGATTTCAAGATCCTGC) (Villa et al., 2006) for the cox2 gene. All reactions were conducted in a total volume of 50 μL, consisting of 25 μL of ready-to-use PCR Master mix (SinaClon, Iran), 1.2 μM of each primer, 18.6 μL of DNase-free water, and 10 ng of DNA. Amplifications were carried out using a PeqStar 96X universal thermal cycler with the following conditions: 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, with a final extension step at 72°C for 7 min for ITS-rDNA (White et al., 1990), and 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 1 min, with a final extension step at 72°C for 7 min for cox1 and cox2 genes (Martin, 2000; Chenari Bouket et al., 2015).

PCR amplicons were sequenced by Macrogen (Amsterdam, the Netherlands). Raw sequences were manually edited using SeqManII® (DNA STAR) and MEGA v. 6 (Tamura et al., 2013). Sequence data from ex-type and reference strains of known Globisporangium species were obtained from NCBI GenBank (www.ncbi.nlm.nih.gov/genbank/) (Table 2). The retrieved sequences were assembled using Geneious (version 5.6) and aligned using the Q-INS-I algorithm in MAFFT (latest version), available on the MAFFT web server (Katoh and Standley, 2013; Katoh et al., 2019), separately for each of the genomic regions. Subsequently, after the removal of gaps, phylogenetic analyses were performed on the TrEase webserver (Mishra et al., 2023) for the individual genes using FastTree2 (Price et al., 2010) for Minimum Evolution, RAxML (Stamatakis, 2014) for Maximum Likelihood, and MrBayes (Ronquist et al., 2012) for Bayesian inference. For the Bayesian analysis, a GTR model was selected, and the analyses were run on random trees for 1,000,000 generations, discarding 30% of the first trees as burn-in steps of the analysis to determine posterior probabilities from the remaining trees. RAxML and FastTree2 trees were generated using the GTRGAMMA and GTR algorithms, respectively, and the reliability of the inferred trees was assessed through bootstrap analysis with 1,000 replications. After ensuring that there were no conflicting topologies in the phylogeny of the individual loci, they were concatenated, with the borders marked to ensure independent modeling of substitution rates for each partition. Multigene phylogenies (ITS, cox1, and cox2) with support values were calculated in the same manner as mentioned above, using three different approaches to assess the robustness of the inferred phylogenies. The sequences obtained in this study were deposited in GenBank, and their accession numbers have been provided in Table 2.

Table 2

Species nameSample codeLocalityGenBank accession no.
ITScox1cox2
G.abappressoriumTCBS110198USAHQ643408HQ708455KJ595409
G. acanthophoronCBS33729USAHQ643413HQ708460KJ595376
G.acrogynumA/TCBS54988ChinaHQ643414HQ708461AB362324
G.alternatumTCBS139279AB998876AB998877
G.apiculatumPNCBS120945FranceHQ643443HQ708490KJ595422
G. attrantheridiumDAOM230383CanadaHQ643477HQ708524AB512886
G.baisenseTQBS123FR775440FR774198
G.barbulaeTCBS139569JapanLC028389LC028392LC028395
G. breveHMAS 242231FR751317FR774196
G. buismaniaeCBS28831NetherlandsHQ643479HQ708526KJ595368
G.camurandrumPNDAOM BR876GQ244426GQ244425
G.canarienseTCBS112353SpainHQ643482HQ708528JX397983
G. capenseCBS 149752AustraliaOL342598OL331986OL332028
G. carolinianumCBS122659IndiaHQ643484HQ708530KJ595427
G.cederbergenseTCBS133716South AfricaJQ412768JQ412793JQ412805
G. communeCBS 149753AustraliaOL952618OL860920OL860929
G.coniferarumTCBS148568IranON554847MZ020754MZ020759
G. cryptoirregulareCBS118731USAHQ643515HQ708561GU071763
G.cylindrosporumTCBS21894GermanyHQ643516HQ708562GU071762
G. cystogenesCBS67585NetherlandsAY707985HQ708564KJ595396
G. debaryanumCBS75296UKHQ643519HQ708565KJ595399
G.echinulatumPNCBS28164AustraliaHQ643531HQ708577AB362327
G. emineosumDAOM BR836GQ244428GQ244424
G.erinaceumPNCBS50580New ZealandHQ643534HQ708578AB362326
G. glomeratumCBS122644FranceHQ643542HQ708586KJ595424
G.heterothallicumTCBS45067CanadaHQ643553HQ708597AB512919
G. hypogynumCBS23494FranceHQ643565HQ708609AB362325
G. intermediumCBS26638NetherlandsHQ643572HQ708616AB507410
G.iranenseTIRAN2386CIranMG182709MG182705
G. irregulareCBS250.28GQ410356GU071822GU071760
G. iwayamaiCBS15664AustraliaHQ643669HQ708713JX397979
G.izadpanahiiTCBS144006IranMK454537OP321103MK455859
G. jasmoniumDAOM229150USAHQ643670HQ708714
G. kandovanenseCBS 139567IranKP723167KP938427KP723171
G.kunmingenseTCBS55088ChinaHQ643672HQ708716KJ595389
G. lacustreMAFF 236903JapanLC209786LC209787
G.longandrumPNCBS112355FranceHQ643679HQ708723KJ595413
G.longisporangiumPNCBS122646FranceHQ643680HQ708724KJ595426
G. lucensCBS113342CanadaHQ643681HQ708725KJ595415
G. macrosporumCBS57480NetherlandsHQ643684HQ708728AB512916
G.mahabadenseTIRAN 4986CIranPQ037626PQ031213PQ031206
G. mahabadenseIRAN 5253CIranPQ037627PQ031212PQ031205
G. mamillatumCBS25128NetherlandsHQ643687HQ708731AB512918
G. marsipiumCBS77381NetherlandsHQ643690HQ708734KJ595401
G. mastophorumCBS37572UKHQ643691HQ708735KJ595378
G. megalacanthumDAOM229154GermanyHQ643693HQ708737KJ595435
G.middletoniiPNCBS52874NetherlandsHQ643694HQ708738AB362318
G.minorTCBS22688UKHQ643696HQ708740AB362320
G.multisporumTCBS47050HQ643700HQ708744AB362319
G. nagaiiCBS77996UKHQ643705HQ708749KJ595402
G. nodosumTCBS102274FranceHQ643709HQ708753KJ595407
G. nunnTCBS80896USAHQ643711HQ708755
G. okanoganenseTCBS31581USAHQ643714HQ708758KJ595373
G.ornacarpumTCBS112350FranceHQ643721HQ708762KJ595411
G. orthogononCBS37672LebanonHQ643723HQ708764KJ595379
G. paddicumCBS69883JapanHQ643728JX397975JX397982
G. papilogynumCBS122648IndiaHQ643729HQ708770
G.paroecandrumPNCBS15764AustraliaHQ643731HQ708772DQ071391
G.parvumTCBS22588UKHQ643738HQ708779AB362322
G.parvizenseTIRAN 5217CIranPV444307PV454623PV454627
G. parvizenseIRAN 5344CIranPV444308PV454624PV454628
G. pleroticumCBS77681NetherlandsHQ643748HQ708789AB362321
G.polareTCBS118203NorwayKJ716859KJ595417
G. polymastumCBS81170NetherlandsHQ643752HQ708793KJ595403
G. radiosumCBS21794FranceHQ643756HQ708797KJ595356
G. recalcitransTCBS 122440SpainDQ357833EF426549KJ595423
G.rhizosaccharumTCBS112356IndiaHQ643760HQ708801AB362323
G. rooibosSTE-U7549JQ412770JQ412795JQ412807
G.rostratifingensPNCBS115464USAHQ643761HQ708802KJ595416
G.rostratumPNCBS53374NetherlandsHQ643767HQ708808KJ595388
G.sarabenseTIRAN 5173CIranPV444306PV454622PV454626
G. sarabenseIRAN 5345CIranPV444305PV454621PV454625
G.segnitiumPNCBS112354SpainHQ643772HQ708813KJ595412
G. selbyiCBS129729USAJF836871JF895536JF895532
G. solareTCBS119359SpainKJ716860KJ595421
G.spiculumTCBS122645FranceHQ643790HQ708831KJ595425
G. spinosumCBS27667NetherlandsHQ643792HQ708833KJ595366
G. splendensCBS46248USAHQ643795HQ708836AB512921
G.sylvaticumTCBS45367USAHQ643845HQ708886
G.tabrizenseTIRAN 4985CIranPQ037624PQ031210PQ031204
G. tabrizenseIRAN 5254CIranPQ037625PQ031211PQ031203
G.takayamanumTCBS122491JapanHQ643854HQ708895
G.tenuihyphumTChen 268ChinaMF984123MF984160
G. terrestrisUM2097AustraliaOL342605OL331993OL332034
G. ultimum var. sporangiiferumTCBS21965USAHQ643879HQ708920AF196641
G. uncinulatumCBS51877NetherlandsHQ643944HQ708985KJ595385
G. urmianumIRAN2376CIranKT894049KT894057
G. viniferumCBS119168CanadaHQ643956HQ708997KJ595419
G. violaeCBS15964AustraliaHQ643958HQ708999JX397980
G.yorkenseTC12-118USAKY990050KT692789KY985298
Phytopythium littoraleCBS118360GermanyHQ643386HQ708433KJ595418

A list of strains studied, with collection details and GenBank accession numbers.

-: Accession number not available. The specimen examined and the sequences generated in this study are indicated in bold.

2.4 Pathogenicity assays

Pathogenicity tests were conducted using a single isolate of each species (IRAN 5217C and IRAN 5173C, respectively). Cucumber (Cucumis sativus L.), a known host for a wide range of oomycetes (Ben-Yephet and Nelson, 1999; Lévesque and De Cock, 2004; Roberts et al., 2016; Sigillo et al., 2020; Zhang et al., 2023), was selected as the test plant. The inoculum was prepared according to the methods of Ahadi et al. (2024) with minor modifications. A sterile substrate containing sandy loam soil, wheat seed, and distilled water was inoculated with five mycelial plugs (5 mm3) from three-day-old PDA cultures of the target isolates. After 9 days of incubation at 25°C, cucumber seeds were sown and grown in a greenhouse at 25 ± 2°C with a 16-h photoperiod for 14 days. Positive controls consisted of plants grown in soil inoculated with each of the test isolates, while negative controls were grown in non-inoculated soil. Symptoms including wilting, crown and root rot, and stem discoloration and deterioration were assessed daily for 14 days. Symptomatic plants were further analyzed to isolate and identify potential pathogens using previously described isolation methods. A randomized complete block design with six replicates per treatment was employed.

3 Results

3.1 Phylogeny

In the analysis of multi-locus alignment (Globisporangium species), which included the gene boundaries of ITS (1–1,066), cox1 (1,067–1,560), and cox2 (1,561–2,069), a total of 89 isolates belonging to Globisporangium, along with an outgroup, were examined. The combined dataset (ITS + cox1 + cox2) comprised 2,069 characters, including alignment gaps, with 958 variable characters (636 for ITS-rDNA, 169 for cox1, and 153 for cox2) and 1,002 constant characters (the sequence lengths were 333 bp for ITS-rDNA, 320 bp for cox1, and 349 bp for cox2).

Bayesian analysis confirmed the tree topology obtained from minimum evolution (ME) and maximum likelihood (ML) methods. While most Bayesian posterior probability values were consistent with bootstrap supports, the Bayesian tree was selected to represent the phylogeny, with bootstrap values from ME and ML methods incorporated for comparison (Figure 1). In all three-locus phylogenetic trees (Bayesian, ML, and ME), the four Globisporangium isolates were placed into two distinct, well-supported clades, each representing a separate species. Specifically, the isolates IRAN 5217C and IRAN 5344C formed a robust monophyletic group, with maximum support from Bayesian posterior probability (1) and bootstrap values (100% for both ME and ML). Similarly, isolates IRAN 5173C and IRAN 5345C were clustered together in a separate, strongly supported clade [support values: 1.00 (Bayesian posterior probability), 83% (ME), and 67% (ML)]. In the multi-locus analysis, the topologies of the single-locus phylogenies did not conflict with the respective three-locus phylogenies, confirming the reliability and accuracy of the inferred relationships among these isolates.

Figure 1

3.2 Taxonomy

This study identified two Globisporangium species from various aquatic environments in Iran. Four isolates, including two from the roots of the grass species Cynodon dactylon growing in an irrigation canal (IRAN 5217C and IRAN 5344C), and two from water surface algae in the Sarab River in Sarab City (IRAN 5173C and IRAN 5345C) were reported as new species: G. parvizense sp. nov. and G. sarabense sp. nov.

Globisporangium parvizense Ahadi, Alizadeh, Chenari Bouket sp. nov. (Figure 2).

Figure 2

MycoBank: 857765

Typification: IRAN. East Azarbaijan: Tabriz (Varanaq), from roots of the grass species Cynodon dactylon, growing within the agricultural irrigation canals, Oct 2022, R. Ahadi (holotype IRAN 18632F). Ex-holotype culture IRAN 5217C = AZFC-RA178-2-1. GenBank: ITS = PV444307; cox1 = PV454623; cox2 = PV454627.

Etymology: The species is named in honor of the first author's father (Parviz), whose assistance was invaluable in the collection of the species.

Morphology: The colony pattern on MEA and PCA is a semi-rosette pattern, pattern on CMA is entirely within the growth medium and pattern on PDA and V8A appears submerged to stellate, with a daily growth rate of 9 mm at 25°C on PCA. The cardinal temperatures are at a minimum of 5°C, an optimum of 25°C, and a maximum of 30°C on PCA. The main hyphae are hyaline, aseptate, and range from 2.4 to 6 μm in width. The globose sporangia appear intercalary or terminal, measuring 11–32 μm in diameter (mean 23 μm). Globose hyphal swelling, terminal or intercalary, 8.5–16.5 μm (mean 10 μm) in diameter. Discharge tube arising from sporangia, short to long, one and rarely two per sporangia, and thick, 13–41 μm (mean 19.5 μm) in length and 7–8.5 μm (mean 8 μm) in width. Zoospores are not observed. Oogonia are globose and smooth, appearing intercalary or terminal, with a diameter range of 14–23 μm (mean 20.5 μm) and produced in single cultures. Antheridia are typically one, occasionally two per oogonium, diclinous. Oospores are plerotic, with one, rarely two per oogonium, measuring 15–23 μm in diameter (mean 20 μm). The wall thickness ranged from 1.8 to 3.6 μm.

Additional specimen examined: IRAN. East Azarbaijan: Tabriz (Varanaq), from roots of the grass species Cynodon dactylon, growing within the agricultural irrigation canals, Oct 2022, R. Ahadi. culture IRAN 5344C = AZFC-RA178-2-2. GenBank: ITS = PV444308; cox1 = PV454624; cox2 = PV454628.

Notes: Phylogenetic analysis revealed a close relationship between Globisporangium parvizense and G. hypogynum, followed by a slightly less close relationship with G. acrogynum and G. schmitthenneri. These species, as well as all other Globisporangium species, can be differentiated from G. parvizense based on ITS, cox1, and cox2 sequence data. Blastn searches on NCBI GenBank revealed that the ITS sequence of the G. parvizense ex-type strain (IRAN 5217C = AZFC-RA178-2-1) exhibited 99% identity with the G. hypogynum type strain CBS23494 (HQ643565), G. schmitthenneri type strain Darke1611 (JF836869), and G. acrogynum isolate CBS54988 (HQ643414) (with two, three, and three nucleotide differences, respectively). Similarly, the cox1 sequence of the ex-type strain shared 99% identity, respectively (with four nucleotide differences for both), with the G. hypogynum type strain CBS23494 (HQ708609), G. acrogynum isolate CBS54988 (HQ708461), and G. schmitthenneri type strain Darke1611 (JF895534). Comparative analysis of G. parvizense with the cox2 sequence showed 98% identity, with seven nucleotide differences compared to G. hypogynum type strain CBS23494 (AB362325), G. acrogynum isolate CBS54988 (AB362324), and G. schmitthenneri type strain Darke1611 (JF895530). The phylogenetic data robustly establish G. parvizense as a phylogenetically isolated species within the genus Globisporangium.

Globisporangium parvizense is morphologically distinct from its phylogenetically close species based on several morphological characteristics. A detailed comparison of G. parvizense, G. hypogynum, G. acrogynum, and G. schmitthenneri reveals several distinct features. G. parvizense is characterized by narrower hyphae, up to 6 μm in width, compared to 7.7, 8, and 8.3 μm in G. acrogynum, G. schmitthenneri, and G. hypogynum, respectively. While G. parvizense exclusively forms globose sporangia, G. schmitthenneri also produces lemon-shaped sporangia. Globisporangium parvizense also has smaller oogonia (up to 23 μm) compared to G. hypogynum (up to 35 μm), and consistently smooth oogonia, unlike G. acrogynum. Globisporangium parvizense typically has one, occasionally two, antheridia per oogonium, while G. schmitthenneri can have up to three, and G. acrogynum has only one antheridium per oogonium. Globisporangium parvizense is uniquely characterized by the consistent formation of two spherical oospores per oogonium, while G. acrogynum and G. hypogynum each produce a single oospore. These morphological characteristics, including narrower hyphae, simpler sporangial shapes, consistent oospore formation, and unique antheridial structures, clearly differentiate G. parvizense from its closely related species (Table 3).

Table 3

CharacteristicsG. parvizense sp. nov.G.schmitthenneriaG.acrogynumbG.hypogynumb,c
Daily growth on PCA9 mm13.2 mmNot reported11 mm
Width of main hyphae2.4–6 μm4–8 μm7.7 μm1.5–8.3 μm
Discharge tubeShort to long, one and rarely two per sporangia and thick, 13–41 μm (av. 19.5 μm) length and 7–8.5 μm (av. 8 μm) widthArising from the sporangia was long, >two times longer than sporangia and narrowAbout twice the diameter of the sporangia
ZoosporesNot observed7–10 mm longNot observedObserved
SporangiumGlobose, intercalary or terminal, 11–32 μm (av. 23 μm).Terminal, occasionally intercalary, (sub) globose, lemon shaped, 17–43 (av. 32) μm, up to 48 μm long when limoniform24–40 (av. 31) μm, terminal, rarely intercalary, (sub) globoseTerminal, occasionally intercalary, (sub) globose, non-proliferating, 6.5–34.5 (av. 22) μm
OogoniaGlobose, smooth, intercalary or terminal, 14–23 μm (av. 20.5)Mostly terminal, occasionally intercalary, smooth 19–26 (av. 23) μm, oogonial stalk 3–10 μmTerminal, (sub) globose, papillate, rarely smooth, 18–25 (av. 21) μm in diameterTerminal, (sub) globose, smooth, 10–35 (av. 22) μm in diameter
AntheridiaOne occasionally two per oogonium, diclinousMostly diclinous occasionally monoclinous and hypogynous, antheridial cells 10–25 × 6–12 μm, one occasionally as many as three per oogoniaOne per oogonia, hypogynous, antheridial cells large, 8–15 × 6–14 (av. 11.5–9) μmStrictly hypogynous, antheridial cells 3.0–11.1 × 2.8–8.3 (av. 6.5 × 5.5) μm delimited within the oogonial stalk at disitance of 5–30 μm below the oogonium
OosporePlerotic, one rarely two per oogonium, 15–23 μm (av. 20 μm)Plerotic, single, occasionally two oospores per oogonium, 14–23 (av. 20) μm in diameter, wall smoothPlerotic, single, 18–23 (av. 20) μm in diameter, wall smoothPlerotic, single, smooth-walled
Wall thickness of oospore1.8–3.6 μm1–2.5 μm0.8–1.7 (av. 1.5) μmNot reported

Morphological comparison of Globisporangium parvizense sp. nov. and related species.

a

Description taken from Ellis et al. (2012).

b

Description taken from Middleton (1941).

c

Description taken from Van der Plaats-Niterink (1981).

Globisporangium sarabense Ahadi, Alizadeh, Chenari Bouket sp. nov. (Figure 3).

Figure 3

MycoBank: 857791

Typification: IRAN. East Azarbaijan: Sarab, from water surface algae in Sarab River, Oct 2022, R. Ahadi (holotype IRAN 18544F). Ex-holotype culture IRAN 5173C = AZFC-RA98-1-1. GenBank: ITS = PV444306; cox1 = PV454622; cox2 = PV454626.

Etymology: Referring to the type location, Sarab City.

Morphology: The colony pattern on MEA is a rosette pattern, whereas the pattern on CMA, PDA, PCA, and V8A are submerged to stellate. Daily growth at 25°C on PCA is 20 mm. Cardinal temperatures are a minimum of 5°C, an optimum of 25°C, and a maximum of 35°C on Potato Carrot Agar. Main hyphae are hyaline, aseptate, and 2.4–6 μm (mean 3.1 μm) wide. Sporangia are globose or subglobose, intercalary or terminal, 17–26.8 μm (mean 21.6 μm) in diameter, and lemon-shaped sporangia are intercalary or terminal, 23.1–31.7 μm (mean 27.4 μm) in length and 17–26.8 μm (mean 21.7 μm) in width. The discharge tube is 12.8–10.3 μm (mean 11.5 μm) in length and 3–3.6 μm (mean 3.3 μm) in width. Zoospores are not observed. Oogonia are rarely formed, mostly terminal, smooth, globose, 18.3–23.1 μm (mean 20 μm) in diameter, and produced in a single culture. Antheridia are one per oogonium, mostly diclinous. Oospores are globose, aplerotic, one per oogonium, measuring 12.2–23.3 μm (mean 15.8 μm) in diameter, with wall thickness ranging from 0.6 to 2.4 μm.

Additional specimen examined: IRAN. East Azarbaijan, Sarab, from water surface algae in Sarab River, Oct 2022, R. Ahadi. culture AZFC-RA98-1-2. GenBank: ITS = PV444305; cox1 = PV454621; cox2 = PV454625.

Notes: Phylogenetic analysis revealed a close phylogenetic relationship between G. sarabense, G. lucens, and G. tabrizense, followed by a slightly less close relationship with G. viniferum and G. debaryanum. The ex-type strain of G. sarabense (IRAN 5173C = AZFC-RA98-1-1) exhibited 94% ITS identity with the G. lucens strain CBS113342, 96% identity in the cox1 gene, and <96% identity in the cox2 gene, as well as <94% ITS identity with the G. tabrizense strain IRAN 18502F. It showed 96.62% identity in the cox1 gene and <97% identity in the cox2 gene. However, it also displayed 21 and 15 nucleotide differences in ITS, 18 and 17 in cox1, and 10 and 12 in cox2, respectively, compared to this reference strain. Blastn searches on NCBI GenBank indicated that the ITS sequence of G. sarabense shared the highest similarity (97% identity, with 18 nucleotide differences and 5 gaps) with the G. viniferum isolate Tr-Sm01 (MT251151). Its cox1 sequence was most similar (97%) to Pythium sp. isolate Kb003 (ON202818), and the cox2 sequence was most similar (98%) to G. intermedium (MG256947). The ex-type strain of G. sarabense shared 96% identity in ITS, <95% in cox1 and cox2 genes with the G. viniferum voucher CBS119168, differing by 20 nucleotides in ITS, 16 in cox1, and 12 in cox2. Additionally, it shared 97% ITS identity, 96% cox1 identity, and 97% cox2 identity with G. debaryanum CBS75296, but exhibited 19 nucleotide differences in ITS, 16 in cox1, and 12 in cox2. The examined loci consistently placed G. sarabense in a separate phylogenetic clade, confirming its status as a distinct species within Globisporangium.

Globisporangium sarabense shares some morphological similarities with G. lucens, G. tabrizense, G. viniferum, and G. debaryanum. However, distinct morphological features differentiate G. sarabense from its congeners. Compared to G. lucens, G. sarabense lacks zoospores, while G. lucens produces zoospores. Furthermore, G. sarabense has single oospores, whereas G. lucens occasionally has two oospores per oogonium. Oogonia chains were not identified in G. sarabense, but G. lucens exhibits the formation of oogonia chains. In terms of sporangium morphology, G. sarabense exhibits greater diversity, including lemon-shaped, globose, or subglobose forms, while G. lucens primarily has globose or subglobose sporangia. Globisporangium sarabense possesses a single antheridium per oogonium, whereas G. lucens may have as many as five antheridia.

In contrast to G. tabrizense, G. sarabense is characterized by the absence of filamentous sporangia and the possession of a discharge tube, which further distinguishes it from G. tabrizense. Furthermore, in G. sarabense, the formation of oogonia is infrequent, and in contrast to G. tabrizense, the development of oogonia chains does not occur. In G. tabrizense, as many as two antheridia are produced, whereas in G. sarabense, only a single antheridium is formed. Oospores in G. tabrizense produce both plerotic and aplerotic types, with two oospores per oogonium. In contrast, G. sarabense only produces a single aplerotic oospore. Moreover, G. viniferum has up to three plerotic oospores per oogonium, but G. sarabense has a single, aplerotic oospore.

Differentiating G. sarabense from G. debaryanum is primarily based on the absence of zoospores and the production of only aplerotic oospores in G. sarabense. At the same time, G. debaryanum produces mostly plerotic and rarely aplerotic oospores. Additionally, in G. sarabense, the wall thickness of the oospore is 1.5 μm wider than in G. debaryanum.

In summary, G. sarabense is morphologically distinct from its congeners due to its unique combination of sporangia types, absence of zoospores, oospore characteristics, and number of antheridia. These morphological differences highlight the taxonomic distinctiveness of G. sarabense within the genus Globisporangium (Table 4 and Figure 3).

Table 4

CharacteristicsG. sarabense sp. nov.G.tabrizenseaG.lucensb,cG.viniferumdG.debaryanume
Daily growth on PCA20 mm21 mm9 mm25 mm30 mm
Width of main hyphae2.4–6 μm2.5–8.5 μm in diameter3.5–6.5 μm in diameter>7 μm in diameter
SporangiumGlobose, subglobose and lemon shape, terminal or intercalary, 17–31 (av. 24) μm; discharge tube single occasionally 2, 12.8–10.3 μm (mean 11.5 μm) length and 3–3.6 μm (av. 3.3 μm) widthTerminal and intercalary, lemon-shaped, filamentous, globose, 8.5–39.5 μm in diameterGlobose or subglobose, terminal and occasionally catenulate 2–3 in a chain, intercalary (21–25 μm in diameter); discharge tube up to 30 μm in diameter long, 1–2 per sporangium; Encysted zoospores 8–10 μm in diameterTerminal and intercalary, spherical (7–25 μm in diameter), ovoid to elongated; at different temperatures, in sterile distilled, pond, and soil extract waterSpherical and terminal, up to 21 μm in diameter
ZoosporesNot observedNot observed8–10 μm in diameterZoospores were never observed in spite of repeated culturingPresent
OogoniaRarely formed, mostly terminal, smooth, globose, 18.3–23.1 μmIntercalary and terminal, globose, smooth, 13.5–22 μm in diameter, rarely 2 in chainSmooth walled, globose, 22–35 μm in diameter, rarely pyriform, usually terminal, occasionally intercalary, rarely 2–3 in chainMostly intercalary, occasionally terminal, sometimes catenulate, 17–29 μm in diameter, antheridia and oogonia borne on an appressorium, cylindrical or peanut-shapedSpherical, smooth, 13–22 μm in diameter, terminal
AntheridiaOne per oogonium, mostly diclinousDiclinous and monoclinous, 1–2 per oogonium1–2(5) per oogonium, monoclinous, usually stalked, originating usually more than 20 μm distance from the oogonium base, occasionally diclinous, antheridial cells clavate, occasionally 2–3 borne on one antheridial branchHypogynous, monoclinous sessile or monoclinous on short branches, at times diclinous, 1–5 per oogonium, antheridial cells conspicuous and at times bi-lobed, monoclinous stalked antheridia making a broad apical contact zone with the oogonia1 per oogonium, arising from the oogonial stalk
OosporeGlobose, aplerotic, one per oogonium, 12.2–23.3 μmSingle, rarely 2, globose, plerotic or aplerotic, 12.5–22 μm in diameterAplerotic, usually single, occasionally 2 oospores per oogonium, globose, 17–23 μm in diameter.Spherical, elongated and irregular, 1 to 3 per oogonia, plerotic, rarely aplerotic, 12–22 μm in diameterPlerotic rarely aplerotic, mostly spherical, single, 12–21 μm in diameter
Wall thickness of oospore0.6–2.4 μm1.2–1.8 μm1.5–2.5 μm1–2 μm1 μm

Morphological comparison of Globisporangium sarabense sp. nov. and related species.

a

Ahadi et al. (2024).

b

Ali-Shtayeh and Dick (1985).

c

Uzuhashi et al. (2010).

d

Paul and Bala (2008).

e

Hendrix (1974).

4 Pathogenicity assay

Pathogenicity experiments confirmed the pathogenicity of all examined isolates, including G. parvizense sp. nov. (IRAN 5217C) and G. sarabense sp. nov. (IRAN 5173C), resulting in crown and root rot and subsequent seedling death (Figure 4). All inoculated seedlings developed characteristic water-soaked lesions at the crown, leading to crown and root rot and eventually plant collapse within 2 weeks.

Figure 4

Seedlings emerged normally 3 days post-sowing (dps). However, by 5 dps, initial symptoms—water-soaked lesions on the crown accompanied by incipient wilting—became apparent. These symptoms were intensified by 7 dps, with lesion coalescence, stem browning, and tissue decay extending into the root system. Control plants (negative control) remained symptomless throughout the experiment and exhibited significantly greater root and stem development compared to the inoculated treatments. Microscopical examination of infected tissues revealed the presence of sporangia and oospores in all three tested isolates. Furthermore, successful re-isolation of the original isolates from infected plants (100%) and their subsequent identification through detailed microscopy and morphometry fulfilled Koch's postulates, unequivocally confirming their pathogenicity.

5 Discussion

This study was part of a broader research project aimed at investigating the diversity of Pythium s.l. populations from Iranian aquatic environments. The primary focus of this survey was to study the diversity of Globisporangium species in non-agricultural environments in Iran. We described two new species of Globisporangium, namely G. parvizense sp. nov. and G. sarabense sp. nov., using a multi-gene phylogenetic framework that combined nuclear rDNA ITS sequences with partial sequences of cytochrome c oxidase subunits I and II (cox1 and cox2), supported by morphological assessments. The multi-gene phylogenetic approach enabled a comparative evaluation of the discriminatory robustness of these three genetic markers—ITS, cox1, and cox2—based on their nucleotide-level variation among the newly described species.

The newly described species can be clearly differentiated from previously described species in Globisporangium based on their morphological characteristics. Morphologically, G. parvizense differs from its close relatives in several ways: it lacks zoospores (unlike G. schmitthenneri and G. hypogynum), has a discharge tube (unlike G. acrogynum), possesses one to two antheridia per oogonium (unlike G. schmitthenneri and G. acrogynum), and forms two oospores per oogonium (unlike G. acrogynum and G. hypogynum). Similarly, G. sarabense can be distinguished by its uniquely shaped sporangia, absence of zoospores (unlike G. lucens and G. debaryanum), lack of oogonium chains (unlike G. tabrizense and G. lucens), and presence of a single antheridium and oospore per oogonium (in contrast to G. tabrizense, G. lucens, and G. viniferum).

For G. sarabense, the ITS region exhibited 21 and 15 nucleotide differences compared to G. lucens and G. tabrizense, respectively, making it the most informative marker for distinguishing these species. In contrast, cox1 showed 18 and 17 differences, while cox2 showed 10 and 12, respectively. Thus, while all three loci contributed to species delimitation, ITS provided the highest resolution in this case. Conversely, in G. parvizense, ITS showed only two to three nucleotide differences compared to G. hypogynum, G. schmitthenneri, and G. acrogynum, indicating limited discriminatory power. Cox1 showed four differences, while cox2 showed seven, making cox2 the most informative marker in this lineage.

These findings underscore that the effectiveness of genetic markers can vary across lineages. While ITS proved most effective for G. sarabense, the mitochondrial genes (cox1 and cox2) offered superior resolution for G. parvizense. This highlights (I) the limitations of relying solely on ITS—commonly used as a DNA barcode for oomycetes—which may lack sufficient resolution for some taxa, and (II) the importance of a multi-locus phylogenetic approach for robust species delimitation, providing a deeper understanding of the genetic diversity and evolutionary relationships within Pythium s.l.

The isolation of two novel Globisporangium species from irrigation systems and their positive pathogenicity toward cucumber plants might suggest that such organisms are not merely transient inhabitants but may actively exploit freshwater systems as a means of dispersal, raising concerns about their potential role in introducing plant diseases into agricultural settings. This is particularly important in Iran as it is one of the top cucumber producers globally and grows it widely near rivers and other natural water bodies (Nikolaou et al., 2021).

Moreover, the confirmed pathogenicity of these species on cucumber raises important ecological questions about the ability of aquatic-associated oomycetes to transition from water-associated habitats to terrestrial plant hosts. Although cucumber is not an aquatic plant, its constant exposure to irrigation water, flooding, and high soil moisture creates an ecological bridge that allows aquatic-origin oomycetes to colonize terrestrial crops. This highlights the importance of future research into the environmental adaptability of these pathogens and their potential infection under natural field conditions (Redekar et al., 2020).

The findings of this study highlight the urgent need for systematic monitoring and risk assessment of oomycetes in irrigation systems. If left unchecked, these pathogens could pose a serious threat to food security and sustainable agriculture. Future work should aim to monitor oomycete populations in agricultural water, identify high-risk species, and develop targeted disease management strategies to prevent future outbreaks.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.

Ethics statement

The pathogenicity experiment on cucumber was complied with relevant institutional, national, and international guidelines and legislation. We confirm that all methods were performed in accordance with the relevant guidelines.

Author contributions

RA: Funding acquisition, Resources, Writing – original draft, Formal analysis, Conceptualization, Investigation. AA: Project administration, Formal analysis, Supervision, Conceptualization, Writing – review & editing, Resources, Funding acquisition, Investigation, Writing – original draft. AC: Writing – original draft, Resources, Conceptualization, Supervision, Writing – review & editing, Funding acquisition, Investigation. HM: Investigation, Writing – review & editing, Writing – original draft. H-PG: Funding acquisition, Writing – review & editing, Supervision.

Funding

The author(s) declare that no financial support was received for the research and/or publication of this article.

Acknowledgments

We would like to express our sincere gratitude to the Research Deputy of Azarbaijan Shahid Madani University, Tabriz, Iran, for providing financial support for this project. We also extend our thanks to the East Azerbaijan Agriculture and Natural Resources Research and Education Center for their valuable cooperation throughout the study. We are deeply appreciative of the IGB Leibniz-Institute of Freshwater Ecology and Inland Fisheries for not only providing essential facilities for this project but also facilitating the first author's participation at the institute, which enabled a portion of the research to be conducted there. Finally, we wish to thank Mr. Parviz Ahadi, the father of the first author, for his invaluable assistance during the sampling process. A special thanks to the Research Deputy of Azarbaijan Shahid Madani University, Tabriz, Iran and East Azerbaijan Agriculture and Natural Resources Research and Education Center for funding this project, and IGB Leibniz-Institute of Freshwater Ecology and Inland Fisheries Institute for providing financial support for this study under The German Science Foundation (DFG) Pycnotrap project (GR1540/37-1) given to H-PG. HM gratefully acknowledges support from the Simon's Foundation International as part of the BIOSSCOPE program (http://scope.bios.edu/).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that Gen AI was used in the creation of this manuscript. In the preparation of this manuscript, ChatGPT (OpenAI, 2024) was used exclusively for language editing and improving the clarity of the text. The tool was not used to generate or analyze scientific content. All ChatGPT-assisted edits were manually reviewed and verified for correctness. OpenAI. (2024, March 25). ChatGPT (Mar 25 version) [Large language model; https://chat.openai.com].

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1

    AbdelzaherH. M. A.KageyamaK. (2020). Diversity of aquatic Pythium and Phytopythium spp. from rivers and a pond of Gifu city, Japan. Nov. Res. Microbiol. J.4, 10291044. 10.21608/nrmj.2020.130851

  • 2

    AbdelzaherH. M. A.MorikawaT.IchitanT.ElnaghyM. A. (1995). Classification of Pythium ‘group F'based on mycelial protein and isozyme patterns. Mycoscience36, 4549. 10.1007/BF02268572

  • 3

    AhadiR.BouketA. C.AlizadehA.MasigolH.GrossartH. P. (2024). Globisporangium tabrizense sp. nov., Globisporangium mahabadense sp. nov., and Pythium bostanabadense sp. nov. (Oomycota), three new species from Iranian aquatic environments. Sci. Rep. 14:31701. 10.1038/s41598-024-81651-0

  • 4

    Ali-ShtayehM. S.DickM. W. (1985). Five new species of Pythium (Peronosporomycetidae). Bot. J. Linn. Soc.91, 297317.

  • 5

    Al-SheikhH.AbdelzaherH. M. A. (2012). Occurrence, identification and pathogenicity of Pythium aphanidermatum, P. diclinum, P. dissotocum and Pythium “group P” isolated from Dawmat Al-Jandal Lake, Saudi Arabia. Res. J. Environ. Sci. 6 :196. 10.3923/rjes.2012.196.209

  • 6

    BalaK.RobideauG. P.DésaulniersN.De CockA.LévesqueC. A. (2010). Taxonomy, DNA barcoding and phylogeny of three new species of Pythium from Canada. Persoonia Mol. Phylog. Evol. Fungi25, 2231. 10.3767/003158510X524754

  • 7

    BartonR. (1958). Occurrence and establishment of Pythium in soils. Trans. Br. Mycol. Soc.41, 207222. 10.1016/S0007-1536(58)80033-9

  • 8

    Ben-YephetY.NelsonE. B. (1999). Differential suppression of damping-off caused by Pythium aphanidermatum, P. irregulare, and P. myriotylum in composts at different temperatures. Plant Dis.83, 356360. 10.1094/PDIS.1999.83.4.356

  • 9

    ChenJ. J.ZhengX. B. (2019). Pythium subutonaiense, a new aquatic oomycete from southern china based on morphological and molecular characters. Mycobiology47, 273279. 10.1080/12298093.2019.1642700

  • 10

    Chenari BouketA.ArzanlouM.TojoM.Babai-AhariA. (2015). Pythium kandovanense sp. nov., a fungus-like eukaryotic micro-organism (Stramenopila, Pythiales) isolated from snow-covered ryegrass leaves. Int. J. Syst. Evol. Microbiol. 65, 25002506. 10.1099/ijs.0.000291

  • 11

    DerevninaL.PetreB.KellnerR.DagdasY. F.SarowarM. N.GiannakopoulouA.et al. (2016). Emerging oomycete threats to plants and animals. Philos. Trans. R. Soc. B Biol. Sci.371:20150459. 10.1098/rstb.2015.0459

  • 12

    EllisM. L.PaulP. A.DorranceA. E.BrodersK. D. (2012). Two new species of Pythium, P. schmitthenneri and P. selbyi, pathogens of corn and soybean in Ohio. Mycologia104, 477487. 10.3852/11-162

  • 13

    GhiasiM.KhosraviA. R.SoltaniM.BinaiiM.ShokriH.TootianZ.et al. (2010). Characterization of Saprolegnia isolates from Persian sturgeon (Acipencer persicus) eggs based on physiological and molecular data. J. Mycol. Med.20, 17. 10.1016/j.mycmed.2009.11.005

  • 14

    GohT. K. (1999). Single-spore isolation using a hand-made glass needle. Fungal Divers.2, 4763.

  • 15

    HamlinA. N.LockerS.HuguetE.BerryC. R.ColeR.IvJ. F. G.et al. (2024). Computed tomographic characteristics of confirmed and presumed noncutaneous pythiosis in 25 dogs. Vet. Radiol. Ultrasound65, 8798. 10.1111/vru.13326

  • 16

    HendrixJ. r. F. F. (1974). Taxonomy and genetics of Pythium. Proc. Am. Phytopathol. Soc.30, 200207. 10.5555/19751634442

  • 17

    KageyamaK. (2010). Mycobiota in the subtropical and cool temperate areas in Japan. IFO Res. Commun. Nov. Res. Microbiol. J.24:117.

  • 18

    KatohK.RozewickiA. j.YamadaK. D. (2019). MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinformatics20, 11601166. 10.1093/bib/bbx108

  • 19

    KatohK.StandleyD. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol.30, 772780. 10.1093/molbev/mst010

  • 20

    LévesqueC. A.De CockA. W. A. M. (2004). Molecular phylogeny and taxonomy of the genus Pythium. Mycol. Res.108, 13631383. 10.1017/S0953756204001431

  • 21

    MartinF. N. (2000). Phylogenetic relationships among some Pythium species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase II gene. Mycologia92, 711727. 10.1080/00275514.2000.12061211

  • 22

    MartinF. N.LoperJ. E. (1999). Soilborne plant diseases caused by Pythium spp.: ecology, epidemiology, and prospects for biological control. CRC. Crit. Rev. Plant Sci.18, 111181. 10.1080/07352689991309216

  • 23

    MartinJ. (1992). Cultures in Organizations: Three Perspectives. New York, NY: Oxford University Press. 10.1093/oso/9780195071634.001.0001

  • 24

    MasigolH.KhodaparastS. A.Mostowfizadeh-GhalamfarsaR.MousanejadS.Rojas-JimenezK.GrossartH. P. (2018). Notes on Dictyuchus species (Stramenopila, Oomycetes) from Anzali lagoon, Iran. Mycol. Iran5, 7989. 10.22043/mi.2018.120353

  • 25

    MasigolH.KhodaparastS. A.Mostowfizadeh-GhalamfarsaR.Rojas-JimenezK.WoodhouseJ. N.NeubauerD.et al. (2020). Taxonomical and functional diversity of Saprolegniales in Anzali lagoon, Iran. Aquat. Ecol.54, 323336. 10.1007/s10452-019-09745-w

  • 26

    MasigolH.KhodaparastS. A.WoodhouseJ. N.Rojas-JimenezK.FonvielleJ.RezakhaniF.et al. (2019). The contrasting roles of aquatic fungi and oomycetes in the degradation and transformation of polymeric organic matter. L&O64, 26622678. 10.1002/lno.11242

  • 27

    MasigolH.Mostowfizadeh-GhalamfarsaR.GrossartH. P. (2022). The current status of Saprolegniales in Iran: calling mycologists for better taxonomic and ecological resolutions. Mycol. Iran8, 113. 10.22043/MI.2022.358121.1212

  • 28

    MasigolH.SolbachM. D.PourmoghaddamM. J.AhadiR.Mostowfizadeh-GhalamfarsaR.TaheriS. R.et al. (2025). A glimpse into Oomycota diversity in freshwater lakes and adjacent forests using a metabarcoding approach. Sci. Rep.15:19124. 10.1038/s41598-025-01727-3

  • 29

    MasigolH.van WestP.TaheriS. R.Fregeneda-GrandesJ. M.PârvulescuL.McLagganD.et al. (2023). Advancements, deficiencies, and future necessities of studying Saprolegniales: A semi-quantitative review of 1073 published papers. Fungal Biol. Rev.46:100319. 10.1016/j.fbr.2023.100319

  • 30

    MiddletonJ. T. (1941). Boot rot of barley caused by Pythium hypogynum n. sp. Phytopathology31:863.

  • 31

    MirmazloomiS.GhiasiM.ShirangiS. A.LashgariS. N.KhosraviA. R. (2022). Morphological and molecular characterization of two species of Saprolegnia isolated from a rainbow trout (Oncorhynchus mykiss) hatchery in Iran. Int. Aquat. Res.14:223. 10.22034/iar.2022.1959159.1282

  • 32

    MishraA.ShuklaA.RanaN. P.CurrieW. L.DwivediY. K. (2023). Re-examining post-acceptance model of information systems continuance: a revised theoretical model using MASEM approach. Int. J. Inf. Manag.68:102571. 10.1016/j.ijinfomgt.2022.102571

  • 33

    MöllerE. M.BahnwegG.SandermannH.GeigerH. H. (1992). A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Res.20:6115. 10.1093/nar/20.22.6115

  • 34

    MoritaY.TojoM. (2007). Modifications of PARP medium using fluazinam, miconazole, and nystatin for detection of Pythium spp. in soil. Plant Dis.91, 15911599. 10.1094/PDIS-91-12-1591

  • 35

    Mostowfizadeh-GhalamfarsaR. (2015). The current status of Pythium species in Iran: challenges in taxonomy. Mycol. Iran2, 7987. 10.22043/mi.2015.19901

  • 36

    MuellerG. M. (2011). Biodiversity of Fungi: Inventory and Monitoring Methods. Amsterdam: Elsevier.

  • 37

    NamB.ChoiY.-J. (2019). Phytopythium and Pythium species (Oomycota) isolated from freshwater environments of Korea. Mycobiology47, 261272. 10.1080/12298093.2019.1625174

  • 38

    NguyenH. D. T.DodgeA.DadejK.RintoulT. L.PonomarevaE.MartinF. N.et al. (2022). Whole genome sequencing and phylogenomic analysis show support for the splitting of genus Pythium. Mycologia114, 501515. 10.1080/00275514.2022.2045116

  • 39

    NikolaouG.NeocleousD.ChristouA.PolycarpouP.KittaE.KatsoulasN. (2021). Energy and water related parameters in tomato and cucumber greenhouse crops in semiarid mediterranean regions. A review, part II: irrigation and fertigation. Horticulturae7:548. 10.3390/horticulturae7120548

  • 40

    NzungizeJ. R.LyumugabeF.BusogoroJ. P.BaudoinJ. P. (2012). Pythium root rot of common bean: biology and control methods. A review. Biotechnol. Agron. Soc. Environ. 16, 405413.

  • 41

    PaulB.BalaK. (2008). A new species of Pythium with inflated sporangia and coiled antheridia, isolated from India. FEMS Microbiol. Lett.282, 251257. 10.1111/j.1574-6968.2008.01138.x

  • 42

    PriceM. N.DehalP. S.ArkinA. P. (2010). FastTree 2–approximately maximum-likelihood trees for large alignments. PLoS ONE5:e9490. 10.1371/journal.pone.0009490

  • 43

    RahmanM. Z.AbdelzaherH. M. A.MingzhuL.MotohashiK.SugaH.KageyamaK. (2015). Pythium rishiriense sp. nov. from water and P. alternatum sp. nov. from soil, two new species from Japan. FEMS Microbiol. Lett.362:fnv086. 10.1093/femsle/fnv086

  • 44

    RedekarN. R.BourretT. B.EberhartJ. L.JohnsonG. E.PittonB. J. L.HaverD. L.et al. (2020). The population of oomycetes in a recycled irrigation water system at a horticultural nursery in southern California. Water Res.183:116050. 10.1016/j.watres.2020.116050

  • 45

    RobertsD. P.LakshmanD. K.McKennaL. F.EmcheS. E.MaulJ. E.BauchanG. (2016). Seed treatment with ethanol extract of Serratia marcescens is compatible with Trichoderma isolates for control of damping-off of cucumber caused by Pythium ultimum. Plant Dis.100, 12781287. 10.1094/PDIS-09-15-1039-RE

  • 46

    RobideauG. P.De CockA. W. A. M.CoffeyM. D.VoglmayrH.BrouwerH.BalaK.et al. (2011). DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Mol. Ecol. Resour. 11, 10021011. 10.1111/j.1755-0998.2011.03041.x

  • 47

    RonquistF.TeslenkoM.Van Der MarkP.AyresD. L.DarlingA.HöhnaS.et al. (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol.61, 539542. 10.1093/sysbio/sys029

  • 48

    SalmaninezhadF.AloiF.PaneA.Mostowfizadeh-GhalamfarsaR.CacciolaS. O. (2022). Globisporangium coniferarum sp. nov., associated with conifers and Quercus spp. Fungal Syst. Evol.10, 127137. 10.3114/fuse.2022.10.05

  • 49

    SalmaninezhadF.Mostowfizadeh-GhalamfarsaR. (2017). Taxonomy, phylogeny and pathogenicity of Pythium species in rice paddy fields of Fars Province. Iran. J. Plant Pathol. 53, 3150.

  • 50

    SalmaninezhadF.Mostowfizadeh-GhalamfarsaR. (2019). Three new Pythium species from rice paddy fields. Mycologia111, 274290. 10.1080/00275514.2018.1543486

  • 51

    SalmaninezhadF.Mostowfizadeh-GhalamfarsaR. (2022). The current status of Globisporangium species in Iran: from Pythium sensu lato to Newly Described Species. Mycol. Iran.9, 114. 10.22092/MI.2022.359205.1221

  • 52

    SalmaninezhadF.Mostowfizadeh-GhalamfarsaR. (2023). The current status of Phytopythium species in Iran: challenges in identification of an intermediate taxon. Mycol. Iran10, 112. 10.3390/jof10060405

  • 53

    ShrevesK. V.SaraivaM.RubaT.MillerC.ScottE. M.McLagganD.et al. (2024). Specific phylotypes of Saprolegnia parasitica associated with atlantic salmon freshwater aquaculture. J. Fungi10:57. 10.3390/jof10010057

  • 54

    SigilloL.PaneC.GaragusoI.LuongoL.GalliM.ValenteM. T.et al. (2020). First report of Pythium spinosum as a causal agent of crown and root rot in greenhouse cucumber cultivation in Italy. Plant Dis.104:3269. 10.1094/PDIS-02-20-0305-PDN

  • 55

    StamatakisA. (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics30, 13121313. 10.1093/bioinformatics/btu033

  • 56

    TamuraK.StecherG.PetersonD.FilipskiA.KumarS. (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol.30, 27252729. 10.1093/molbev/mst197

  • 57

    UzuhashiS.KakishimaM.TojoM. (2010). Phylogeny of the genus Pythium and description of new genera. Mycoscience51, 337365. 10.1007/S10267-010-0046-7

  • 58

    UzuhashiS.OkadaG.OhkumaM. (2015). Four new Pythium species from aquatic environments in Japan. Antonie van Leeuwenhoek. Int. J. Gen. Mol. Microbiol.107, 375391. 10.1007/s10482-014-0336-8

  • 59

    Van der Plaats-NiterinkA. J. (1981). Monograph of the genus Pythium. Stud. Mycol.21, 1240.

  • 60

    VillaN. O.KageyamaK.AsanoT.SugaH. (2006). Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and -tubulin gene sequences. Mycologia98, 410422. 10.3852/mycologia.98.3.410

  • 61

    WatkinsonS. C.BoddyL.MoneyN. (2015). The Fungi, 3rd Edn. Waltham, MA: Academic Press.

  • 62

    WhiteT. J.BrunsT.LeeS.TaylorJ. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. Guid. Methods Appl.18, 315322. 10.1016/B978-0-12-372180-8.50042-1

  • 63

    ZhangJ.SunX.AoN.ZouH.ShaoH.KageyamaK.et al. (2023). Host range and loop-mediated isothermal amplification detection of Globisporangium sylvaticum from Guizhou, China. J. Fungi9:752. 10.3390/jof9070752

Summary

Keywords

aquatic oomycetes, plant parasites, Pythium sensu lato, systematics, taxonomy

Citation

Ahadi R, Alizadeh A, Chenari Bouket A, Masigol H and Grossart H-P (2025) Multigene phylogeny, morphology, and pathogenicity uncover two novel Globisporangium species (Oomycota) from freshwater habitats in northwestern Iran. Front. Microbiol. 16:1615096. doi: 10.3389/fmicb.2025.1615096

Received

20 April 2025

Accepted

30 June 2025

Published

06 August 2025

Volume

16 - 2025

Edited by

Samantha Chandranath Karunarathna, Qujing Normal University, China

Reviewed by

Danfeng Bao, Mae Fah Luang University, Thailand

Jian Ma, Mae Fah Luang University, Thailand

Updates

Copyright

*Correspondence: Alireza Alizadeh Hans-Peter Grossart

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics