Abstract
The rising prevalence of blaKPC-harboring Pseudomonas aeruginosa (KPC-PA) is a significant threat to public health. In the study, we identified a carbapenem-resistant P. aeruginosa (CRPA; PAE3) from a patient with pneumonia infection. The resistance phenotype was analyzed using the broth microdilution method. Whole-genome sequencing was performed to sequence type (ST), resistance genes, plasmid replicon, and the genetic environment of the blaKPC-2 gene. The other 75 Pseudomonas aeruginosa (PA) isolates with chromosome- or plasmid-borne blaKPC gene were used to analyze the mobilized characterization of blaKPC gene in PA from a global perspective. The result revealed PAE3 belonged to ST463 and exhibited multidrug resistance, which is the first report of PA harboring a chromosome-borne blaKPC-2 gene located within a Tn1721-like transposon in South China. In total, 76 KPC-PA strains were identified from 7 countries, representing 6 distinct blaKPC variants—blaKPC-2, blaKPC-3, blaKPC-33, blaKPC-87, blaKPC-90, and blaKPC-113—with the majority located within transposons such as Tn1403, Tn1721, Tn4401, or Tn6296-like elements. A total of 63 blaKPC-positive plasmids evolved into different phylogenetic clades in China and other countries, indicating clonal transmission and regional evolution. The dissemination of blaKPC is primarily observed in three distinct forms in ST463 KPC-PA in China: (1) plasmid-mediated transfer associated with Tn6296-like transposon; (2) Tn1721, and (3) the IS26-ISKpn27-blaKPC-2-ISKpn6 structural arrangement, which is integrated into both plasmid and chromosome. In contrast, Tn4401 is commonly observed in Europe and the United States, predominantly emerging in ST235. This study represents the valuable systematic classification of the transposons associated with the spread of blaKPC and offers new insights into the mobilized genetic platforms that contributed to the global dissemination of carbapenem resistance in PA.
Introduction
Pseudomonas aeruginosa (PA) is an opportunistic pathogen that thrives in individuals with weakened immune systems, particularly those in intensive care units (ICUs) (; ). This versatile bacterium is responsible for a range of infections, including pneumonia, urinary tract infections, and bloodstream infections, and is increasingly difficult to treat due to its remarkable resistance to multiple classes of antibiotics (; ). Among these, the resistance to carbapenems—powerful broad-spectrum antibiotics used as a last line of defense—poses a significant therapeutic challenge (). Carbapenem-resistant PA develops primarily through two mechanisms: (1) the alteration of outer membrane permeability through loss of porin OprD, enhancing antibiotic efflux (MexAB-OprM and MexXY–OprM) and mutation of target penicillin-binding proteins (PBPs); (2) the acquisition of carbapenemase genes, which encode enzymes capable of hydrolyzing and inactivating carbapenems (; ; Tenover et al., 2022). These resistance genes are frequently found on mobile genetic elements (MGEs), including plasmids, transposons, integrons, and genomic islands, which facilitate the horizontal transfer of resistance between bacteria (; Yoon and Jeong, 2021). To date, several families of carbapenemases associated with MGEs have been identified in PA ().
One of the most concerning is the Klebsiella pneumoniae (KP) carbapenemase (blaKPC), a class A carbapenemase that has emerged as a major contributor to resistance worldwide (; ; Wang et al., 2024). The blaKPC variants are prevalent in diverse Gram-negative bacilli, predominantly K. pneumoniae (73.8%), followed by Enterobacter hormaechei (7.1%), Escherichia coli (6%), and Enterobacter cloacae (5.5%), but are rare in PA (). Although most linked to K. pneumoniae (especially the pandemic ST258 clone), blaKPC in PA remains a significant threat (Wang et al., 2024; Yu et al., 2018). The blaKPC gene has been identified in various PA sequence types (STs), including ST463, ST235, ST654, ST1006, and ST1212. Notably, ST463 PA gained attention due to its association with particularly severe infections and higher mortality rates (). The ST463 blaKPC-positive PA (KPC-PA) has shown a numerical dominance and regional prevalence in China, particularly in Zhejiang Province. ST463 is known for its increased virulence and its ability to acquire a diverse range of MGEs, facilitating the spread of various resistance genes, including carbapenemase genes ().
The blaKPC gene was initially linked to the 10 kb Tn4401 transposon in the United States, which contains a transposase gene (tnpA), a resolvase gene (tnpR), and two insertion sequences (ISs), ISKpn6 and ISKpn7, in addition to the β-lactamase gene blaKPC-2, which is highly mobile, enabling the gene to spread rapidly within bacterial populations (; ; )[8]. In China, however, the blaKPC-2 variant is frequently found within the Tn1721 transposon, which shares similar transposase and resolvase genes but is distinct in its structure and mobility (; ; Yuan et al., 2021). Additionally, Tn1403, a transposon identified in Pseudomonas species, plays a significant role in the dissemination of resistance genes and is categorized within the Tn21 subfamily of the Tn3 family (; Vezina and Levesque, 1991). Separated by an identical backbone, the accessory regions of these four plasmids were composed of two IS26-associated modules, namely, the IS26-blaKPC-2-IS26 and IS26-Tn6376-IS26, which originated from Tn6296. The blaKPC-2 gene in Tn6296 was flanked by ISKpn27 and ISKpn6, followed by the korC-orf6-klcA-repB gene ().
The blaKPC gene is predominantly disseminated in PA via transposition, frequently co-existing with other ISs or transposases, thereby creating a complex antibiotic resistance gene landscape. Clonal lineages such as ST463 are notably prevalent in specific geographical areas, with blaKPC-harboring strains typically exhibiting heightened resistance and virulence. In this study, we described the multidrug resistance and genomic features of blaKPC-2-positive PA isolate (PAE3), belonging to ST463, and integrated 75 plasmid-borne blaKPC PA strains from the public database to demonstrate the mobilized platform characterization of the blaKPC gene in PA. This comprehensive analysis aims to enhance our understanding of the genetic mechanisms underlying the development and global spread of carbapenem resistance in PA, with important implications for public health and antimicrobial resistance management.
Materials and methods
Bacterial collection
We used the specific primers KPC-F: TGTCACTGTATCGCCGTC and KPC-R: CTCAGTGCTCTACAGAAAACC to screen for 100 CRPA strains and identified the PAE3 strain that produces KPC. The strain PAE3 was obtained from the sputum sample of a 90-year-old patient with severe pneumonia in the intensive care unit of the Second Affiliated Hospital of Guangzhou Medical University in November 2023. It was identified using the VITEK-2 COMPACT automatic microbial identification system (bioMérieux, Marcy-l’Étoile, France).
Antimicrobial susceptibility test
Antimicrobial susceptibility testing of PAE3 was performed using the broth microdilution method, which contained 50 μL of drugs, and 50 μL inoculum of 5 × 105 CFU/mL concentration was added to 96 well plates and incubated in Mueller Hinton Broth at 35 °C for 18 h. The antimicrobial agents included ceftazidime, cefepime, imipenem, meropenem, ciprofloxacin, levofloxacin, amikacin, tobramycin, colistin, ceftazidime–avibactam, piperacillin-tazobactam, and ticarcillin-clavulanic acid. The results for colistin were confirmed according to EUCAST SOP 10.2, and the other results were interpreted based on the CLSI 2025 M100 (Table 1).
Table 1
| Antibiotics | MIC (μg/mL) | Interpretation | Interpretive categories of MIC (μg/mL) | Standard reference document | |||
|---|---|---|---|---|---|---|---|
| Categories | Name | Susceptible (S) | Intermediate (I) | Resistance (R) | |||
| Cephalosporins | Ceftazidime | 16 | I | ≤4 | 8 | ≥16 | CLSI 2025 M100 |
| Cefepime | ≥32 | R | ≤2 | 4–8 | ≥16 | CLSI 2025 M100 | |
| Carbapenems | Imipenem | ≥16 | R | ≤1 | 2 | ≥4 | CLSI 2025 M100 |
| Meropenem | ≥16 | R | ≤1 | 2 | ≥4 | CLSI 2025 M100 | |
| Quinolones | Ciprofloxacin | ≥4 | R | ≤0.25 | 0.5 | ≥1 | CLSI 2025 M100 |
| Levofloxacin | ≥8 | R | ≤0.5 | 1 | ≥2 | CLSI 2025 M100 | |
| Aminoglycosides | Amikacin | ≤2 | S | ≤4 | 8 | ≥16 | CLSI 2025 M100 |
| Tobramycin | ≥16 | R | ≤2 | 4 | ≥8 | CLSI 2025 M100 | |
| Polymyxins | Colistin | 2 | S | ≤2 | ≥4 | EUCAST SOP 10.2 | |
| β-lactam/β-lactamase inhibitor combinations | Piperacillin-tazobactam | ≥64/4 | R | ≤8/4 | ≥32/4 | CLSI 2025 M100 | |
| Ticarcillin-clavulanate | ≥128 | R | ≤16/2 | 32/2–64/2 | ≥128/2 | CLSI 2025 M100 | |
Minimum inhibitory concentration (MIC) values of PAE3.
S, susceptible; R, resistant; I, intermediate.
Whole genome sequencing and bioinformatics analysis
Whole genome sequencing of PAE3 was performed using paired-end sequencing with Illumina Novaseq (2×150 bp paired-end reads), and long sequencing was performed with PacBio Sequel II by Shanghai Biozeron Biotechnology Co., Ltd. (Shanghai, China). PacBio reads were assembled using Unicycler v0.4.8 (https://github.com/rrwick/Unicycler) and polished by Pilon v1.22m (https://github.com/broadinstitute/pilon) with default parameters (Walker et al., 2014). The assembled genome of P. aeruginosa strain PAE3 was submitted to the NCBI GenBank database and annotated using the NCBI Prokaryotic Annotation Pipeline (; Tatusova et al., 2016). For PAE3 and other KPC-PA strains, multilocus sequence typing (MLST) was performed using MLST v2.0 (https://cge.food.dtu.dk/services/MLST/) (). Antimicrobial resistance genes (ARGs) and plasmid incompatibility types were identified using ResFinder v4.6.0 (http://genepi.food.dtu.dk/resfinder) () and PlasmidFinder v2.1 (https://cge.food.dtu.dk/services/PlasmidFinder/), (), respectively, with default thresholds. The oriTfinder2 (https://tool2-mml.sjtu.edu.cn/oriTfinder/oriTfinder) () was utilized to predict plasmid mobility by identifying the origin of transfer (oriT) and other related components under the default parameters..
Genetic environment analysis of blaKPC in PA
We performed MegaBLAST (https://doi.org/10.1093/bioinformatics/btn322) analysis of the blaKPC-2 gene sequence against the GenBank nonredundant (nr) P. aeruginosa (taxid: 287) database (on 23 April 2024) to identify 75 KPC-PA isolates harboring blaKPC, applying thresholds of 100.00% coverage and > 99.00% identity (Supplementary Table S1). The variants of blaKPC genes were further analyzed using the CARD database () and the BLDB database (). The ISs and transposons (Tn) adjacent to the ARGs were identified using ISfinder () with default parameters. Easyfig 2.2.5 (Sullivan et al., 2011) was used to visualize the genetic context of blaKPC genes. The presence/absence of orthologous gene families of the blaKPC-positive plasmids in PA was analyzed using the phylogenetic cladogram. A binary gene presence/absence matrix was built using Orthofinder 2.5.4 () with predefined parameters and visualized through iTOL 6.8.1 ().
Results
Antibiotic resistance profiles and genomic characterization of PAE3
Antimicrobial susceptibility testing results highlighted that PAE3 exhibited resistance to cephalosporins (Cefepime), carbapenems (imipenem and meropenem), quinolones (ciprofloxacin and levofloxacin), aminoglycosides (amikacin and tobramycin), and β-lactam/β-lactamase inhibitor combinations (piperacillin-tazobactam and ticarcillin-clavulanate). In addition, it exhibited intermediate resistance to ceftazidime and susceptibility to colistin and ceftazidime-avibactam (Supplementary Table S1).
The complete sequenced genome of PAE3 consists of a 7,073.5 kb chromosome and a 3,292-bp plasmid pPAE3. Key genomic features include the following: a total of 6,617 genes (with 6,459 coding genes) and 6,537 coding sequences (CDSs) in total (6,537 of which encode proteins); a GC content of 65.79%; an N50 contig length of 8,889 bp; and an average sequencing depth of 399.3×. MLST analysis revealed that PAE3 belonged to ST463. PAE3 harbored chromosome-borne ARGs, including ant(2″)-Ia, aac(6′)-IIa, blaCARB-2, sul1, blaKPC-2, blaPAO, aph(3′)-IIb, blaOXA-486, and crpP (Figure 1). However, the plasmid pPAE3 did not carry acquired ARG genes. The small plasmid pPAE3 was characterized as mobilizable by oriTfinder2 analysis, which detected a 38-bp oriT (coordinates 3173.0.3210) and an associated relaxase gene belonging to the MOBV family. There is a multidrug-resistant (MDR) region located on the chromosome, which contains intI1 with resistance gene cassettes ant(2″)-Ia-aac(6′)-IIa-blaCARB-2-qacE∆1-sul1 flanked by TnAs3 and ∆IS6100-TnAs2 (Figure 2A). This MDR region displayed 100.00% coverage and 99.78% identity of the segment in HS18-89 PA (CP084321), which is also present in other bacterial species such as Achromobacter xylosoxidans, Shewanella xiamenensis, and Leclercia adecarboxylata. The blaKPC-2 gene was located on a Tn1721-mediated~10 kb transposition unit, with IS26-∆ISKpn27-Tn3-Tn2-∆ISKpn27 located upstream and truncated ∆ISKpn6 located downstream of blaKPC-2 (Figure 2B), which was nearly identical to plasmid p1011-KPC2 (100.00% coverage and 99.78% identity). According to current knowledge, PAE3 is the first reported Tn1721 transposon harbored on the chromosome of PA ST463, identified in South China.
Figure 1
Figure 2
Overview of the 76 KPC-PA strains
In total, 75 KPC-PA with clear genetic location (plasmid or chromosome) were used to conduct further analysis (Table 2). For some KPC-PA strains with incomplete data, we supplemented information on their ST types and geographic distribution by consulting relevant literature. All data used in this study were derived from authentic sequences in the NCBI database that provided reliable and accurate analysis information. The isolation dates of a total of 76 KPC-PA strains spanned from 2006 to 2024. Since 2015, the detection rate of KPC-PA has significantly increased and is closely associated with the transmission of mobile genetic platforms carried by this clonal strain.
Table 2
| Numbers of strains | Genetic structure | Variants of blaKPC | MLST | Country | Numbers in chromosome | Numbers in plasmid | Copies in one strain |
|---|---|---|---|---|---|---|---|
| 15 | Tn1403 | blaKPC-2, blaKPC-3, blaKPC-33, blaKPC-113 | ST463, ST485, ST244, ST664, ST1076, ST3504, ST3761, ST1212, ST3903 | China | 2 | 13 | 1 |
| 10 | Tn1721 | blaKPC-2 | ST463 | China | 5 | 5 | 1 |
| 11 | Tn4401 | blaKPC-2, blaKPC-3, blaKPC-31, blaKPC-33 | ST111, ST312, ST235, ST654 | Argentina, Chile, Brazil, France, Colombia, Ecuador | 4 | 7 | 1 or 2 |
| 8 | Tn6296-like | blaKPC-2 | ST463 | China | 0 | 8 | 1 or 2 |
| 14 | IS26-∆ISKpn27-blaKPC-2-∆ISKpn6 | blaKPC-2, blaKPC-33, blaKPC-90 | ST463 | China | 6 | 8 | 1–5 |
| 6 | ∆ISKpn6-blaKPC-2-Tn3-ISKpn27-Tn3-Tn2 | blaKPC-2, blaKPC-87 | ST697, ST235, ST270, ST635 | China, Argentina, Colombia | 0 | 6 | 1 or 2 |
| 3 | IS26-∆IS26-Tn3-ISKpn27-blaKPC-2-IS26 | blaKPC-2 | ST463 | China | 0 | 3 | 1 |
| 13 | Others | blaKPC-2 | ST234, ST244, ST316, ST381, ST463, ST1006, ST1976, ST3503 | Brazil, Colombia, China | 0 | 13 | 1 or 2 |
Summary of the blaKPC genetic context in 76 KPC-PA.
Among total strains, blaKPC-2, detected in 81.9% strains, was the most prevalent variant, followed by blaKPC-3 (n = 3), blaKPC-33 (n = 2), blaKPC-87 (n = 1), blaKPC-90 (n = 1), and blaKPC-113 (n = 1). The global dissemination of KPC-PA exhibits distinct geographic patterns Figure 2). The major countries included China (n = 57, 75%), followed by Colombia (7, 9.2%), Brazil (4, 7.0%), Argentina (3, 5.3%), and Chile (3, 5.3%) (Figure 3). A total of 24 distinct STs were identified, with ST463 (33/76), ST235 (4/76), and ST654 (4/76) accounting for the top three STs. The ST463 KPC-PA lineage was the most prevalent genotype in China (57.9%), and ST654 was prevalent in South American countries such as Argentina, Brazil, and Chile. The ST235 and ST311 lineages were primarily reported in Colombia and ST66 in France. Certain STs (e.g., ST4 and ST48) appear globally distributed, whereas others (e.g., ST1070 in China and ST277 in Brazil) are regionally restricted.
Figure 3
Genetic mapping of the blaKPC gene in PA
In 76 KPC-PA isolates, 13 strains (from No.1 to No.13 in Supplementary Table S1) contained the chromosome-borne blaKPC gene. A total of 5 strains (38.5%) were associated with a Tn1721 transposon variant, 4 strains (30.8%) with a Tn4401 structure, and 2 strains (15.4%) with a Tn1403 transposon. PAE3 and the other 4 KPC-PA strains containing Tn1721-like transposons (NDTH9845, NDTH7329, HS18-89, and PA12) all belong to the ST463 PA from China. In total, 2 strains harboring Tn1403 transposons (SRRSH15 and SRRSH1521) belong to the ST244 from Hangzhou, China, and 4 strains, 24Pae112, M27432, 34Pae36, and HDR5_1, containing Tn4401 transposons, belong to ST235 (Colombia), ST235 (Argentina), ST111 (Colombia), and ST316 (Ecuador), respectively.
In total, 63 strains (from No.14 to No.76 in Supplementary Table S1) harbored plasmid-mediated blaKPC gene; 5 strains (7.94%) contained elements corresponding to a Tn1721 transposon variant; 7 strains (11.1%) aligned with the Tn4401 transposon; 13 strains (20.6%) indicated blaKPC within a Tn1403 structure; 8 strains (12.7%) harbored a Tn6296-like transposon; and 1 plasmid (pCCBH28525_KPC) was associated with Tn5501 transposon (Supplementary Table S1) (). The phylogenetic tree of the 63 blaKPC-harboring plasmids demonstrated that most isolates were clustered into three primary clades and named as I–III (Figure 4).
Figure 4
Clade I comprised 18 plasmids, ranging from 29.40 to 44.43 kb (Figure 4). These plasmids were mainly identified in ST463 and geographically distributed in China. Four copies of blaKPC-2, two blaKPC-33, and one blaKPC-90 harboring plasmids were also classified into clade I. For the conjugative transfer regions, the genes encoding T4CPs of VirD4/TraG subfamily were characterized by the domain “TrwB_AAD_bind (PF10412)”but no relaxase and T4SS gene clusters were identified, inferred to be putative non-conjugative plasmids (Figure 3). The blaKPC gene was mainly located on the composite transposon “IS26-ISKpn27-Tn3-IS26-∆IS26-Tn3-ISKpn27-blaKPC-∆ISKpn6” and two copies of blaKPC-2 harboring four plasmids comprised the transposon “∆ISKpn6-blaKPC-2-ISKpn27-Tn3-∆Tn2-IS26-∆IS26-∆Tn2-Tn3-ISKpn27-blaKPC-2-∆ISKpn6” (Figure 1 and Table 2).
Clade II included 12 blaKPC-2-harboring, 1 blaKPC-3-harboring, and 1 blaKPC-113-harboring plasmids, with lengths ranging from 48.31–106.7 kb (Figure 4). Major plasmids carried single ARG and genes encoding T4CP or T4SS, while no genes related to the release of the MOBP family were detected (Figure 3). Plasmids in clade II were not mobilizable according to the structure of conjugative transfer regions. In total, 13 plasmids (92.86%) were geographically found in China, which included ST463, ST1212 (n = 3), ST11 (n = 1), ST3761 (n = 1), and ST3903 (n = 1). The blaKPC gene located on plasmids of clade II was characterized by “ISKpn27-blaKPC-∆ISKpn6” (Figure 3).
Clade III comprised 10 MDR plasmids with lengths ranging from 392.2 to 510.711 kb, which were only discovered in China, including blaKPC-2-harboring, blaKPC-3-harboring, blaKPC-33-harboring, and blaKPC-87-harboring plasmids (Figure 4 and Supplementary Table S2). All plasmids contained only one single-replicon, one plasmid with IncU replicons, and the other plasmids with unknown replicons. Most plasmids belonging to clade III had no genes encoding relaxase, T4CP, or T4SS, inferred to be putative non-conjugative plasmids (Figure 3).
Genetic platforms mobilizing blaKPC gene in PA
blaKPC within Tn1403 transposon in KPC-PA
A total of 15 blaKPC MGEs from 15 strains were classified into the Tn1403 transposon, including 2 from the chromosome and 13 contained in plasmids. Members of this group were narrowly geographically distributed in China and belonged to ST244, ST463, ST485, ST664, ST1076, ST3504, ST3761, ST1212, and ST3903 (Table 2). Among all KPC-PA strains, there were 12 blaKPC-2-, 1 blaKPC-3, 1 blaKPC-33, and 1 blaKPC-113 harboring strains, which were classified as part of the Tn1403 cluster. Notably, each strain harboring Tn1403 transposons carried exactly one copy of the blaKPC gene. We explored the genetic environment surrounding the blaKPC genes located on the composite transposon Tn1403, which comprises a highly conserved region “IS6100-∆Tn3-ISKpn27-blaKPC-2-∆ISKpn27,” as well as four additional elements upstream of the tnpR and tnpA (Figure 5A).
Figure 5
blaKPC within Tn1721-like transposons harboring in KPC-PA
The blaKPC-2 MGEs from 10 strains were classified into the Tn1721 cluster, which exhibited an equal division between chromosomes and plasmids (Table 2). The PAE3 strain also contained the blaKPC-2 gene with the composite transposon Tn1721 (Figure 5C). We explored the genetic context associated with the blaKPC-2 gene within Tn1721, which carried the conserved structure of “tnpATn1721-tnpRTn1721-IS26-∆Tn3-ISKpn27-blaKPC-∆ISKpn6.” Notably, all the strains classified into the Tn1721 group were detected in China and belonged to ST463. In the KPC-PA, the combination of chromosomal carriage and Tn1721 has been identified. The genetic environment of the blaKPC gene is not totally identical, and the primary difference from the closest sequences is the inversion of Tn3 and Tn2.
blaKPC within Tn4401 transposon in KPC-PA
Out of all the strains, the genetic structures surrounding blaKPC (plasmid or chromosome) in 11 strains contain the Tn4401-like transposon. Among these isolates, 4 strains contained the blaKPC gene in the chromosome and 7 strains harbored blaKPC within a plasmid structure (Table 2). The genetic context surrounding the blaKPC-2 genes within Tn4401 carried the conserved structure of “tnpATn4401-tnpRTn4401-ISKpn7-∆ISKpn7-blaKPC-2-ISKpn6” (Figure 5B). This genetic structure, commonly observed in ST235 and ST654, was widely distributed in Chile, Colombia, Argentina, and Ecuador (Table 2). Thus, the blaKPC gene within Tn4401 in PA was predominantly detected in Europe and the Americas, with a rare report in Asia.
blaKPC-2 within Tn6296-like transposon in KPC-PA
The blaKPC-2 genetic platform was identified in 8 strains of Tn6296-like transposon in China (Figure 4D). All blaKPC-2 genes were plasmid-borne and carried by ST463 PA. Additionally, 4 strains contained 2 symmetrically arranged copies of blaKPC-2 (Table 2 and Figure 5D).
The genetic context of blaKPC lacking a typical transposon structure in a plasmid
In total, 14 strains harbored 21 blaKPC-2, 1 blaKPC-33, and 1 blaKPC-90 genes, which were flanked by ISKpn6/∆ISKpn6 and ISKpn27-IS26, and no typical transposase enzymes were identified near blaKPC (Figure 6A). This genetic structure exhibited high copy numbers within individual strains (with up to five identical copies) and was prevalent in ST463 PA in China (Table 2). A total of 6 strains carried distinct genetic blaKPC gene clusters, characterized by a conserved genomic architecture with truncated ISKpn6 elements flanking an intact Tn3-Tn2 transposon (Figure 6B). These strains are distributed in China, Argentina, and Colombia, which represent diverse STs, including ST270, ST697, ST235, and ST635 (Table 2). Moreover, 3 ST463 PA strains contained the blaKPC-2 gene within the structure “IS26-∆IS26-Tn3-ISKpn27-blaKPC-2-IS26” and formed a distinct cluster in this study (Figure 6C and Table 2). There were still 13 strains that could not be classified into specific groups but shared the common feature of truncated ISKpn6 elements flanking the blaKPC gene. Remarkably, the CCBH28525 strain from Brazil presented 2 copies of the blaKPC gene flanking a central region containing transposase and resolvase genes of the Tn5501 family (Figure 6D).
Figure 6
Discussion
The emergence and spread of MDR bacteria in recent years have posed significant challenges to the clinical management of bacterial infections. IntI1 commonly harbors multidrug resistance gene cassettes and can be transferred via mobile genetic elements, with the incidence ranging from 22 to 59% (). The intI1 is frequently linked to resistance genes, including ant(2″)-Ia, aac(6′)-IIa, blaCARB-2, qacE∆1, and sul1, which are flanked by transposons (TnAs3 and ∆IS6100-TnAs2) and integrated into the chromosome of P. aeruginosa (). The conservation of specific gene clusters across bacterial species suggests the occurrence of horizontal gene transfer, which facilitates the spread of antibiotic resistance (; ).
The global spread of carbapenem resistance among Gram-negative bacteria is driven by the horizontal transfer of resistance genes via active transposons and diverse plasmids, including blaOXA-232, blaIMP-4, and blaVIM-71 (; Zheng et al., 2024; Zheng et al., 2023). This mechanism facilitates the rapid dissemination of carbapenemases such as blaKPC, contributing to their widespread prevalence in different regions (; ). However, the blaKPC gene exhibited similar transmission patterns between carbapenem-resistant KP and PA, while the primary differences were observed in clonal diversity, regional prevalence, resistance gene profiles, and clinical symptoms. The dissemination of the blaKPC gene in KP typically exhibits a broader geographical distribution, whereas KPC-PA specifically demonstrates a regional prevalence. In the Pearl River Delta region, the presence of plasmid-mediated KPC-PA has only been documented by Professor Chen Dingqiang from Zhujiang Hospital in 2021 (Wang et al., 2021). To the best of our knowledge, this study is the first to identify chromosomally mediated KPC-PA in South China, representing a significant advancement in the understanding of this pathogen (Wu et al., 2021; Yuan et al., 2021; Zhang et al., 2022). We conducted a comprehensive genomic investigation of the carbapenem-resistant PAE3 strain, which carries the blaKPC-2 gene, and characterized the genetic determinants mediating horizontal transfer of resistance genes. To further understand the global dissemination of KPC-PA, we systematically analyzed blaKPC gene variants, genetic contexts, and the distribution patterns of 76 KPC-PA strains, which vary across countries and span a broad temporal range (2006–2024). The results provided novel insights into: (1) the role of mobile genetic platforms in facilitating the blaKPC gene in PA and (2) the molecular epidemiology of KPC-PA. Through our study, 7 distinct blaKPC gene variants (blaKPC-2, blaKPC-3, blaKPC-31, blaKPC-33, blaKPC-87, blaKPC-90, and blaKPC-113), 4 predominant transposon types (Tn1403, Tn1721, Tn4401, and Tn6296-like), and 24 STs across seven different countries were discovered. The blaKPC-2 gene is commonly associated with the Tn1721-, Tn1403-, and Tn6296-like transposon structures in PA strains from Eastern China. In contrast, the spread of the blaKPC-2 gene in the Americas, Europe, and other regions was mediated by the Tn4401 transposon (). Notably, the Tn1721 transposon structure is uniquely detected in ST463 PA strains, which were integrated into both chromosomes and plasmids (Zhang et al., 2023). Our findings indicate that the blaKPC gene carried by the Tn1721 transposon in ST463 PA exhibits a high prevalence in China. Our study suggests that the blaKPC gene harbored within the Tn1721 transposon could contribute to the adaptability of PA against diverse environmental conditions across Eastern China, which is also predominantly found in K. pneumoniae and other Enterobacteriaceae in China (; ; Tang et al., 2017). Furthermore, blaKPC-producing PA strains could be involved in the emergence and spread of multidrug resistance, potentially in combination with other carbapenem genes, including blaVIM and blaIMP (; Tenover et al., 2022).
The Tn3-family transposon Tn4401 is an important mobile genetic element of the blaKPC gene and was identified in all isolates. Tn1403 transposon was initially recovered from a MDR clinical PA strain recognized in the United States in 1973–1974 (Vezina and Levesque, 1991). The tnpA and tnpR genes of Tn1403 exhibited 97.4 and 39.9% similarity to those of Tn1721, respectively. Tn6296 is also a common transposon and is formed by the insertion of the “core blaKPC platform” of Tn1722. This insertion truncates the mcp gene of Tn1722 to an incomplete structure. The genetic environment of Tn6296 is modulated by elements such as IS26, which may lead to more complex changes in the transposon structure related to the blaKPC gene. In addition, Tn6296 exhibits structural conservation with other transposons such as Tn3, but harbors distinct features for the dissemination and evolution of resistance genes (Yuan et al., 2021). IS26 contributes to the mobilization of resistance genes into the gene pool by forming transposons (; Tang et al., 2024). The presence of IS26 in this study is notable, as it could mediate diverse mobilization mechanisms. Specifically, IS26 has been shown to facilitate the mobilization of adjacent genes independent of transposase enzymes, potentially reshaping intergenic regions (; ). In MDR PA strains, IS26 is predominantly present as multiple copies, with directly oriented elements forming pseudocomposite transposons (PCTns). IS26, belonging to the IS6 family, often appears as multiple copies in the MDR PA strains, which, when oriented, form a composite transposon called pseudocomposite transposon (PCTn) and facilitate horizontal gene transfer through cointegration of donor and recipient DNA (Tang et al., 2024).
In response to the crisis of KPC-PA, a new generation of β-lactam/β-lactamase inhibitor combinations, including ceftazidime-avibactam, imipenem-relebactam, and meropenem-vaborbactam, have become vital therapeutic options. These agents target and inhibit KPC and effectively restore susceptibility by large retrospective analysis and ceftazidime-avibactam could inhibit PAE3 in vivo (; ; ). There are several limitations here: our study focused only on blaKPC-positive PA but did not include other Enterobacteriaceae. Moreover, only the complete sequences of blaKPC-positive plasmids in KPC-PA from the NCBI database were selected for subsequent analysis, which may reflect a partial view of the real epidemiology. In summary, this research enhanced our understanding of the genetic mechanisms driving the global spread of blaKPC in PA.
Conclusion
The emergence and spread of PA pose significant clinical and epidemiological challenges. We identified a blaKPC-positive CRPA belonging to ST463, which is integrated into the chromosomal structure within a Tn1721 transposon in this study. Additionally, we investigated the transposon structures contributing to the transmission of the blaKPC gene in PA from a global perspective to improve the understanding of the mechanisms of KPC-PA. Our results suggest that the ST463 PA has evolved a clonal lineage and developed distinct genetic platforms that facilitate chromosomal integration of blaKPC-2 via Tn1721, a feature rarely reported in Southern China. Furthermore, our global analysis revealed three dominant genetic architectures driving blaKPC dissemination: (1) Tn1721 in Chinese ST463 PA; (2) Tn4401 in ST235/ST654 PA from the Americas and Europe; (3) and Tn6296-like elements in plasmid-borne ST463 isolates. These findings underscore the role of mobile elements, including transposons and ISs, in the molecular epidemiology of the blaKPC gene in PA.
Importance
The emergence of carbapenem-resistant Pseudomonas aeruginosa (PA) that harbors the blaKPC gene represents a critical threat to global public health, particularly due to limited treatment options and high mortality in vulnerable populations. This study was carried out to understand how mobile genetic elements drive the dissemination of blaKPC in PA. To our knowledge, a clinically relevant ST463 PA strain (PAE3) carrying a chromosome-borne blaKPC gene was first identified from southern China, which exhibited multidrug resistance. Combining a global dataset of 76 blaKPC-positive PA strains, the blaKPC gene is predominantly disseminated through various transposon structures, including Tn1721, Tn1403, Tn4401, and Tn6296-like elements, which exhibit distinct regional distribution patterns. Tn1721 is the dominant transposon found in Chinese ST463 PA, contrasting with Tn4401-mediated dissemination in ST235/ST654 PA observed in the Americas and Europe. This work provides novel insights into the mobilized genetic platforms that facilitate the dissemination of the blaKPC gene in PA.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found at: https://www.ncbi.nlm.nih.gov/genbank/, CP154349.
Ethics statement
This study has been approved by the Ethics Committee of the Second Affiliated Hospital of Guangzhou Medical University (Permission Number: LYZX-2025-086- 01).
Author contributions
MC: Funding acquisition, Writing – review & editing, Data curation, Investigation, Writing – original draft, Validation, Visualization. TD: Data curation, Investigation, Writing – original draft, Formal analysis. XL: Data curation, Formal analysis, Methodology, Software, Writing – original draft. RNZ: Data curation, Investigation, Writing – original draft. ZG: Conceptualization, Investigation, Resources, Writing – original draft. DZ: Software, Validation, Writing – original draft. JZ: Methodology, Resources, Visualization, Writing – original draft. JL: Data curation, Formal analysis, Writing – original draft. XC: Formal analysis, Methodology, Validation, Writing – original draft. MW: Supervision, Validation, Writing – review & editing. RIZ: Conceptualization, Project administration, Supervision, Validation, Writing – review & editing. QZ: Conceptualization, Funding acquisition, Project administration, Supervision, Validation, Visualization, Writing – review & editing.
Funding
The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported financially by the grants from the Guangzhou Basic and Applied Basic Research Foundation (Grant No. 2024312107) and the Science and Technology Projects of Social Development in Zhuhai (Grant No. 2420004000255).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The authors declare that no Gen AI was used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2025.1666175/full#supplementary-material
References
1
AbrilD.Marquez-OrtizR. A.Castro-CardozoB.Moncayo-OrtizJ. I.Olarte EscobarN. M.Corredor RozoZ. L.et al. (2019). Genome plasticity favours double chromosomal Tn4401b-Bla(KPC-2) transposon insertion in the Pseudomonas aeruginosa ST235 clone. BMC Microbiol.19:45. doi: 10.1186/s12866-019-1418-6
2
AlcockB. P.HuynhW.ChalilR.SmithK. W.RaphenyaA. R.WlodarskiM. A.et al. (2023). CARD 2023: expanded curation, support for machine learning, and resistome prediction at the comprehensive antibiotic resistance database. Nucleic Acids Res.51, D690–D699. doi: 10.1093/nar/gkac920
3
AurilioC.SansoneP.BarbarisiM.PotaV.GiaccariL. G.CoppolinoF.et al. (2022). Mechanisms of action of carbapenem resistance. Antibiotics11:421. doi: 10.3390/antibiotics11030421
4
BortolaiaV.KaasR. S.RuppeE.RobertsM. C.SchwarzS.CattoirV.et al. (2020). ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother.75, 3491–3500. doi: 10.1093/jac/dkaa345
5
BotelhoJ.GrossoF.PeixeL. (2019). Antibiotic resistance in Pseudomonas aeruginosa - mechanisms, epidemiology and evolution. Drug Resist. Updat.44:100640. doi: 10.1016/j.drup.2019.07.002
6
CarattoliA.ZankariE.García-FernándezA.Voldby LarsenM.LundO.VillaL.et al. (2014). In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob. Agents Chemother.58, 3895–3903.
7
DengY.BaoX.JiL.ChenL.LiuJ.MiaoJ.et al. (2015). Resistance integrons: class 1, 2 and 3 integrons. Ann. Clin. Microbiol. Antimicrob.14:45. doi: 10.1186/s12941-015-0100-6
8
DingL.ShenS.ChenJ.TianZ.ShiQ.HanR.et al. (2023). Klebsiella pneumoniae carbapenemase variants: the new threat to global public health. Clin. Microbiol. Rev.36:e0000823. doi: 10.1128/cmr.00008-23
9
EmmsD. M.KellyS. (2019). OrthoFinder: phylogenetic orthology inference for comparative genomics. Genome Biol.20:238. doi: 10.1186/s13059-019-1832-y
10
FangY.WangN.WuZ.ZhuY.MaY.LiY.et al. (2023). An XDR Pseudomonas aeruginosa ST463 strain with an IncP-2 plasmid containing a novel transposon Tn6485f encoding Bla(IMP-45) and Bla(AFM-1) and a second plasmid with two copies of Bla(KPC-2). Microbiology spectrum11:e0446222. doi: 10.1128/spectrum.04462-22
11
Forero-HurtadoD.Corredor-RozoZ. L.Ruiz-CastellanosJ. S.Marquez-OrtizR. A.AbrilD.VanegasN.et al. (2023). Worldwide dissemination of Bla(KPC) gene by novel mobilization platforms in Pseudomonas aeruginosa: a systematic review. Antibiotics12:658. doi: 10.3390/antibiotics12040658
12
GalettiR.AndradeL. N.ChandlerM.Varani AdeM.DariniA. L. (2016). New small plasmid harboring blaKPC-2 in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.60, 3211–3214.
13
GillingsM.BoucherY.LabbateM.HolmesA.KrishnanS.HolleyM.et al. (2008). The evolution of class 1 integrons and the rise of antibiotic resistance. J. Bacteriol.190, 5095–5100. doi: 10.1128/JB.00152-08
14
Hammoudi HalatD.Ayoub MoubareckC. (2022). The intriguing Carbapenemases of Pseudomonas aeruginosa: current status, genetic profile, and global epidemiology. Yale J. Biol. Med.95, 507–515.
15
HarmerC. J.HallR. M. (2016). IS26-mediated formation of transposons carrying antibiotic resistance genes. mSphere1:e00038-16. doi: 10.1128/mSphere.00038-16
16
HengH.YangX.ZhangH.SunR.YeL.LiJ.et al. (2024). Early detection of OXA-232-producing Klebsiella pneumoniae in China predating its global emergence. Microbiol. Res.282:127672. doi: 10.1016/j.micres.2024.127672
17
HuF.PanY.LiH.HanR.LiuX.MaR.et al. (2024a). Carbapenem-resistant Klebsiella pneumoniae capsular types, antibiotic resistance and virulence factors in China: a longitudinal, multi-Centre study. Nat. Microbiol.9, 814–829. doi: 10.1038/s41564-024-01612-1
18
HuY.ShenW.LinD.WuY.ZhangY.ZhouH.et al. (2024b). KPC variants conferring resistance to ceftazidime-avibactam in Pseudomonas aeruginosa strains. Microbiol. Res.289:127893. doi: 10.1016/j.micres.2024.127893
19
HuY. Y.WangQ.SunQ. L.ChenG. X.ZhangR. (2019). A novel plasmid carrying carbapenem-resistant gene Bla (KPC-2) in Pseudomonas aeruginosa. Infect Drug Resist12, 1285–1288. doi: 10.2147/IDR.S196390
20
KangM. S.BaekJ. Y.KoJ. H.ChoS. Y.LeeK. Y.LeeY. H.et al. (2024). Antimicrobial activity of ceftazidime-avibactam against KPC-2-producing Enterobacterales: a cross-combination and dose-escalation titration study with relebactam and vaborbactam. Microbiology Spectrum12:e0034424. doi: 10.1128/spectrum.00344-24
21
LarsenM. V.CosentinoS.RasmussenS.FriisC.HasmanH.MarvigR. L.et al. (2012). Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol.50, 1355–1361. doi: 10.1128/JCM.06094-11
22
LetunicI.BorkP. (2021). Interactive tree of life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res.49, W293–w296. doi: 10.1093/nar/gkab301
23
LiY.LiuQ.SheJ.QiuY.DaiX.ZhangL. (2023). IS26-mediated in vivo acquisition of blaKPC-2 in an ST11-K64 Klebsiella pneumoniae isolate from a senile inpatient. J. Antimicrob. Chemother.78, 550–553. doi: 10.1093/jac/dkac420
24
LiY.YangQ.ChenM.CaiH.FangL.ZhouJ.et al. (2024). Decadal evolution of KPC-related plasmids in Pseudomonas aeruginosa high-risk clone ST463 in Zhejiang, China. Commun. Biol.7:1646.
25
LiG.ZhangY.BiD.ShenP.AiF.LiuH.et al. (2015). First report of a clinical, multidrug-resistant Enterobacteriaceae isolate coharboring fosfomycin resistance gene fosA3 and carbapenemase gene blaKPC-2 on the same transposon, Tn1721. Antimicrob. Agents Chemother.59, 338–343. doi: 10.1128/AAC.03061-14
26
LiuG.LiX.GuanJ.TaiC.WengY.ChenX.et al. (2025). oriTDB: a database of the origin-of-transfer regions of bacterial mobile genetic elements. Nucleic Acids Res.53, D163–d168. doi: 10.1093/nar/gkae869
27
LiuM.MaJ.JiaW.LiW. (2020). Antimicrobial resistance and molecular characterization of gene cassettes from class 1 Integrons in Pseudomonas aeruginosa strains. Microb. Drug Resist.26, 670–676. doi: 10.1089/mdr.2019.0406
28
NaasT.BonninR. A.CuzonG.VillegasM. V.NordmannP. (2013). Complete sequence of two KPC-harbouring plasmids from Pseudomonas aeruginosa. J. Antimicrob. Chemother.68, 1757–1762. doi: 10.1093/jac/dkt094
29
NaasT.OueslatiS.BonninR. A.DabosM. L.ZavalaA.DortetL.et al. (2017). Beta-lactamase database (BLDB) - structure and function. J. Enzyme Inhib. Med. Chem.32, 917–919. doi: 10.1080/14756366.2017.1344235
30
PalombaE.ComelliA.SaluzzoF.Di MarcoF.MatarazzoE.ReN. L.et al. (2025). Activity of imipenem/relebactam against KPC-producing Klebsiella pneumoniae and the possible role of Ompk36 mutation in determining resistance: an Italian retrospective analysis. Ann. Clin. Microbiol. Antimicrob.24:23. doi: 10.1186/s12941-025-00792-w
31
QinS.XiaoW.ZhouC.PuQ.DengX.LanL.et al. (2022). Pseudomonas aeruginosa: pathogenesis, virulence factors, antibiotic resistance, interaction with host, technology advances and emerging therapeutics. Signal Transduct. Target. Ther.7:199. doi: 10.1038/s41392-022-01056-1
32
ReyesJ.KomarowL.ChenL.GeL.HansonB. M.CoberE.et al. (2023). Global epidemiology and clinical outcomes of carbapenem-resistant Pseudomonas aeruginosa and associated carbapenemases (POP): a prospective cohort study. Lancet Microbe4, e159–e170. doi: 10.1016/S2666-5247(22)00329-9
33
RozwandowiczM.BrouwerM. S. M.FischerJ.WagenaarJ. A.Gonzalez-ZornB.GuerraB.et al. (2018). Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae. J. Antimicrob. Chemother.73, 1121–1137. doi: 10.1093/jac/dkx488
34
SayersE. W.CavanaughM.ClarkK.OstellJ.PruittK. D.Karsch-MizrachiI. (2020). GenBank. Nucleic Acids Res.48, D84–D86. doi: 10.1093/nar/gkz956
35
ShenP.ZhangY.LiG.JiangX. (2016). Characterization of the genetic environment of the blaKPC-2 gene among Klebsiella pneumoniae isolates from a Chinese hospital. Braz. J. Infect. Dis.20, 384–388. doi: 10.1016/j.bjid.2016.04.003
36
SiguierP.PerochonJ.LestradeL.MahillonJ.ChandlerM. (2006). ISfinder: the reference Centre for bacterial insertion sequences. Nucleic Acids Res.34, D32–D36. doi: 10.1093/nar/gkj014
37
SilveiraM. C.AlbanoR. M.Rocha-de-SouzaC. M.LeaoR. S.MarquesE. A.PicaoR. C.et al. (2022). Description of a novel IncP plasmid harboring Bla(KPC-2) recovered from a SPM-1-producing Pseudomonas aeruginosa from ST277. Infect. Genet. Evol.102:105302.
38
SophonsriA.KaluM.Wong-BeringerA. (2024). Comparative in vitro activity of ceftazidime-avibactam, imipenem-relebactam, and meropenem-vaborbactam against carbapenem-resistant clinical isolates of Klebsiella pneumoniae and Pseudomonas aeruginosa. Antibiotics13:416. doi: 10.3390/antibiotics13050416
39
StokesH. W.ElbourneL. D.HallR. M. (2007). Tn1403, a multiple-antibiotic resistance transposon made up of three distinct transposons. Antimicrob. Agents Chemother.51, 1827–1829. doi: 10.1128/AAC.01279-06
40
SullivanM. J.PettyN. K.BeatsonS. A. (2011). Easyfig: a genome comparison visualizer. Bioinformatics27, 1009–1010. doi: 10.1093/bioinformatics/btr039
41
TangY.LiG.LiangW.ShenP.ZhangY.JiangX. (2017). Translocation of Carbapenemase gene Bla(KPC-2) both internal and external to transposons occurs via novel structures of Tn1721 and exhibits distinct movement patterns. Antimicrob. Agents Chemother.61:e01151-17. doi: 10.1128/AAC.01151-17
42
TangN.WeiD.ZengY.ZhangG.WangC.FengJ.et al. (2024). Understanding the rapid spread of antimicrobial resistance genes mediated by IS26. mLife3, 101–109. doi: 10.1002/mlf2.12114
43
TatusovaT.DiCuccioM.BadretdinA.ChetverninV.NawrockiE. P.ZaslavskyL.et al. (2016). NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res.44, 6614–6624. doi: 10.1093/nar/gkw569
44
TenoverF. C.NicolauD. P.GillC. M. (2022). Carbapenemase-producing Pseudomonas aeruginosa -an emerging challenge. Emerging Microbes Infections11, 811–814. doi: 10.1080/22221751.2022.2048972
45
VezinaG.LevesqueR. C. (1991). Molecular characterization of the class II multiresistance transposable element Tn1403 from Pseudomonas aeruginosa. Antimicrob. Agents Chemother.35, 313–321. doi: 10.1128/AAC.35.2.313
46
WalkerB. J.AbeelT.SheaT.PriestM.AbouellielA.SakthikumarS.et al. (2014). Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One9:e112963. doi: 10.1371/journal.pone.0112963
47
WangL. J.ChenE. Z.YangL.FengD. H.XuZ.ChenD. Q. (2021). Emergence of clinical Pseudomonas aeruginosa isolate Guangzhou-PaeC79 carrying crpP, Bla(GES-5), and Bla(KPC-2) in Guangzhou of China. Microb. Drug Resist.27, 965–970. doi: 10.1089/mdr.2020.0420
48
WangQ.WangR.WangS.ZhangA.DuanQ.SunS.et al. (2024). Expansion and transmission dynamics of high risk carbapenem-resistant Klebsiella pneumoniae subclones in China: an epidemiological, spatial, genomic analysis. Drug Resist. Updat.74:101083. doi: 10.1016/j.drup.2024.101083
49
WuW.LuL.FanW.ChenC.JinD.PanH.et al. (2021). Complete genome sequences of two novel KPC-2-producing IncU multidrug-resistant plasmids from international high-risk clones of Escherichia coli in China. Front. Microbiol.12:698478. doi: 10.3389/fmicb.2021.698478
50
YoonE. J.JeongS. H. (2021). Mobile Carbapenemase Genes in Pseudomonas aeruginosa. Front. Microbiol.12:614058. doi: 10.3389/fmicb.2021.614058
51
YuF.LvJ.NiuS.DuH.TangY. W.PitoutJ. D. D.et al. (2018). Multiplex PCR analysis for rapid detection of Klebsiella pneumoniae Carbapenem-resistant (sequence type 258 [ST258] and ST11) and Hypervirulent (ST23, ST65, ST86, and ST375) strains. J. Clin. Microbiol.56:e00731-18. doi: 10.1128/JCM.00731-18
52
YuanM.GuanH.ShaD.CaoW.SongX.CheJ.et al. (2021). Characterization of Bla(KPC-2)-carrying plasmid pR31-KPC from a Pseudomonas aeruginosa strain isolated in China. Antibiotics10:1234. doi: 10.3390/antibiotics10101234
53
ZhangP.WuW.WangN.FengH.WangJ.WangF.et al. (2023). Pseudomonas aeruginosa high-risk sequence type 463 co-producing KPC-2 and AFM-1 Carbapenemases, China, 2020-2022. Emerg. Infect. Dis.29, 2136–2140. doi: 10.3201/eid2910.230509
54
ZhangB.XuX.SongX.WenY.ZhuZ.LvJ.et al. (2022). Emerging and re-emerging KPC-producing hypervirulent Pseudomonas aeruginosa ST697 and ST463 between 2010 and 2021. Emerging Microbes Infections11, 2735–2745. doi: 10.1080/22221751.2022.2140609
55
ZhengZ.ChengQ.YeL.XuY.ChenS. (2024). Characterization of VIM-71, a novel VIM-type metallo-β-lactamase variant encoded by an integrative and conjugative element recovered from a Vibrio alginolyticus strain in China. Microbiol. Res.278:127532. doi: 10.1016/j.micres.2023.127532
56
ZhengZ.LiuL.YeL.XuY.ChenS. (2023). Genomic insight into the distribution and genetic environment of Bla(IMP-4) in clinical carbapenem-resistant Klebsiella pneumoniae strains in China. Microbiol. Res.275:127468. doi: 10.1016/j.micres.2023.127468
Summary
Keywords
Pseudomonas aeruginosa, carbapenem-resistant, blaKPC-positive plasmid, regional evolution, transposon
Citation
Chen M, Deng T, Li X, Zhou R, Gao Z, Zhou D, Zhu J, Li J, Chen X, Wang M, Zhang R and Zhou Q (2025) Characterization of genetic context of blaKPC in Pseudomonas aeruginosa. Front. Microbiol. 16:1666175. doi: 10.3389/fmicb.2025.1666175
Received
15 July 2025
Accepted
16 October 2025
Published
14 November 2025
Volume
16 - 2025
Edited by
Maria Teresa Mascellino, Sapienza University of Rome, Italy
Reviewed by
Ahmed Mahrous Soliman, Kafrelsheikh University, Egypt
Osman Birol Ozgümüs, Recep Tayyip Erdoğan University, Türkiye
Updates
Copyright
© 2025 Chen, Deng, Li, Zhou, Gao, Zhou, Zhu, Li, Chen, Wang, Zhang and Zhou.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Minling Wang, wml443@126.com; Rui Zhang, zhangruidoctor@163.com; Qiang Zhou, qiangzhou70@163.com
† These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.