Impact of simulated microgravity in short-term evolution of an RNA bacteriophage

Introduction: Microgravity is a critical environmental factor in space that can alter microbial physiology and virus–host interactions. Understanding these effects is essential for planetary protection and crew health during long-term missions. Bacteriophage Qβ, an RNA virus infecting Escherichia coli F+ strains, provides a relevant model due to its potential presence in the human gut microbiome and its well-characterized evolutionary dynamics.

Methods: We simulated microgravity using a custom-built 3D-clinostat and compared Qβ infections in semisolid medium under standard gravity and simulated microgravity. Twelve evolutionary lines were propagated for ten serial transfers under four experimental conditions combining bacterial growth and infection environments. Viral titers were quantified by plaque assay, and consensus sequences were determined by Sanger sequencing.

Results: Initial infections under simulated microgravity yielded significantly lower viral titers than those in standard gravity, likely due to hindered phage diffusion and delayed infection initiation. After ten transfers, mutation C2011A (amino acid substitution T222N in the A1 virus protein) was fixed in all lines evolved under simulated microgravity but remained absent or polymorphic in standard gravity lines. Under simulated microgravity, the mutation increased virus titers and promoted faster initiation of infections in semisolid medium. However, those effects were not appreciable in normal gravity.

Discussion: Our findings highlight the adaptability of Qβ and the potential impact of microgravity on phage-host interactions, offering insights into virus evolution in extraterrestrial conditions and its implications for space missions and planetary protection.

1 Introduction

The harsh conditions of outer space -including extreme temperatures, high levels of radiation and microgravity- pose significant challenges to life as we know it (Horneck, 1981; Horneck et al., 2010; Fukunaga, 2020; Furukawa et al., 2020). Although early studies have explored the ability of diverse organisms to survive in space (Antipov et al., 1967; Thimann, 1968; de Serres, 1969; Taylor, 1974; Klaus et al., 1997; Brown, 1999), much remains unknown about the genetic or phenotypic changes they may undergo when exposed to this environment. In recent years, the growing prospect of long-term and increasingly distant space missions has brought into focus several aspects of this topic that deserve to be investigated in detail.

In the case of unmanned missions, especially those targeting potentially habitable environments such as Mars or the icy moons of the solar system, it is crucial to ensure that the places to be explored remain uncontaminated by terrestrial microorganisms. To achieve this goal, planetary protection protocols are implemented on Earth that limit microbial presence on spacecrafts (McKaig et al., 2024). However, it is equally important to know whether microorganisms can survive the extreme conditions of space travel and the environments being explored. For manned missions, including extended stays on the International Space Station (ISS), additional concerns arise due to the fact that the space environment can significantly impact the physiology and immune system of astronauts (Sonnenfeld, 1998; Aponte et al., 2006; Kuzichkin et al., 2022), potentially increasing their susceptibility to infections caused by viruses and bacteria. Since astronauts aboard the ISS and spacecrafts are shielded from extreme temperatures and radiation but not from microgravity, this condition takes on considerable interest. Gravity has also the peculiarity that has remained constant on Earth since the formation of the planet, meaning that all terrestrial life has evolved without the need to adapt to changes in gravitational force. This fact highlights the importance of investigating how biological systems respond when confronted with gravity conditions to which they have never been exposed.

Changes in gravity can significantly impact biological processes, particularly those involved in the assembly of macromolecular structures (McPherson and DeLucas, 2015; Koaykul et al., 2019; Zhou et al., 2020; Martirosyan et al., 2022). For example, studies conducted with purified VP1 protein, the major capsid protein of polyomavirus, revealed distinct assembly behaviors under different gravity conditions. Ground-based experiments demonstrated that VP1 assembled into capsid-like structures alongside a heterogeneous array of capsomere subunits. In contrast, under microgravity conditions, capsomeres were of uniform size, and no capsid-like structures were formed (Chang et al., 1993). Similarly, the cell-free assembly of bacteriophage T7 virions was enhanced under simulated microgravity compared to static controls (Lehr et al., 2024). Microgravity also influences the growth, survival, and physiology of microorganisms, which can exhibit altered motility, chemotaxis, and cell morphology (Nickerson et al., 2004; Rosenzweig et al., 2010; Rea et al., 2016; Huang et al., 2018; Acres et al., 2021; Cortesão et al., 2022). Of particular importance to human health are the changes in virulence (Wilson et al., 2007; Rosenzweig et al., 2010; Gilbert et al., 2020; Su et al., 2021; Wazir et al., 2023), antibiotic resistance (Mortazavi, 2019; Tirumalai et al., 2019), and host-pathogen interactions (Higginson et al., 2016; Barrila et al., 2021, 2022; Huss et al., 2023). In some cases, the phenotypic changes appear to be linked to altered gene expression, while in others, they may result from disruptions in molecular transport mechanisms (Arunasri et al., 2013; Topolski et al., 2022).

When talking about the risks of microgravity conditions on human health, it is worth noting that our bodies harbor approximately the same number of bacterial as human cells (Sender et al., 2016). These bacteria, which constitute the so-called microbiome, are essential as they are involved in fundamental processes such as immune system regulation, food digestion, and the production of certain neurotransmitters (Gilbert et al., 2018). This means that to evaluate the health risks associated with space missions, it is critical to understand how the components of the microbiome are affected in this environment (Saei and Barzegari, 2012; Cervantes and Hong, 2016; Voorhies and Lorenzi, 2016; Mahnert et al., 2021; Siddiqui et al., 2021). The human microbiome is complex and highly diverse. To function properly, the different species that make it up must maintain an appropriate balance between them, something that is largely regulated by the presence of bacterial viruses (Shkoporov and Hill, 2019). While phage-host interactions have been thoroughly explored in terrestrial ecosystems, their dynamics under microgravity conditions remain unexplored. A recent study carried out with bacteriophage T7 and Escherichia coli onboard the ISS identified several mutations in both phage and bacteria that improved fitness in microgravity (Huss et al., 2023). These findings highlight the importance of conducting similar studies with other bacteriophage-host systems to gain a broader understanding of how microgravity influences these interactions.

In this work, we focus on the interaction between the bacterium E. coli and one of its specific viruses, the bacteriophage Qβ, which infects strains expressing conjugative pili (F+ strains). Qβ was first isolated in 1961 from human feces (Arisaka, 2024), suggesting its potential presence in the gut environment. Although this does not necessarily imply that it is a stable or abundant component of the intestinal microbiome, its tropism for F+ strains of E. coli, which are frequently found in the human gut, makes it a relevant model for studying phage-host interactions in this context. E. coli has also served extensively as a model organism in space biology, with prior studies showing that simulated microgravity alters its growth and gene expression (Arunasri et al., 2013; Topolski et al., 2022). These features underscore its suitability for investigating virus–bacteria interactions under conditions that mimic spaceflight.

Using the bacteriophage Qβ-E. coli system as an experimental model, we have established a serial transfer protocol that allows us to investigate the evolution of the virus under simulated microgravity conditions in a 3D-clinostat. Qβ belongs to the family Fiersviridae (formerly named Leviviridae), genus Qubevirus (Walker et al., 2021). The phage has a single-stranded, positive-sense RNA genome of 4,217 nucleotides that encodes four proteins: the A2 protein, which interacts with the cell receptor (the F pilus) and is also involved in the lysis of the infected bacteria (Bernhardt et al., 2001; Cui et al., 2017); the coat protein, the main structural component of the capsid; the A1 protein, a low-abundance capsid protein produced via stop codon readthrough of the coat protein gene (Hofstetter et al., 1974); and the replicase (Kidmose et al., 2010), essential for RNA genome replication. Like other RNA viruses, Qβ replicates with high error rates (Bradwell et al., 2013), resulting in highly heterogeneous populations that can rapidly adapt to a wide variety of environmental conditions. Over the years, we have conducted a number of successful studies concerning the adaptation of this virus to diverse selective pressures (Lázaro et al., 2018; Somovilla et al., 2019; Laguna-Castro et al., 2023, 2024). However, this is the first time when the selective pressure assayed - simulated microgravity - is not a condition found naturally on Earth.

The main objectives of the current work were to investigate how microgravity conditions, simulated in a 3D-clinostat, affect the yield of Qβ infections and to identify the genetic and phenotypic changes experienced by the virus when evolving in this environment. Our results show that the virus titers obtained in infections carried out in the 3D-clinostat were lower than those achieved in a standard incubator. Nevertheless, the virus was able to improve its performance in the simulated microgravity environment within a short period, showing its extraordinary capacity to adapt to new conditions. Studies of this type are crucial for understanding the effects of the space environment on microorganisms, not only to ensure the safety and success of space missions but also to advance our ability to explore new worlds, where the limits of terrestrial biology may be challenged and redefined.

2 Materials and methods

2.1 Description of the 3D-clinostat

To grow bacteria and perform virus infection under altered gravity, we designed and constructed a 3D-clinostat with two rotation axes, which allow us to avoid a predominant directionality with respect to the culture.

The clinostat consists of a 48.5 cm-long aluminum cylinder, inside which up to 16 Petri dishes can be stacked (Figure 1). The cylinder is attached to a rectangular frame by means of a steel bar, perpendicular to the cylinder longitudinal axis through its middle point, and which serves as first rotation axis. The frame rotates, in turn, around a coplanar second axis, perpendicular to the first one, which it intersects in the center of the cylinder. For liquid medium cultures, culture tubes were fixed longitudinally on the lateral surface of the cylinder, evenly distributed.

Figure 1

Figure 1. Design and dimensions of the 3D-clinostat. (A) Photograph of the custom-built 3D-clinostat, consisting of an aluminum cylinder (48.5 cm long, 6 cm radius) mounted on a rectangular frame that rotates around two perpendicular axes. Two independent motors drive rotation at adjustable speeds, enabling the cylinder to traverse all orientations on a sphere and simulate microgravity conditions. Dimensions of the main components are indicated. (B) Detailed view of the cylinder’s dimensions and configuration. Up to 16 Petri dishes can be stacked inside the cylinder, and culture tubes can be inserted longitudinally along its lateral surface.

Two separate motors drive rotation around each axis. Rotation speed can be adjusted independently, using an Arduino Uno plate and motor driver shield (Arduino, Italy) for each one, forcing the cylinder to go through all positions on a sphere (Kim et al., 2017; Clary et al., 2022). We finally chose 3:2.73 rpm (first:second axes) to obtain the desired trajectory, maintaining negligible centrifugal effects. Simulated microgravity (estimated as the centrifugal force due to rotation around the first axis, the only effort applied constantly in the same direction with respect to the culture plates) ranged between 3 × 10⁻⁴ g (innermost position in the cylinder) and 2.4 × 10⁻³ g (outermost position), consistent with previously reported values for bacterial cultures under similar conditions (Arunasri et al., 2013; Topolski et al., 2022). The trajectory was verified with an accelerometer and gyroscope MPU6050 (Arduino, Italy) on an Arduino Uno Rev. 3 plate fixed on the surface of the cylinder (Supplementary Figure 1).

2.2 Viruses and bacteria

The plasmid pBRT7Qβ, which contains a cDNA of bacteriophage Qβ cloned in the plasmid pBR322 (Taniguchi et al., 1978; Barrera et al., 1993), was used to transform E. coli DH5-α, a strain that permits virus expression, although it cannot be infected because it lacks the virus receptor. The supernatant of an overnight culture obtained from a transformed colony was used to infect E. coli, strain Hfr (Hayes, 1953), in semisolid agar. The virus progeny contained in a randomly chosen lysis plaque was isolated, and 10⁶ plaque forming units (pfu) were used to infect an E. coli Hfr culture under the standard conditions used in our laboratory (37 °C, 250 rpm for 2 h in NB medium: 8 g/L Nutrient Broth from Merck and 5 g/L NaCl) in a New Brunswick Scientific Innova 42 Incubator Shaker (Eppendorf, Enfield, CT, USA), which will hereafter be referred to as the standard incubator. The culture was treated with chloroform (1/20 v/v, 28 °C, 15 min, shaking 850 rpm in thermoblock) and centrifugated at 13,000 rpm. The supernatant containing the virus particles was used as the ancestor of all the evolutionary lines analyzed in this work. It was denoted Qβ_Anc and its consensus sequence showed no mutations relative to the Qβ cDNA cloned in pBR322.

The plasmid pBRT7Qβ was also used to engineer a single-mutant virus (Qβ_C2011A) containing the mutation C2011A. The protocol to obtain this mutant has been previously described (Laguna-Castro and Lázaro, 2022).

Bacteria used for infections (E. coli Hfr) were obtained by inoculating a well-isolated colony in a 12 mL polystyrene tube (deltalab) containing 2 mL of NB medium that was incubated for 7 h at 37 °C either in the standard incubator above described (vertical position; 250 rpm) or in the 3D-clinostat (placed in a thermally regulated room). The stationary phase cultures thus obtained were diluted 1:20 in similar tubes until completing a volume of 2 mL in NB medium, and incubated in the same incubator where they had reached the stationary phase as long as necessary to reach an OD₆₀₀ around 0.8. The exponential phase bacteria thus obtained were infected with the phage in the conditions described in each experiment.

2.3 Standard procedures for infections in semisolid medium

Infections in semisolid medium were carried out by mixing 300 μL of the corresponding exponential phase bacteria with 100 μL of phage buffer (1 g/L gelatin, 0.05 M Tris–HCl, pH 7.5, and 0.01 M MgCl₂) containing the indicated pfu and 4.5 mL of melted top agar (7 g/L agar in NB medium). This mix was poured onto Petri dishes containing a bottom agar layer (32 g/L LB Agar, Lennox L Broth Base from Invitrogen). The Petri dishes were incubated for 2 h at 37 °C in horizontal position without shaking (standard incubator) or in the 3D-clinostat (see Figure 1B). After this time, 4 mL of phage buffer was added to each plate and kept shaking horizontally (110 rpm) for 20 min at 25 °C. The buffer was transferred to eppendorf tubes and centrifuged at 13,000 rpm for 10 min to collect the supernatant containing the virus particles, which were maintained at 4 °C for short-term use (less than 15 days) or at −80 °C for long-term storage.

In all cases, virus titers were determined by plaque assay and expressed as the number of pfu per mL of the phage suspension.

2.4 Evolution experiment

The virus Qβ_Anc was used to initiate 12 evolutionary lines that were propagated for 10 serial transfers in semisolid medium (Figure 2). Prior to infection, bacteria were grown in liquid medium, either in the standard incubator or in the 3D-clinostat until an OD₆₀₀ of around 0.8. Infections were carried out in semisolid medium as described in the above section. We defined four experimental conditions that were assayed in triplicate: bacteria grown and infected in the standard incubator (SS lines), bacteria grown in the standard incubator and infected in the 3D-clinostat (SC lines), bacteria grown in the 3D-clinostat and infected in the standard incubator (CS lines), and bacteria grown and infected in the 3D-clinostat (CC lines). In all cases, infection at the first transfer was performed with 10⁷ pfu of the ancestral virus (virus Qβ_Anc; see Section 2.2). Subsequent transfers until completing a total of 10 were performed with 10⁷ pfu of the virus supernatant obtained at the previous transfer of each line. All transfers were performed after a standardized incubation time of 2 h, regardless of the condition (standard gravity or simulated microgravity). This decision was based on previous experience with Qβ infections in semisolid medium and aimed to maintain consistency across all experimental lines.

Figure 2

Figure 2. Scheme of the evolution experiment. Two E. coli cultures were grown in liquid medium to an OD₆₀₀ ≅ 0.8, either in the standard incubator (S) or in the 3D-clinostat (C). Each culture was then used to initiate six evolutionary lines, where phage propagation occurred in semisolid medium: three lines were incubated under standard conditions and three in the 3D-clinostat. The resulting evolutionary lines were designated as SS, SC, CS, and CC, followed by a number (1, 2, or 3) to identify each replicate. In this nomenclature, the first letter refers to the growth condition of the bacteria prior to infection, and the second letter indicates the condition under which the infection took place. For further details, refer to the “Evolution experiment” section in Materials and methods.

Two negative controls in which bacteria were incubated in the absence of virus, both in the standard incubator and in the 3D-clinostat, were set at each transfer. These controls were processed and plated exactly the same as the experimental samples, and were run in parallel using the same equipment and conditions. Their purpose was to detect any contamination, which could occur either during the preparation of the bacterial cultures or during the course of the experiment. When lysis plaques appeared in a control plate, the corresponding transfer was discarded and repeated.

2.5 Determination of the virus replicative ability in semisolid medium

The virus yield obtained in replication assays carried out in semisolid medium was used as a measure of the virus replicative ability. For this purpose, infections were performed with 10⁴ pfu of the virus population assayed. We used this amount of virus to ensure that the replicative capacity of the system was not saturated. After 2 h of incubation either in the standard incubator or the 3D-clinostat, virus supernatants were collected and titrated as described above.

2.6 Plaque timing experiments

To evaluate the onset of phage-induced lysis under different gravity conditions, we performed plaque timing assays using low viral loads of either the ancestral virus Qβ_Anc or the mutant Qβ_C2011A. Infections were carried out in semisolid agar and incubated either in the standard incubator or in the 3D-clinostat. Lysis plaques were counted at various time points over a 24-h period. For each Petri dish, the percentage of plaques observed at a given time was calculated relative to the total number of plaques counted at 24 h. This normalization allowed for direct comparison of plaque formation kinetics across conditions and viral genotypes. In a separate assay, the number of lysis plaques formed after 4 h of incubation was quantified in five Petri dishes incubated in parallel. The results were also expressed as the percentage of the total plaques observed at 24 h.

2.7 RNA extraction, cDNA synthesis, PCR amplification, and nucleotide sequencing

Viral RNA was prepared following standard procedures to determine the consensus sequence either from biological clones or from complex virus populations. RNAs were used for cDNA synthesis with the avian myeloblastosis virus reverse transcriptase (Promega), followed by PCR amplification using Expand high-fidelity DNA polymerase (Roche). The pairs of oligonucleotide primers used for RT-PCR were the following: P1 forward (5′CTTTAGGGGGTCACCTCACAC3′) with P1 reverse (5′GGATGGGTCACAAGAACCGT3′) to amplify from nucleoide position 10 to 1595, P2 forward (5′GACGTGACATCCGGCTCAAA3′) with P2 reverse (5′CAACGGACGGAACATCTCCT3′) to amplify from nucleotide position 1109 to 2787 and P3 forward (5′GTGCCATACCGTTTGACT3^′) with P3 reverse (5^′GATCCCCCTCTCACTCGT3^′) to amplify from nucleotide position 2254 to 4195. PCR products were column purified (Qiagen) and subjected to standard Sanger sequencing using Big Dye Chemistry (v3.1) with an automated sequencer (Abi 3730 XL, Applied Biosystems, Perkin Elmer). Sequences were assembled and aligned with Geneious Pro v4.8.5.¹ Mutations relative to the sequence of the Qβ cDNA present in the plasmid pBRT7Qβ (virus Qβ_Anc) were identified using the same software.

3 Results

3.1 Experimental setup and bacterial growth under simulated microgravity

As a preliminary step to the evolution experiment with bacteriophage Qβ, we compared the growth of E. coli in liquid medium at 37 °C under two conditions: the routine laboratory protocol (250 rpm in the standard incubator; see Section 2.2) and in the 3D-clinostat (see Section 2.1). The results showed that E. coli grew faster in the clinostat than in the standard incubator (Figure 3). However, this difference cannot be attributed solely to the simulated microgravity, as other factors may also contribute. In particular, while tubes in the standard incubator remain in a fixed vertical position, the clinostat continuously alters their orientation, likely increasing aeration due to greater surface exposure. Since E. coli growth is sensitive to oxygen availability, this could affect not only bacterial replication but also their physiological state and susceptibility to phage infection.

Figure 3

Figure 3. Growth of E. coli in liquid medium under standard gravity and simulated microgravity. An overnight E. coli culture grown under standard conditions (37 °C, 250 rpm) was diluted 1:20 and distributed into tubes containing 2 mL each. Cultures were incubated either in the standard incubator (37 °C, 250 rpm, black circles) or in the 3D-clinostat (37 °C, dual-axis rotation at 3:2.73 rpm, ochre circles). At the indicated times, two tubes per condition were sampled and OD₆₀₀ was measured. Points represent the mean of two replicates; error bars indicate standard deviation.

To avoid this confounding factor, we chose to perform infections in semisolid agar in Petri dishes, where the surface exposed to air remains constant across conditions. In this setup, bacterial cells are largely immobilized, and the ability of the phage to diffuse through the agar becomes a key determinant of virus-host encounters, especially during the early stages of infection. While E. coli can exhibit motility in semisolid media through swimming or swarming, these behaviors are strongly dependent on agar concentration and cell density. Swimming is typically observed at agar concentrations ≤ 0.3% (Croze et al., 2011), whereas swarming requires a lag phase of 2–4 h, during which cells accumulate and remodel their physiology in response to surface contact and density cues (Partridge, 2022). In our experiments, the top agar concentration was 0.7%, and infections were incubated for only 2 h, a timeframe that precedes the onset of swarming and limits bacterial movement. Therefore, we consider phage diffusion to be a critical factor influencing infection dynamics under these conditions. This constraint on phage mobility may also influence the selective pressures acting during serial propagation, as discussed in later sections.

3.2 Reduced replication efficiency of Qβ under simulated microgravity

To assess the impact of simulated microgravity on phage replication in semisolid agar, we performed infections with the virus Qβ_Anc using two different viral loads: 10³ and 10⁴ pfu. The initial experiment with 10³ pfu served as a pilot to evaluate whether simulated microgravity affected viral yield. Upon observing a significant reduction in titers (Figure 4), we conducted two additional experiments with 10⁴ pfu to test the reproducibility of the effect and to determine whether the inhibitory impact of simulated microgravity was dependent on the initial viral load. The results (Figure 4) confirmed that replication efficiency was significantly reduced under simulated microgravity conditions (p < 0.05; Mann–Whitney test) and that the effect was consistent across different viral inputs.

Figure 4

Figure 4. Virus titers obtained in Qβ infections carried out in semisolid agar either in simulated microgravity (3D-clinostat) or in normal gravity (standard incubator). The results of three different assays are represented, one in which infections were carried out with 10³ pfu and two others with 10⁴ pfu. Bacteria used for infections had been previously grown in the standard incubator until reaching an OD₆₀₀ ≅ 0.8. Each infection assay was carried out in triplicate both in the standard incubator (black bars) and in the 3D-clinostat (ochre bars). Each bar represents the mean of the three values obtained for each condition. Standard deviations are also depicted. Asterisks indicate that the differences between the two conditions tested in each experiment are statistically significant (p < 0.05; Mann–Whitney test).

3.3 Qβ evolution under simulated microgravity conditions

The results shown in Figure 4 indicate that simulated microgravity reduces the yield obtained in Qβ infections. To investigate whether the phage could develop adaptive responses to this selective pressure, we designed an evolution experiment in which Qβ was propagated in semisolid medium for 10 serial transfers (Figure 2). At each transfer, infections were performed either in normal gravity (standard incubator; S) or in simulated microgravity (3D-clinostat; C). Bacteria used for infections had been previously grown in liquid medium either in the standard incubator or in the 3D-clinostat until reaching an OD₆₀₀ ≅ 0.8. This design allowed us to test four evolutionary scenarios, combining the conditions under which bacteria were grown and infections were carried out: SS (bacteria grown and infected in the standard incubator), SC (bacteria grown in the standard incubator and infected in the clinostat), CS (bacteria grown in the clinostat and infected in the standard incubator), and CC (bacteria grown and infected in the clinostat). It is worth noting that this experimental design permits only the evolution of phages, as fresh bacteria are introduced in each transfer.

Determination of the consensus sequences of the viral populations at transfer 10 revealed a single mutation, C2011A (resulting in the amino acid substitution T222N in the A1 protein), in some of the evolved lines (Figure 5). The mutation was fixed in all six lines where infections were performed in the 3D-clinostat (lines SC and CC), regardless of the previous bacteria growth condition. In contrast, the mutation was not fixed in any of the lines evolved in the standard incubator (lines SS and CS). It was undetectable in two of them and present as a polymorphism, reaching at most 50%, in the remaining four.

Figure 5

Figure 5. Chromatograms corresponding to the nucleotide position 2011 of the Qβ genome in the evolutionary lines tested. The evolutionary lines correspond to those described in the legend of Figure 2 and in Section 2.4 of Materials and methods. The arrow points to the 2011 position in the Qβ genome, showing the nucleotide (or mixture of nucleotides) present in each line.

Mutation C2011A had previously been identified in our laboratory as beneficial for replication in well-mixed liquid cultures with low bacterial density (Laguna-Castro and Lázaro, 2022). In the current experiment, the concentration of bacteria in the semisolid agar was always around 2 × 10⁷ colony forming units per ml (cfu/mL), a condition favorable for the selection of the mutation. However, its fixation in all the lines evolved in the clinostat, whereas it was absent or remained as a polymorphism in the lines evolved in the standard incubator suggests that its selective value is greater under simulated microgravity.

To assess whether the evolved lines were optimized with respect to the ancestor, we performed replication assays using lines SC and SS. These were chosen because the bacterial growth condition prior to infection did not appear to influence the selection of mutation C2011A (Figure 5). The results showed that SS lines did not differ significantly from the ancestor in infections carried out in the standard incubator (p > 0.05; Mann–Whitney test) (Figure 6A), while SC lines exhibited significantly higher viral titers in infections carried out in the 3D-clinostat (p < 0.05; Mann–Whitney test) (Figure 6B).

Figure 6

Figure 6. Virus titers obtained in semisolid agar when infecting with lines SS and SC and the viruses Qβ_Anc and Qβ_C2011A. (A) Assay carried out in the standard incubator with lines SS. (B) Assay carried out in the 3D-clinostat with lines SC. Bacteria used for infections had been previously grown in the standard incubator until reaching an OD₆₀₀ ≅ 0.8. Each bar represents the mean of three values obtained for each virus or evolutionary lines assayed. Standard deviations among replicas are also depicted. Asterisks indicate that the difference with the ancestor is statistically significant (p < 0.05; Mann–Whitney test). See Section 2.5 for further details.

Although the only mutation we detected in the consensus sequences of the evolved populations was C2011A, this does not exclude the presence of additional low-frequency mutations, which altogether could contribute to the increase in the replicative fitness of the lines evolved in the 3D-clinostat. To study the effect of mutation C2011A when present in a simpler mutant spectrum, we used the single mutant Qβ_C2011A. It was observed that the viral titers of the mutant did not differ significantly from those of the ancestor when replication was performed in the standard incubator (p > 0.05; Mann–Whitney test) (Figure 6A), whereas they were significantly higher when replication took place in the 3D-clinostat (p < 0.05; Mann–Whitney test) (Figure 6B).

3.4 C2011A mutation favors an earlier start of infections in simulated microgravity conditions

The fact that mutation C2011A enhances viral entry into E. coli cells (Laguna-Castro and Lázaro, 2022) explains its selective advantage in infections with low bacterial density, such as those performed during the evolution experiment shown in Figure 2. In addition, in semisolid agar infections, where bacterial cells are largely immobilized (see Section 3.1), phage diffusion becomes another limiting factor for initiation of infections. This constraint likely increases the selective pressure for mutations that improve entry efficiency once a virus-bacterium encounter occurs. In the present study, mutation C2011A was detectable in 10 out of the 12 evolved lines, all propagated in semisolid medium. However, it was only fixed in the lines evolved under simulated microgravity, suggesting that this condition imposes additional barriers to the infection, thereby amplifying the selective advantage of the mutation.

If it is indeed more difficult for the phage to initiate infections under simulated microgravity conditions, lysis plaques would be expected to appear later or even occur in smaller numbers in the 3D-clinostat than in the standard incubator. To test this possibility, we performed an experiment in which bacteria were infected using low viral loads of either the ancestral virus (≅ 60 pfu) or the mutant Qβ_C2011A (≅ 50 pfu). Petri dishes were incubated in the standard incubator or in the 3D-clinostat, and lysis plaques were counted at various time points (Figure 7). It is noticeable that, for the same virus, the curves obtained when infections were carried out in the standard incubator were always above those obtained for infections performed in the 3D-clinostat. In addition, although the difference was not statistically significant (p > 0.05; Mann–Whitney test), the total number of plaques observed at 24 h was higher in the standard incubator (58.3 ± 3.5 for Qβ_Anc and 46.0 ± 4.0 for Qβ_C2011A) than in the 3D-clinostat (48.0 ± 3.0 for Qβ_Anc and 38.0 ± 1.7 for Qβ_C2011A). Although the mutant appeared to initiate infections slightly earlier than the ancestral virus (compare Figures 7A,B), the effect was quite subtle and difficult to interpret given variability among replicates. Because data were normalized to the total plaques observed at 24 h, relative dynamics can be compared, but conclusions remain limited by the modest magnitude of the differences.

Figure 7

Figure 7. Kinetics of lysis plaque formation. (A) Virus Qβ_Anc. (B) Virus Qβ_C2011A. Each curve represents the results obtained in a Petri dish. In all cases, the percentage of plaques at each time was calculated with respect to the total obtained in the same Petri dish at 24 h. In both panels, black symbols refer to infections carried out in the standard incubator and ochre symbols to infections in the 3D-clinostat. See Section 2.6 for additional details.

To address the limitations of the previous assay and assess whether mutation C2011A affects infection onset, we performed a complementary experiment (Figure 8). Both the ancestral virus and the mutant Qβ_C2011A were tested under standard gravity and simulated microgravity conditions. As in Figure 7, the number of plaques observed after 4 h was normalized to the total plaques at 24 h, enabling direct comparison of early infection dynamics. No significant differences were detected between the two viruses in the standard incubator (p > 0.05; Mann–Whitney test). In contrast, under simulated microgravity, the mutant produced significantly more plaques than the ancestor (p < 0.05; Mann–Whitney test), indicating that mutation C2011A facilitates earlier infection initiation in this environment.

Figure 8

Figure 8. Percentage of lysis plaques observed after 4 h of incubation. Values are expressed relative to the total number of lysis plaques observed at 24 h, in infections performed with either Qβ_Anc or Qβ_C2011A, under standard gravity (black symbols) or simulated microgravity (3D-clinostat; ochre symbols). Each data point represents the result from an individual Petri dish. Horizontal lines indicate the mean values obtained from five replicates per condition. The asterisk denotes statistically significant differences (p < 0.05; Mann–Whitney test). See Section 2.6 for additional details.

Although the viral load used for Qβ_C2011A (≅ 120 pfu) was slightly higher than that used for the ancestral virus (≅ 50 pfu) in this experiment, this difference is minor in the context of plaque assays, where viral suspensions are typically diluted from stocks containing up to 10¹⁰ pfu/ml. Moreover, because the data were normalized to the total number of plaques observed at 24 h, the comparison of infection onset dynamics remains valid. The earlier appearance of plaques in the mutant virus under simulated microgravity is consistent with previous findings (Laguna-Castro and Lázaro, 2022), where mutation C2011A was shown to enhance viral entry under conditions of low bacterial density. This advantage is expected to be particularly relevant in semisolid agar, where phage diffusion is limited and initial virus-host encounters are less frequent.

The earlier onset of infections in the standard incubator than in the clinostat suggests that the differences in viral titers could be greater if the incubation time of the bacteria with the virus was shorter. To test this idea, we compared the virus titers obtained after 1 and 2 h in triplicate infections performed in semisolid agar with the virus Qβ_Anc and the mutant Qβ_C2011A. While titers at 2 h were 7.5 times higher in the standard incubator than in the clinostat, this difference increased to 25-fold at 1 h (data not shown), reinforcing the idea that delayed infection initiation is a key factor limiting viral replication under simulated microgravity.

4 Discussion

This study explores the effects of simulated microgravity on the short-term evolution of the RNA bacteriophage Qβ, which is probably a normal component of the human gut microbiome where it infects the bacteria E. coli (Arisaka, 2024). The good previous knowledge that exists about this phage and its evolution in different conditions (Bradwell et al., 2013; Lázaro et al., 2018; Somovilla et al., 2019; Laguna-Castro et al., 2023, 2024) makes it an excellent model to investigate how bacteria-phage interactions could be affected in space conditions.

Our results show a significantly lower yield of Qβ infections carried out in simulated microgravity conditions compared to those performed in normal gravity, regardless of the initial viral load used for infection (Figure 4). This observation aligns with previous studies indicating that microgravity (real or simulated) can disrupt biological processes such as molecular transport and macromolecular assembly (Chang et al., 1993; McPherson and DeLucas, 2015; Koaykul et al., 2019; Zhou et al., 2020; Martirosyan et al., 2022; Lehr et al., 2024), which are critical for efficient viral replication. In addition, in semisolid agar infections, such as those carried out in this work, bacteria and phages encounters are mainly determined by the diffusion capacity of the phage, which can also be affected by gravity conditions. The lower the ability of the phage to spread, the less likely it is to find a susceptible bacterium, which probably translates into a delay in the average time needed to initiate an infection, giving rise to lower viral titers. The results showing a later onset of infections under simulated microgravity in the 3D-clinostat (Figures 7, 8) could be well explained on the basis of a decreased phage diffusion rate under this condition. This finding underlines the importance of diffusion dynamics in the success of phage infections in structured mediums, such as biofilms formed by many bacteria, including those present in the human gut, and suggests that microgravity might enhance the selective pressure to optimize the process.

The evolution experiment we have carried out revealed that Qβ was capable of improving its replication in the 3D-clinostat within a relatively short timeframe. Mutation C2011A, which introduces an amino acid substitution (T222N) in the A1 protein, was fixed in all evolutionary lines propagated under simulated microgravity, whereas it remained polymorphic or absent in the lines evolved under normal gravity (Figure 5). Previous work in our laboratory identified this mutation as advantageous for virus replication in low-density bacterial cultures carried out in liquid medium with good shaking (Laguna-Castro and Lázaro, 2022). We also demonstrated that the mutation increases virus entry into bacteria, which may also make it of selective value when replication takes place on semisolid agar, a medium in which bacteria-phage encounters are hindered by the limited mobility of bacteria and the constrained diffusion of phages.

Although the mutation was not exclusive to the clinostat-evolved lines, its consistent fixation under simulated microgravity suggests that the selective pressure in that environment may have been stronger. We acknowledge that the result would have been more compelling had the mutation been entirely absent from the standard incubator lines. However, it is important to note that adaptive mutations do not necessarily need to be specific to a single environment. A mutation may confer a general advantage under multiple conditions, with its fixation rate varying depending on the intensity of the selective pressure. In our case, mutation C2011A enhances viral entry under low bacterial density (Laguna-Castro and Lázaro, 2022), a condition that inherently reduces the likelihood of successful infection. This advantage is likely relevant in semisolid agar, where initial virus-host encounters are limited, and even more so under simulated microgravity, where diffusion constraints may be exacerbated due to the constantly changing gravity directionality. This layered selective context likely explains the accelerated fixation of C2011A in the clinostat lines. Future deep sequencing of the evolved populations could help identify additional low-frequency mutations contributing to adaptation and clarify the specific selective pressures acting in each environment.

This reasoning is supported by the observation that the mutant virus Qβ_C2011A exhibited significantly higher replication rates than the ancestral virus in the clinostat but not in the standard incubator (Figure 6). The findings are consistent with previous results obtained in the T7 bacteriophage and E. coli system, where microgravity conditions were shown to drive the emergence of mutations in both the phage and the host, enhancing their capacity for interaction (Huss et al., 2023). Such parallels strengthen the notion that microgravity exerts distinctive selective pressures on virus–host systems, where even broadly adaptive mutations may become preferentially fixed due to the cumulative constraints of the environment.

The earlier onset of lysis plaques observed in standard gravity conditions compared to simulated microgravity (Figure 7) further underscores the impact of gravity on the kinetics of phage infections. The delay in plaque formation in the clinostat indicates that initiation of infections takes longer in this condition than in the standard incubator. Mutation C2011A appears to mitigate this effect, as evidenced by the higher number of lysis plaques formed at early times by the virus Qβ_C2011A compared to the ancestor when infections are carried out in the 3D-clinostat (Figure 8). The fact that viral titers experienced a sharper decline in the clinostat with respect to the standard incubator when the incubation time with bacteria was shorter (1 h versus 2 h) also points to the later onset of infections as the main factor affecting the reduction of viral titers under simulated microgravity conditions.

Another factor that could influence bacteriophage Qβ replication under the conditions tested is the physiological state and growth capacity of E. coli (Zea et al., 2017). It is described that many bacteria undergo alterations when grown under microgravity conditions, both in ground-based simulations and spaceflight experiments (Nickerson et al., 2004; Rosenzweig et al., 2010; Rea et al., 2016; Huang et al., 2018; Santomartino et al., 2020; Acres et al., 2021; Cortesão et al., 2022). In our preliminary tests, E. coli grew faster in the 3D-clinostat than in the standard incubator (Figure 3), consistent with previous reports showing that simulated microgravity can accelerate growth and modulate gene expression (Arunasri et al., 2013; Topolski et al., 2022). However, this difference may also reflect increased aeration in the clinostat, where tube orientation changes continuously, exposing a larger surface to air. Because oxygen availability strongly affects E. coli growth, subsequent phage infections were performed on semisolid agar to maintain a constant exposed surface.

Until now, we have stated that mutation C2011A favors phage replication in simulated microgravity because, under this condition, phage diffusion is slower, meaning that a mutation that favors virus entry once the encounter with the bacteria has occurred is advantageous. An alternative possibility is that bacteria could express fewer receptors for the phage, F pili in this case, when grown under simulated microgravity conditions (Piscon et al., 2023). In such a scenario, the selective value of mutation C2011A would also be enhanced. Some preliminary experiments we have conducted do not show appreciable differences in virus entry in bacteria grown in liquid medium in the clinostat or the standard incubator. However, it would be necessary to carry out more precise studies to determine if the expression of the Qβ receptor in E. coli is altered in simulated microgravity.

The ability of Qβ to adapt to simulated microgravity has broader implications for understanding phage-bacteria interactions in extraterrestrial environments. Given the essential role of bacteriophages in regulating microbial ecosystems, changes in phage dynamics could influence the composition and stability of microbial communities in space habitats. This is particularly relevant for human health during long-term space missions, as disruptions in the gut microbiome - partly regulated by phages - could have significant physiological consequences. Furthermore, the observation that simulated microgravity can alter the selective pressures experienced by viruses emphasizes the need for more comprehensive studies on microbial evolution in space environments.

While we acknowledge that simulated microgravity using clinostats does not perfectly replicate true microgravity, we believe our findings are quite valuable for future research that helps elucidate how variations in gravitational conditions impact phage-bacteria interactions in space and extraterrestrial environments. The findings shown contribute to our understanding of life adaptation and underscore the importance of considering microgravity as a key factor in the design of space missions and planetary protection protocols. Future experiments conducted in true microgravity environments, such as aboard the ISS, could validate and expand the conclusions drawn here, providing deeper insights into the complex interplay between gravitational forces and biological systems.

Data availability statement

The original contributions presented in the study are included in the article/Supplementary material, further inquiries can be directed to the corresponding author.

Author contributions

AR-M: Conceptualization, Formal analysis, Investigation, Methodology, Validation, Writing – review & editing. SM-B: Methodology, Validation, Writing – review & editing. UH: Methodology, Supervision, Validation, Writing – review & editing. ÁS: Conceptualization, Methodology, Supervision, Validation, Writing – review & editing. EL: Conceptualization, Data curation, Funding acquisition, Supervision, Validation, Writing – original draft, Writing – review & editing.

Funding

The author(s) declare that financial support was received for the research and/or publication of this article. This study was funded by grant number PID2023-147963NB-C22, given by MICIU/AEI/10.13039/501100011033 and by FEDER, EU. The funder played no role in study design, data collection, analysis and interpretation of data, or the writing of this manuscript.

Acknowledgments

The authors would like to thank Ricardo Ferrándiz Guibelalde for his helpful assistance and technical support with the 3D-clinostat at CAB.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.

Generative AI statement

The authors declare that Gen AI was used in the creation of this manuscript. Chat GPT was used to improve the quality of the English language.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2025.1680651/full#supplementary-material

Footnotes

^https://www.geneious.com

References

Acres, J. M., Youngapelian, M. J., and Nadeau, J. (2021). The influence of spaceflight and simulated microgravity on bacterial motility and chemotaxis. NPJ Microgravity 7:7. doi: 10.1038/S41526-021-00135-X

PubMed Abstract | Crossref Full Text | Google Scholar

Antipov, V. V., Kozlov, V. A., Parfenov, G. P., and Saksonov, P. P. (1967). The results of biological studies made on board the Voskhod and Voskhod 2 spaceships. Life Sci. Space Res. 5, 119–121

PubMed Abstract | Google Scholar

Aponte, V. M., Finch, D. S., and Klaus, D. M. (2006). Considerations for non-invasive in-flight monitoring of astronaut immune status with potential use of MEMS and NEMS devices. Life Sci. 79, 1317–1333. doi: 10.1016/j.lfs.2006.04.007

PubMed Abstract | Crossref Full Text | Google Scholar

Arisaka, B. F. (2024). Isolation and grouping of RNA phages by Itaru Watanabe et al. (1967). Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 100, 204–209. doi: 10.2183/PJAB.100.017

Crossref Full Text | Google Scholar

Arunasri, K., Adil, M., Venu Charan, K., Suvro, C., Himabindu Reddy, S., and Shivaji, S. (2013). Effect of simulated microgravity on E. coli K12 MG1655 growth and gene expression. PLoS One 8:e57860. doi: 10.1371/journal.pone.0057860

PubMed Abstract | Crossref Full Text | Google Scholar

Barrera, I., Schuppli, D., Sogo, J. M., and Weber, H. (1993). Different mechanisms of recognition of bacteriophage Q beta plus and minus strand RNAs by Q beta replicase. J. Mol. Biol. 232, 512–521. doi: 10.1006/JMBI.1993.1407

PubMed Abstract | Crossref Full Text | Google Scholar

Barrila, J., Sarker, S. F., Hansmeier, N., Yang, S., Buss, K., Briones, N., et al. (2021). Evaluating the effect of spaceflight on the host-pathogen interaction between human intestinal epithelial cells and Salmonella Typhimurium. NPJ Microgravity 7:9. doi: 10.1038/S41526-021-00136-W

PubMed Abstract | Crossref Full Text | Google Scholar

Barrila, J., Yang, J., Franco Meléndez, K. P., Yang, S., Buss, K., Davis, T. J., et al. (2022). Spaceflight analogue culture enhances the host-pathogen interaction between Salmonella and a 3-D biomimetic intestinal co-culture model. Front. Cell. Infect. Microbiol. 12:705647. doi: 10.3389/FCIMB.2022.705647

PubMed Abstract | Crossref Full Text | Google Scholar

Bernhardt, T. G., Wang, I. N., Struck, D. K., and Young, R. (2001). A protein antibiotic in the phage Qbeta virion: diversity in lysis targets. Science 292, 2326–2329. doi: 10.1126/SCIENCE.1058289

PubMed Abstract | Crossref Full Text | Google Scholar

Bradwell, K., Combe, M., Domingo-Calap, P., and Sanjuán, R. (2013). Correlation between mutation rate and genome size in riboviruses: mutation rate of bacteriophage qβ. Genetics 195, 243–251. doi: 10.1534/GENETICS.113.154963

PubMed Abstract | Crossref Full Text | Google Scholar

Brown, R. B. (1999). Effects of space flight, clinorotation, and centrifugation on the growth and metabolism of Escherichia coli. Boulder, Colorado, USA : University of Colorado.

Google Scholar

Cervantes, J. L., and Hong, B. Y. (2016). Dysbiosis and immune dysregulation in outer space. Int. Rev. Immunol. 35, 67–82. doi: 10.3109/08830185.2015.1027821

PubMed Abstract | Crossref Full Text | Google Scholar

Chang, D., Paulsen, A., Johnson, T. C., and Consigli, R. A. (1993). Virus protein assembly in microgravity. Adv. Space Res. 13, 251–257. doi: 10.1016/0273-1177(93)90380-T

PubMed Abstract | Crossref Full Text | Google Scholar

Clary, J. L., France, C. S., Lind, K., Shi, R., Alexander, J., Richards, J. T., et al. (2022). Development of an inexpensive 3D clinostat and comparison with other microgravity simulators using Mycobacterium marinum. Front. Space Technol. 3:1032610. doi: 10.3389/FRSPT.2022.1032610

Crossref Full Text | Google Scholar

Cortesão, M., Holland, G., Schütze, T., Laue, M., Moeller, R., and Meyer, V. (2022). Colony growth and biofilm formation of Aspergillus niger under simulated microgravity. Front. Microbiol. 13:975763. doi: 10.3389/fmicb.2022.975763

PubMed Abstract | Crossref Full Text | Google Scholar

Croze, O. A., Ferguson, G. P., Cates, M. E., and Poon, W. C. (2011). Migration of chemotactic bacteria in soft agar: role of gel concentration. Biophys. J. 101, 525–534. doi: 10.1016/j.bpj.2011.06.023

PubMed Abstract | Crossref Full Text | Google Scholar

Cui, Z., Gorzelnik, K. V., Chang, J. Y., Langlais, C., Jakana, J., Young, R., et al. (2017). Structures of qβ virions, virus-like particles, and the qβ–MurA complex reveal internal coat proteins and the mechanism of host lysis. Proc. Natl. Acad. Sci. USA 114, 11697–11702. doi: 10.1073/pnas.1707102114

PubMed Abstract | Crossref Full Text | Google Scholar

de Serres, F. J. (1969). Effects of radiation during space flight on microorganisms and plants on the biosatellite II and Gemini XI missions. Life Sci. Space Res. 7, 62–66.

Google Scholar

Fukunaga, H. (2020). The effect of low temperatures on environmental radiation damage in living systems: does hypothermia show promise for space travel? Int. J. Mol. Sci. 21:6349. doi: 10.3390/ijms21176349

PubMed Abstract | Crossref Full Text | Google Scholar

Furukawa, S., Nagamatsu, A., Nenoi, M., Fujimori, A., Kakinuma, S., Katsube, T., et al. (2020). Space radiation biology for “living in space.”. Biomed. Res. Int. 2020:4703286. doi: 10.1155/2020/4703286

PubMed Abstract | Crossref Full Text | Google Scholar

Gilbert, J. A., Blaser, M. J., Caporaso, J. G., Jansson, J. K., Lynch, S. V., and Knight, R. (2018). Current understanding of the human microbiome. Nat. Med. 24, 392–400. doi: 10.1038/NM.4517

PubMed Abstract | Crossref Full Text | Google Scholar

Gilbert, R., Torres, M., Clemens, R., Hateley, S., Hosamani, R., Wade, W., et al. (2020). Spaceflight and simulated microgravity conditions increase virulence of Serratia marcescens in the Drosophila melanogaster infection model. NPJ Microgravity 6:4. doi: 10.1038/S41526-019-0091-2

PubMed Abstract | Crossref Full Text | Google Scholar

Hayes, W. (1953). The mechanism of genetic recombination in Escherichia coli., in cold Spring Harbor Symposia on quantitative biology. Cold Spring Harb. Symp. Quant. Biol. 18, 75–93. doi: 10.1101/SQB.1953.018.01.016

Crossref Full Text | Google Scholar

Higginson, E. E., Galen, J. E., Levine, M. M., and Tennant, S. M. (2016). Microgravity as a biological tool to examine host–pathogen interactions and to guide development of therapeutics and preventatives that target pathogenic bacteria. Pathog Dis. 74:ftw095. doi: 10.1093/FEMSPD/FTW095

PubMed Abstract | Crossref Full Text | Google Scholar

Hofstetter, H., Monstein, H. J., and Weissmann, C. (1974). The readthrough protein A1 is essential for the formation of viable Q beta particles. Biochim. Biophys. Acta 374, 238–251. doi: 10.1016/0005-2787(74)90366-9

PubMed Abstract | Crossref Full Text | Google Scholar

Horneck, G. (1981). Survival of microorganisms in space: a review. Adv. Space Res. 1, 39–48. doi: 10.1016/0273-1177(81)90241-6

PubMed Abstract | Crossref Full Text | Google Scholar

Horneck, G., Klaus, D. M., and Mancinelli, R. L. (2010). Space microbiology. Microbiol. Mol. Biol. Rev. 74, 121–156. doi: 10.1128/mmbr.00016-09

PubMed Abstract | Crossref Full Text | Google Scholar

Huang, B., Li, D. G., Huang, Y., and Liu, C. T. (2018). Effects of spaceflight and simulated microgravity on microbial growth and secondary metabolism. Mil. Med. Res. 5:18. doi: 10.1186/s40779-018-0162-9

PubMed Abstract | Crossref Full Text | Google Scholar

Huss, P., Chitboonthavisuk, C., Meger, A., Nishikawa, K., Oates, R. P., Mills, H., et al. 2023). Bacteriophage-host interactions in microgravity onboard the international Space Station. bioRxiv, 2023.10.10.561409. doi:doi: 10.1101/2023.10.10.561409

Crossref Full Text | Google Scholar

Kidmose, R. T., Vasiliev, N. N., Chetverin, A. B., Andersen, G. R., and Knudsen, C. R. (2010). Structure of the Qbeta replicase, an RNA-dependent RNA polymerase consisting of viral and host proteins. Proc. Natl. Acad. Sci. USA 107, 10884–10889. doi: 10.1073/PNAS.1003015107

PubMed Abstract | Crossref Full Text | Google Scholar

Kim, S. M., Kim, H., Yang, D., Park, J., Park, R., Namkoong, S., et al. (2017). An experimental and theoretical approach to optimize a three-dimensional clinostat for life science experiments. Microgravity Sci. Technol. 29, 97–106. doi: 10.1007/s12217-016-9529-2

Crossref Full Text | Google Scholar

Klaus, D., Simske, S., Todd, P., and Stodieck, L. (1997). Investigation of space flight effects on Escherichia coli and a proposed model of underlying physical mechanisms. Microbiology 143, 449–455. doi: 10.1099/00221287-143-2-449

PubMed Abstract | Crossref Full Text | Google Scholar

Koaykul, C., Kim, M. H., Kawahara, Y., Yuge, L., and Kino-Oka, M. (2019). Alterations in nuclear Lamina and the cytoskeleton of bone marrow-derived human mesenchymal stem cells cultured under simulated microgravity conditions. Stem Cells Dev. 28, 1167–1176. doi: 10.1089/SCD.2018.0229

PubMed Abstract | Crossref Full Text | Google Scholar

Kuzichkin, D. S., Nichiporuk, I. A., Zhuravleva, O. A., Markin, A. A., Rykova, M. P., Zhuravleva, T. V., et al. (2022). Endothelial dysfunction markers and immune response indices in cosmonauts’ blood after long-duration space flights. NPJ Microgravity 8:46. doi: 10.1038/s41526-022-00237-0

PubMed Abstract | Crossref Full Text | Google Scholar

Laguna-Castro, M., and Lázaro, E. (2022). Propagation of an RNA bacteriophage at low host density leads to a more efficient virus entry. Front. Virol. 2, 1–12. doi: 10.3389/fviro.2022.858227

Crossref Full Text | Google Scholar

Laguna-Castro, M., Rodríguez-Moreno, A., and Lázaro, E. (2024). Evolutionary adaptation of an RNA bacteriophage to repeated freezing and thawing cycles. Int. J. Mol. Sci. 25:4863. doi: 10.3390/IJMS25094863

PubMed Abstract | Crossref Full Text | Google Scholar

Laguna-Castro, M., Rodríguez-Moreno, A., Llorente, E., and Lázaro, E. (2023). The balance between fitness advantages and costs drives adaptation of bacteriophage qβ to changes in host density at different temperatures. Front. Microbiol. 14:1197085. doi: 10.3389/FMICB.2023.1197085

PubMed Abstract | Crossref Full Text | Google Scholar

Lázaro, E., Arribas, M., Cabanillas, L., Román, I., and Acosta, E. (2018). Evolutionary adaptation of an RNA bacteriophage to the simultaneous increase in the within-host and extracellular temperatures. Sci. Rep. 8:8080. doi: 10.1038/s41598-018-26443-z

PubMed Abstract | Crossref Full Text | Google Scholar

Lehr, F. X., Pavletić, B., Glatter, T., Heimerl, T., Moeller, R., and Niederholtmeyer, H. (2024). Enhanced assembly of bacteriophage T7 produced in cell-free reactions under simulated microgravity. NPJ Microgravity 10, 30–12. doi: 10.1038/s41526-024-00378-4

PubMed Abstract | Crossref Full Text | Google Scholar

Mahnert, A., Verseux, C., Schwendner, P., Koskinen, K., Kumpitsch, C., Blohs, M., et al. (2021). Microbiome dynamics during the HI-SEAS IV mission, and implications for future crewed missions beyond earth. Microbiome 9:27. doi: 10.1186/s40168-020-00959-x

PubMed Abstract | Crossref Full Text | Google Scholar

Martirosyan, A., Falke, S., McCombs, D., Cox, M., Radka, C. D., Knop, J., et al. (2022). Tracing transport of protein aggregates in microgravity versus unit gravity crystallization. NPJ Microgravity 8:4. doi: 10.1038/s41526-022-00191-x

PubMed Abstract | Crossref Full Text | Google Scholar

McKaig, J., Caro, T., Burton, D., Tavares, F., and Vidaurri, M. (2024). Chapter 10: planetary protection—history, science, and the future. Astrobiology 24, S-202–S-215. doi: 10.1089/ast.2021.0112

PubMed Abstract | Crossref Full Text | Google Scholar

McPherson, A., and DeLucas, L. J. (2015). Microgravity protein crystallization. NPJ Microgravity 1:15010. doi: 10.1038/npjmgrav.2015.10

PubMed Abstract | Crossref Full Text | Google Scholar

Mortazavi, S. M. J. (2019). Acquired antibiotic resistance in Escherichia coli exposed to simulated microgravity: possible role of other space stressors and adaptive responses. MBio 10, 1–2. doi: 10.1128/MBIO.00165-19

Crossref Full Text | Google Scholar

Nickerson, C. A., Ott, C. M., Wilson, J. W., Ramamurthy, R., and Pierson, D. L. (2004). Microbial responses to microgravity and other low-shear environments. Microbiol. Mol. Biol. Rev. 68, 345–361. doi: 10.1128/MMBR.68.2.345-361.2004

PubMed Abstract | Crossref Full Text | Google Scholar

Partridge, J. D. (2022). Surveying a swarm: experimental techniques to establish and examine bacterial collective motion. Appl. Environ. Microbiol. 88:e0185321. doi: 10.1128/AEM.01853-21

PubMed Abstract | Crossref Full Text | Google Scholar

Piscon, B., Pia Esposito, E., Fichtman, B., Samburski, G., Efremushkin, L., Amselem, S., et al. (2023). The effect of outer space and other environmental cues on bacterial conjugation. Microbiol. Spectr. 11:e0368822. doi: 10.1128/spectrum.03688-22

PubMed Abstract | Crossref Full Text | Google Scholar

Rea, G., Cristofaro, F., Pani, G., Pascucci, B., Ghuge, S. A., Corsetto, P. A., et al. (2016). Microgravity-driven remodeling of the proteome reveals insights into molecular mechanisms and signal networks involved in response to the space flight environment. J. Proteome 137, 3–18. doi: 10.1016/J.JPROT.2015.11.005

PubMed Abstract | Crossref Full Text | Google Scholar

Rosenzweig, J. A., Abogunde, O., Thomas, K., Lawal, A., Nguyen, Y. U., Sodipe, A., et al. (2010). Spaceflight and modeled microgravity effects on microbial growth and virulence. Appl. Microbiol. Biotechnol. 85, 885–891. doi: 10.1007/S00253-009-2237-8

PubMed Abstract | Crossref Full Text | Google Scholar

Saei, A. A., and Barzegari, A. (2012). The microbiome: the forgotten organ of the astronauts body - probiotics beyond terrestrial limits. Future Microbiol. 7, 1037–1046. doi: 10.2217/fmb.12.82

PubMed Abstract | Crossref Full Text | Google Scholar

Santomartino, R., Waajen, A. C., de Wit, W., Nicholson, N., Parmitano, L., Loudon, C. M., et al. (2020). No effect of microgravity and simulated Mars gravity on final bacterial cell concentrations on the international Space Station: applications to space bioproduction. Front. Microbiol. 11, 1–15. doi: 10.3389/fmicb.2020.579156

PubMed Abstract | Crossref Full Text | Google Scholar

Sender, R., Fuchs, S., and Milo, R. (2016). Revised estimates for the number of human and bacteria cells in the body. PLoS Biol. 14:e1002533. doi: 10.1371/journal.pbio.1002533

Crossref Full Text | Google Scholar

Shkoporov, A. N., and Hill, C. (2019). Bacteriophages of the human gut: the “known unknown” of the microbiome. Cell Host Microbe 25, 195–209. doi: 10.1016/J.CHOM.2019.01.017

PubMed Abstract | Crossref Full Text | Google Scholar

Siddiqui, R., Akbar, N., and Khan, N. A. (2021). Gut microbiome and human health under the space environment. J. Appl. Microbiol. 130, 14–24. doi: 10.1111/jam.14789

PubMed Abstract | Crossref Full Text | Google Scholar

Somovilla, P., Manrubia, S., and Lázaro, E. (2019). Evolutionary dynamics in the RNA bacteriophage qβ depends on the pattern of change in selective pressures. Pathogens 8:80. doi: 10.3390/PATHOGENS8020080

PubMed Abstract | Crossref Full Text | Google Scholar

Sonnenfeld, G. (1998). Immune responses in space flight. Int. J. Sports Med. 19, S195–S204. doi: 10.1055/s-2007-971992

PubMed Abstract | Crossref Full Text | Google Scholar

Su, X., Guo, Y., Fang, T., Jiang, X., Wang, D., Li, D., et al. (2021). Effects of simulated microgravity on the physiology of Stenotrophomonas maltophilia and Multiomic analysis. Front. Microbiol. 12:701265. doi: 10.3389/FMICB.2021.701265

PubMed Abstract | Crossref Full Text | Google Scholar

Taniguchi, T., Palmieri, M., and Weissmann, C. (1978). QB DNA-containing hybrid plasmids giving rise to QB phage formation in the bacterial host. Nature 274, 223–228. doi: 10.1038/274223A0

PubMed Abstract | Crossref Full Text | Google Scholar

Taylor, G. R. (1974). Space microbiology. Ann. Rev. Microbiol. 28, 121–137. doi: 10.1146/ANNUREV.MI.28.100174.001005

PubMed Abstract | Crossref Full Text | Google Scholar

Thimann, K. V. (1968). Biosatellite II experiments: preliminary results. Proc. Natl. Acad. Sci. USA 60, 347–361. doi: 10.1073/PNAS.60.2.347

PubMed Abstract | Crossref Full Text | Google Scholar

Tirumalai, M. R., Karouia, F., Tran, Q., Stepanov, V. G., Bruce, R. J., Ott, C. M., et al. (2019). Evaluation of acquired antibiotic resistance in Escherichia coli exposed to long-term low-shear modeled microgravity and background antibiotic exposure. MBio 10:e02637. doi: 10.1128/MBIO.02637-18

PubMed Abstract | Crossref Full Text | Google Scholar

Topolski, C., Divo, E., Li, X., Hicks, J., Chavez, A., and Castillo, H. (2022). Phenotypic and transcriptional changes in Escherichia coli K12 in response to simulated microgravity on the EagleStat, a new 2D microgravity analog for bacterial studies. Life Sci. Space Res. 34, 1–8. doi: 10.1016/j.lssr.2022.04.003

PubMed Abstract | Crossref Full Text | Google Scholar

Voorhies, A. A., and Lorenzi, H. A. (2016). The challenge of maintaining a healthy microbiome during long-duration space missions. Front. Astron. Space Sci. 3:23. doi: 10.3389/FSPAS.2016.00023

Crossref Full Text | Google Scholar

Walker, P. J., Siddell, S. G., Lefkowitz, E. J., Mushegian, A. R., Adriaenssens, E. M., Alfenas-Zerbini, P., et al. (2021). Changes to virus taxonomy and to the international code of virus classification and nomenclature ratified by the international committee on taxonomy of viruses (2021). Arch. Virol. 166, 2633–2648. doi: 10.1007/S00705-021-05156-1

PubMed Abstract | Crossref Full Text | Google Scholar

Wazir, H. U., Narang, P., Silvani, G., Mehner, C., Poole, K., Burke, C., et al. (2023). Bacterial virulence and prevention for human spaceflight. Life 13:656. doi: 10.3390/LIFE13030656

PubMed Abstract | Crossref Full Text | Google Scholar

Wilson, J. W., Ott, C. M., Höner Zu Bentrup, K., Ramamurthy, R., Quick, L., Porwollik, S., et al. (2007). Space flight alters bacterial gene expression and virulence and reveals a role for global regulator Hfq. Proc. Natl. Acad. Sci. USA 104, 16299–16304. doi: 10.1073/pnas.0707155104

PubMed Abstract | Crossref Full Text | Google Scholar

Zea, L., Larsen, M., Estante, F., Qvortrup, K., Moeller, R., de Oliveira, S. D., et al. (2017). Phenotypic changes exhibited by E. coli cultured in space. Front. Microbiol. 8, 1–12. doi: 10.3389/fmicb.2017.01598

Crossref Full Text | Google Scholar

Zhou, J., Ruggeri, F. S., Zimmermann, M. R., Meisl, G., Longo, G., Sekatskii, S. K., et al. (2020). Effects of sedimentation, microgravity, hydrodynamic mixing and air-water interface on α-synuclein amyloid formation. Chem. Sci. 11, 3687–3693. doi: 10.1039/D0SC00281J

PubMed Abstract | Crossref Full Text | Google Scholar