Characterization and Pathogenicity of Very Virulent IBDV

Huansheng Wu^*Qi LiuJiangjiang NieYing HuQinghua ZengKe WangXiangdong WuZheng ChenHuali Xie

• Jiangxi Agricultural University, Nanchang, China

1 Introduction Infectious bursal virus belongs to the family Birnaviridae and the genus Avibirnavirus [1]. The Birnaviridae family has three virus genera, including the Avibirnavirus represented by IBDV, Aquabirnavirus represented by Infectious Pancreatic Necrosis virus (IPNV) and Entomobirnavirus represented by Drosophila X Virus (DXV) [2]. The IBDV genome contains double-stranded RNA (dsRNA) in Segments A and B. The non-structural protein VP5 and the polyproteins VP2-VP4-VP3 are encoded by Segment A (about 3.2 kb).Among these, the polyprotein undergoes further self-cleavage to produce the precursors VP2, VP3, and VP4. After additional processing, PVP2 yields mature VP2 and a number of tiny peptides [3]. VP2 is the outside capsid protein that includes the main protective antigen and even neutralizing epitopes [1]. In addition, the highly variable region (HVR) of VP2 plays an important role in the cytotropism, virulence and antigenic variation of the virus. The antigenic variation of IBDV mainly stems from the mutation in the high-variability region of VP2 (amino acids 206-350) [4]. Variant strains, such as the Del-E strain in the United States, have significant differences from traditional strains in this region, causing them to evade the immune protection induced by traditional vaccines [5]. Molecular epidemiological studies have shown that the VP2 of vvIBDV is highly conserved worldwide (>96% similarity), suggesting that these strains may originate from a single ancestral virus [6]. It is worth noting that naturally occurring recombination events (recombination of segments A and B) have also led to the emergence of new virus strains, such as the A2dB1 recombinant strain discovered in China in recent years [7]. VP3, as the "scaffold protein" of the virus, not only participates in capsid assembly but also combines with the viral dsRNA to form virus replication complex (RPC). Studies have shown that VP3 plays an important role in inhibiting the host's innate immune response [8-10]. It can block the activation of interferon regulatory factor 7 (IRF7), resulting to inhibit the type I interferon generation [11]. As an RNA polymerase, VP1 has a unique "genomic ligation" activity and is capable of covalently ligation viral RNA in vitro. This characteristic is quite unique in the Birnaviridae family[12 13]. IBDV mainly targets Bursa of Fabricius (BF), the central immune organ of young chickens, especially disrupts the IgM+ B cell subset of immature B lymphocytes. IBDV infection leads to the massive apoptosis of these cells, resulting in damaged immunosuppression [14]. There are classified into two subgroups of IBDV (type I and type II), but only serum type I causes great damage to young chickens. Serum type I viruses can be further classified into classic strains (such as STC, F52/70), variant strains (such as Del-E, GLS), and very virulent strains (vvIBDV, such as HK46, UK661) [6]. These different strains have significant differences in pathogenicity, antigenicity and molecular characteristics. Since the emergence of very virulent strains in the late 1980s, they have become a major threat to the global chicken farming industry, with a mortality rate of 70-100% [15]. IBDV has extremely strong stability and is resistant to a variety of physical and chemical factors [16]. The virus remains stable within the pH range of 2 to 12, is insensitive to ether, chloroform and trypsin, and can still remain infectious after being treated at 56°C for 5 hours. This strong environmental resistance enables the virus to survive for a long time in the breeding environment, increasing the difficulty of prevention and control [17]. In recent years, the Infectious Bursal Disease Viruses (IBDVs) isolated from chicken farms in Jiangxi Province are mainly composed of very virulent strains (vvIBDVs) and novel variant strains. For instance, a case of co-infection with vvIBDV and Chicken Infectious Anemia Virus (CIAV) was detected in a layer farm in Jiangxi in 2024. Sequencing results revealed that this vvIBDV belongs to a novel variant strain, and its genomic characteristics are significantly different from those of traditional strains. In addition, the A3B3 genotype (e.g., HLJ0504-like strain), which is prevalent nationwide, also poses a potential transmission risk in Jiangxi Province. This type of strain causes more severe damage to the bursa of Fabricius, often leading to high mortality and immunosuppression in infected chickens. In this study, BF tissues of chickens infected with IBDV in Jiangxi Province vaccinated IBDV were collected. Chicken embryo inoculation was carried out, and a very virulent strain IBDV was isolated and identified. Both Segment A and B were assortment from very virulent IBDV, with the genotype A3B3[18 19]. What's more, the pathogenicity of SM01 strain was evaluated by infecting SPF chickens, and the results suggested that the very virulent strain SM01 IBDV could cause severe pathological damage to the BF. 2 Materials and Methods 2.1 Chickens and Embryos Specific pathogens-free (SPF) chickens were supplied by the Nanchang Miaowang Hatchery (Nanchang, China). SPF embryos were purchased from Shandong Haotai Experimental Animal Breeding Co., Ltd (Shandong, China). 2.2 Samples collection In September 2023, the 5-week-old vaccinated chickens grew slowly with poor uniformity, feather disheveled as well as sever atrophy of bursal. Additionally, the main grievance was immunosuppression disorder symptoms. This farm has been immunized with attenuated IBDV vaccine. Several five bursa of Fabricius (BF) tissues were collected from diseased chickens for RT-PCR detection. The positive samples were homogenized in PBS, and then frozen and thawed three to five times to release virus(Frozen at -80℃ and thawed at room temperature). After that, the samples were subjected to centrifuge at 12,000 g for 10 min to get the supernatants for virus isolation. 2.3 IBDV molecular detection The total RNA of the BF tissues was extracted using the TRIzol reagent based on the manufacture's descriptions. The positive IBDV samples were detected according to a previous reporting RT-PCR assay [20]. 2.4 Virus isolation and genome sequencing The suspensions of IBDV positive BF tissues were filtered through 0.22 μm syringe filters and injected into the 10-day-old SPF chicken embryos for passaging. The dyed embryos were further analyzed by the RT-PCR for confirming the IBDV positive. To detect the purity of the isolated IBDV, avian leucosis virus (ALV), Marek's disease virus (MDV), chicken anemia virus (CAV) and fowl adenovirus serotype 4 (FAdV4) were detected by PCR; avian influenza virus (AIV) and Newcastle disease virus (NDV) were examined by hemagglutination assay. The full length of viral genome of segment A and segment B were amplified by RT-PCR using the following primers, IBDVAF: GGATACGATCGGTCTGACCC, IBDVAR:CCGGACCCGCGAACGGAT; IBDVBF:GGATACGATGGGTCTGACCCTCT and IBDVBR: GGGGGCCCCCGCAGGCGAA. The PCR products were sub cloned into pMD19-T vectors for next sequencing. 2.5 Multiple alignment and phylogenetic analysis The Segment A and B of SM01 strain used in this study have been registered in GenBank (PQ562378.1 and PQ562379). The multi-sequence alignment was performed using Jalview software to align its nucleotide sequences with multiple referenced IBDV strains, and the adjacent method of 1000 bootstrap repetitions in MEGA 7 software was used to build the phylogenetic tree. 2.6 Pathogenicity evaluation Passage was performed via the allantoic cavity inoculation method. Specifically, 9-to 11-day-old chicken embryos with good developmental status were selected. The boundaries of the air cell and the embryo position were marked under an egg candler. A mark was made as the injection site at approximately 1 mm from the edge of the junction between the embryo surface and the air cell, avoiding blood vessels. Subsequently, the injection site was disinfected with alcohol, and a small hole of about 2 mm was drilled at the injection site using an egg drill. Then, a 1 mL syringe was used to draw 0.1-0.2 mL of the virus inoculum, which was injected into the allantoic cavity. After completion, the small hole was sealed with medical tape or paraffin. The chicken embryos were then placed on an egg rack with the air cell facing upward and incubated in an incubator at 33-35℃ for 48-72 hours. During the incubation period, egg candling was conducted daily to check the embryos. The death of chicken embryos was determined based on the condition of blood vessels, fetal movement, and the developmental boundary of the chorioallantoic membrane. The SM01 strain was inoculated into 1-day-old SPF chickens through eye and nasal drops at a dose of 0.4 mL per chicken with a virus titer of 10-5.5 EID50/0.4mL, totaling 18 chickens. Meanwhile, 18 experimental chickens of the same batch were inoculated with normal saline through the same route as the control group, with 0.4 mL per chicken. Observe the symptoms of the test chickens every day until the 14th day. After 3, 5, 7 and 14 days of virus exposure, 3 chickens were randomly picked from each group for weighing. Then, the BF tissues were dissected and observed. The BF tissues were taken for weighing, and the ratio of chickens (BF (mg)/chicken (g)) was calculated. And analyze the bursa-body index (BBIX), BBIX= the ratio of bursal in infected chickens/the average ratio of bursal in the control chickens (when the bursae index BBIX < 0.7, bursae are judged as atrophied) [21]. 2.7 Histopathology analysis Among the tissues taken on the 3, 5, 7 and 14 days after SM01 challenge, the BF tissues with obvious lesions were fixed with 4% paraformaldehyde tissue fixative to make pathological sections for histological observation. 2.8 Statistical analysis All statistical analyses were conducted using GraphPadPrism9.5 (San Diego, CA, USA). The obtained data were statistically analyzed by software. P value <0.01(**) was considered extremely significant. Descriptive results Total RNA in BF tissues suspected infected with IBDV were extracted. One of five BF tissues was IBDV positive. In addition, no infectious of other viruses were present as determined by PCR. The BF homogenates were injected into 10-day SPF chicken embryos for passaging. After the virus of the BF tissues on the chicken embryos for three generations, it could cause the death of the chicken embryos within 5 days. The alluvial membranes of the diseased and dead chicken embryos of generations 1 to 3 were hemorrhagic. Visually, white pimples could be seen on the alluvial membranes. The bleeding of the chicken embryos was severe, especially on the head, wings and legs (Fig. 1A). The embryos, allantoic fluid were recovered for RT-PCR testing, and the results were positive (Data not shown). This isolated IBDV was named as the SM01 strain. Then, PCR amplification of the SM01 genome was performed using the amplification primers of Segments A and B, and the target gene fragments of sizes about 3200 bp and 2800 bp were expected to be obtained. The electrophoresis results showed that the size of the target fragment was consistent with the expected size, and the target band was single without miscellaneous bands (Data not shown). Taken together, one IBDV, named SM01 strain, was successfully isolated from clinical positive samples derived from vaccinated poultry farm in Jiangxi province. The full-length of Segments A and B of SM01 from died embryos were determined and sequenced. The revealed that Segments A was 3259 nucleotides, and Segment B was 2843 nucleotides. Segment A consists a small ORF that encodes VP5 protein, and a larger ORF that encodes the polyprotein. In addition, the Segment B contains only one ORF that encodes VP1, the polymerase protein of IBDV. Based on phylogenetic trees of nucleotide sequences of polyprotein, IBDV was classified into four genogroups: A1a (classic IBDV), A1b (attenuated IBDV), A2d (novel variant IBDV), and A3 (very virulent IBDV) [18]. The serotype II of IBDV, non-pathological to chickens, locates a distinguished branch [22, 23]. The IBDV SM01 strain was clustered with MB Israel strain, which is a representative strain of very virulent IBDV (vvIBDV) (Fig. 1B).Compared with the international standard A3B3 genotype reference strain MB Israel, the SM01 strain shares a full-length nucleotide homology of 96.2%–98.7% and an amino acid homology of 98.8%– 99.4% in Segment A with it. The characteristic amino acids in the hypervariable region (HVR) of VP2 (e.g., 222A, 256I, 294I) are completely consistent, which further supports its very virulent (vv) phenotype. In addition, there were also three subgroups, B1, B2 and B3, according to phylogenetic tree of nucleotide sequences of VP1 [19]. In Segment B phylogenetic tree, very virulent strain such as HLJ0504, classic strain such as Gt, novel variant strain such as Cu-1wt, and serum type II reference strain jointly form a large branch. Among them, the SM01 strain forms an independent small branch with very virulent strains such as PK2 and Gx, and has the closest genetic relationship (Fig. 1C).Compared with the domestic A3B3 genotype strain Gx, the SM01 strain exhibits a nucleotide homology of 98.2% and an amino acid homology of 99.5% with the Gx strain in Segment B . The two strains are highly consistent in the conserved functional domains of VP1, suggesting a similarity in their replication mechanisms.Compared with the PK2 strain, the SM01 strain shares a nucleotide homology of 97.5% and an amino acid homology of 98.9% with the PK2 strain in Segment B. The two strains form a tight clade in the phylogenetic tree of VP1, indicating a close evolutionary relationship between their polymerase genes. Previous reports have revealed that the highly variable region (HVR, amino acids 202-350) of VP2 is crucial domain, which consists most of the eptitopes and correlates with the virulence and variation of IBDV [24]. Sequence comparison of the HVR of VP2 revealed that the HVR of VP2 in the isolate SM01 has the same heptapeptide region amino acid sequence "SWSASGS" as very virulent IBDV, and also has very virulent IBDV characteristic amino acids.This specifically includes combinations of amino acid positions such as 222A, 256I, 279D, 284A, 294I, and 299S. Based on the results of genetic evolution and homology analysis, it is speculated that the isolated strain SM01 is a virulent strain of IBDV (Fig. 1D). The SM01 strain was inoculated into 1-day-old SPF chickens by nasal drops. As anticipated, during the animal trial, no obvious clinical symptoms were observed in the early stage of challenge (1-2 days); from day 3 onwards, symptoms such as depression and fluffy feathers appeared, and the bursa of Fabricius began to show atrophy and lymphocyte necrosis. Though none of the hens perished during the experiment, the SM01-inoculated chickens showed clinical indications of atypical IBD, such as depressed, puffy feathers, decreased appetite and drinking, and diarrhea. All of the SM01-inoculated hens displayed bursal atrophy at the start of the three-day post-infection period, but no overt gelatin-like deposits were seen. (Fig. 2A). BF tissues were taken for weighing, and then calculating the BBIX and bursa-body ratio. The BBIX in the inoculated group was lower than 0.7 after 5 and 7 days of infection. After 14 days of post-infection, the BBIX was higher than 0.7 (Fig. 2B), suggesting that the damage of BF tissues was gradually restored. At the meantime, bursa-body ratio of challenged chickens was significantly reduced at the beginning of 3 days of infection in compared with that in the control chickens (Fig. 2C). As the results showed in(Fig. 2D)we found that on the 3 days after infected with SM01, obvious pathological damage began to appear in the BF tissues. The lymphocytes in the dermis and medulla necrotic cells were necrotic, dissolved and greatly reduced, and there was a large proliferation of epithelial cells and connective tissue. In compared with the challenged group chickens, no obvious pathological damage was observed in the chickens of control group. In conclusion, this study demonstrated that we isolated a vvIBDV, which both of Segment A and Segment B are from the very virulent strain. Figure legends 1. Asfor AS, Reddy V, Nazki S, Urbaniec J, Brodrick AJ, Broadbent AJ: Modeling Infectious Bursal Disease Virus (IBDV) Antigenic Drift In Vitro. Viruses 2022, 15. 2. Duan K, Zhao J, Ren G, Shao Y, Lu T, Xu L, Tang X, Zhao W, Xu L: Molecular Evolution of Infectious Pancreatic Necrosis Virus in China. Viruses 2021, 13. 3. Huang M, Xu M, Han J, Ke E, Niu X, Zhang Y, Wang G, Yu H, Liu R, Wang S, et al: Enhancing MyD88 oligomerization is one important mechanism by which IBDV VP2 induces inflammatory response. PLoS Pathog 2025, 21:e1012985. 4. Bo Z, Wang S, Xu K, Zhang C, Guo M, Cao Y, Zhang X, Wu Y: Isolation and genomic characteristics of the novel variant infectious bursal disease virus in China. Front Vet Sci 2023, 10:1314903. 5. Jackwood DJ, Sommer-Wagner SE: Amino acids contributing to antigenic drift in the infectious bursal disease Birnavirus (IBDV). Virology 2011, 409:33-37. 6. Zhang W, Wang X, Gao Y, Qi X: The Over-40-Years-Epidemic of Infectious Bursal Disease Virus in China. Viruses 2022, 14. 7. Wang Y, Jiang N, Fan L, Niu X, Zhang W, Huang M, Gao L, Li K, Gao Y, Liu C, et al: Identification and Pathogenicity Evaluation of a Novel Reassortant Infectious Bursal Disease Virus (Genotype A2dB3). Viruses 2021, 13. 8. Gimenez MC, Issa M, Sheth J, Colombo MI, Terebiznik MR, Delgui LR: Phosphatidylinositol 3-Phosphate Mediates the Establishment of Infectious Bursal Disease Virus Replication Complexes in Association with Early Endosomes. J Virol 2021, 95. 9. Deng T, Hu B, Wang X, Ding S, Lin L, Yan Y, Peng X, Zheng X, Liao M, Jin Y, et al: TRAF6 autophagic degradation by avibirnavirus VP3 inhibits antiviral innate immunity via blocking NFKB/NF-kappaB activation. Autophagy 2022, 18:2781-2798. 10. Deng T, Hu B, Wang X, Lin L, Zhou J, Xu Y, Yan Y, Zheng X, Zhou J: Inhibition of Antiviral Innate Immunity by Avibirnavirus VP3 via Blocking TBK1-TRAF3 Complex Formation and IRF3 Activation. mSystems 2021, 6. 11. Wang Z, Chen Y, Chen Y, Chen R, Wang W, Hu S, Li Y, Chen H, Wei P, He X: Infectious bursal disease virus affecting interferon regulatory factor 7 signaling through VP3 protein to facilitate viral replication. Front Cell Infect Microbiol 2024, 14:1529159. 12. Lombardo E, Maraver A, Caston JR, Rivera J, Fernandez-Arias A, Serrano A, Carrascosa JL, Rodriguez JF: VP1, the putative RNA-dependent RNA polymerase of infectious bursal disease virus, forms complexes with the capsid protein VP3, leading to efficient encapsidation into virus-like particles. J Virol 1999, 73:6973-6983. 13. Hu X, Chen Z, Wu X, Ding Z, Zeng Q, Wu H: An Improved, Dual-Direction, Promoter-Driven, Reverse Genetics System for the Infectious Bursal Disease Virus (IBDV). Viruses 2022, 14. 14. Quan R, Zhu S, Wei L, Wang J, Yan X, Li Z, Liu J: Transcriptional profiles in Figure 1: Virus isolation, phylogenetic tree construction and sequence analysis. (A) The 10-day SPF chicken embryos were injected with the positive samples. The slowly growth of the dead chicken embryos could be observed. (B-C) The trees of segment A and B were constructed by the neighbor-joining method with MEGA7 software. The very virulent strain isolated in this study (IBDV-SM01 China) was highlighted with a black frame. (D) The highly variable region of SM01 VP2 were compared to those of other IBDV strains that were cited. The several significant domains are indicated by the black frames. Figure 2: Pathological analysis of IBDV SM01 strain. This figure provide the results of SPF chicken challenged with the IBDV SM01 strain. (A) Post-mortem examination of BF tissues was conducted on chickens infected with the SM01 strain. (B) BBIX index examination of chickens was conducted after the different time of exposing the SM01 strain. The BBIX index lower than 0.7 indicates the sever disruption of BF. (C) Bursal weight ratio of challenged and control chickens was also analyzed after 3, 5, 7 and 14 days of SM01 strain infection. (D) The pathological damage BF tissues was tested by HE staining after 3, 5, 7 and 14 days of infection SM01 strain.