ORIGINAL RESEARCH article

Front. Vet. Sci., 12 February 2026

Sec. Animal Nutrition and Metabolism

Volume 12 - 2025 | https://doi.org/10.3389/fvets.2025.1690922

Effects of probiotic supplementation on growth and meat quality of Simmental bulls

  • Department of Biology and Food Engineering, Lyuliang University, Lishi, China

Abstract

Probiotics are well established to enhance animal immunity and gastrointestinal health, while also improving meat tenderness and antioxidant status. This study evaluated the effects of dietary probiotic supplementation on growth and meat quality of Simmental bulls. Forty Simmental bulls were randomly assigned by body weight to one of four groups, receiving a basal diet supplemented with probiotics at 0, 0.1, 0.2, or 0.3 g per kg of dry matter (DM). The trial included a 20-day adaptation phase followed by a 60-day experimental period. Dietary probiotic supplementation did not affect DM intake or carcass traits (p > 0.05) but linearly increased average daily gain (p = 0.001) and reduced the feed conversion ratio (p = 0.001). Increasing the probiotic dose linearly enhanced meat redness (p = 0.007), while decreasing cooking loss (p = 0.022) and shear force (p = 0.014). Intramuscular fat content and triglyceride levels increased significantly (p = 0.017 and 0.001, respectively), showing linear and quadratic patterns. Antioxidant indices were also strengthened with increasing dosage, including total antioxidant capacity (p = 0.005) and glutathione peroxidase activity (p = 0.012) in a linear manner, and catalase activity (p = 0.012) in a quadratic manner. The probiotic supplementation linearly reduced the proportions of C16:0 (p = 0.008) and saturated fatty acids (SFA) (p = 0.001), and increased the proportions of C18:1n9c (p = 0.013), C22:5n3 (p = 0.017), monounsaturated fatty acids (p = 0.009), polyunsaturated fatty acids (p = 0.007), unsaturated fatty acids (UFA) (p = 0.001), and the UFA/SFA ratio (p = 0.001). The probiotics linearly upregulated the mRNA expression of fatty acid synthase, acetyl-CoA carboxylase, and sterol regulatory element binding transcription factor 1 (p = 0.002, 0.001, and 0.010), quadratically upregulated stearoyl-CoA desaturase 1 and peroxisome proliferate-activated receptor α (p = 0.001 and 0.003), and linearly downregulated carnitine palmitoyltransferase 1B (p = 0.009). Collectively, our results establish that 0.2 g/kg DM is the optimal dosage of dietary probiotic supplementation for simultaneously enhancing bull growth and beef quality. This work validates probiotics as a sustainable feeding strategy and opens new avenues for improving meat quality through microbial manipulation.

1 Introduction

With growing awareness of healthy living, consumer demand for high-quality beef has significantly increased. However, intensive farming practices often improve feeding efficiency at the expense of beef quality (1, 2). Enhancing nutritional value and sensory attributes, particularly intramuscular fat (IMF) content and fatty acid composition, has therefore become a major goal in livestock production. IMF significantly influences beef quality, such as appearance, tenderness, water-holding capacity, and flavor (3). A balanced ratio of unsaturated fatty acids (UFA) in IMF also provides health benefits, including reduced risk of human chronic diseases (4). Understanding the mechanisms that regulate IMF deposition and fat metabolism is thus essential for breeding livestock with improved meat quality and mitigating metabolic disorders.

Probiotics are extensively utilized in animal production due to their beneficial effects on growth performance, immunity, and gastrointestinal health (5, 6). Emerging evidence indicates that probiotic supplementation can modulate meat quality and fat deposition in livestock (7). For example, dietary lactic acid bacteria has been shown to reduce pork shear force and alter fatty acid profiles through upregulation of genes like stearoyl-CoA desaturase (SCD) and peroxisome proliferate-activated receptor α (PPARα) (8). Similarly, lactic acid bacteria supplementation in Sunit lambs enhanced tenderness and IMF deposition by increasing lipogenic gene expression (acetyl-CoA carboxylase, ACC; sterol regulatory element binding transcription factor 1, SREBF1; fatty acid synthase, FAS) and suppressing lipolytic genes (protein kinase AMP-activated catalytic subunit α2, AMPKα2; carnitine palmitoyltransferase 1B, CPT1B) (9). These findings suggested that lactic acid bacteria improved meat quality by promoting lipogenesis and inhibiting lipolysis. However, few studies have examined its effects on IMF deposition and regulatory pathways in cattle.

We hypothesized that probiotic supplementation would enhance growth and IMF deposition through modulation of lipogenic pathways. This study investigated how different levels of probiotic supplementation affect growth and meat quality in bulls. To our knowledge, this is the first study assessing graded probiotic supplementation on IMF deposition and gene expression in Simmental bulls. The finding will offer important insights into improving beef quality through microbial strategies and support sustainable livestock production.

2 Materials and methods

The probiotic supplement (1011CFU/g), composed of a 1:1 blend of Lacticaseibacillus casei 29 and Lactiplantibacillus plantarum 194, was obtained from Animik Biotechnology Co., Ltd. (Luohe, China). This formulation incorporated a 0.5% poly-γ-glutamic acid coating to ensure bacterial viability during gastrointestinal transit.

2.1 Animals and experimental design

The experimental protocol received approval from the Animal Care and Use Committee of Lyuliang University and followed the guidelines in the Guide for the Care and Use of Agricultural Animals in Research and Teaching.1

Forty Simmental bulls (440 ± 18 days old, 562 ± 7.5 kg initial body weight, BW) were stratified by BW and randomly allocated to one of four dietary treatments (n = 10 per group) in a completely randomized design. Throughout the trial, each animal was housed individually in separate pens. The control group (CON) received a basal diet without probiotics, while the treatment groups received graded levels of probiotic supplementation: low-dose (LP, 0.1 g/kg DM), medium-dose (MP, 0.2 g/kg DM), and high-dose (HP, 0.3 g/kg DM). These supplementation levels were selected based on a previous study by He et al. (7). The total mixed ration was formulated to meet the nutritional requirements for beef cattle as established in the Nutrient Requirements of Beef Cattle (8th revised edition, NRC, 2016) (10), with detailed diet composition and nutrient levels provided in Table 1. Probiotics were premixed into approximately 150 g of the daily ration before feeding to ensure uniform distribution. The experiment spanned 80 days, including a 20-day adaptation phase followed by a 60-day experimental period. Treatments were initiated at the beginning of adaptation. All bulls were fed twice daily (07:00 and 19:00 h) and had unrestricted access to feed and water.

Table 1

ItemsContents [g/kg]
ControlLPMPHP
Ingredients
Corn silage500500500500
Corn grain, ground275275275275
Wheat bran34343434
Soybean meal120120120120
Cottonseed meal40404040
Probiotics00.10.20.3
Calcium carbonate5555
Salt5555
Calcium biphosphate15151515
Sodium bicarbonate5555
Mineral and vitamin premixa1111
Chemical composition
NEm (MJ/kg)7.567.567.567.56
NEg (MJ/kg)5.175.175.175.17
Dry matter605.3605.3605.3605.3
Organic matter940.1940.1940.1940.1
Ether extract52.452.452.452.4
Crude protein155.5155.5155.5155.5
Neutral detergent fiber322.8322.8322.8322.8
Acid detergent fiber179.0179.0179.0179.0
Calcium6.76.76.76.7
Phosphorus4.24.24.24.2

Ingredient and chemical composition of experimental diets (DM basis).

a

Contained per kg premix: 100 mg Co, 8,500 mg Cu, 50,000 mg Fe, 30,000 mg Mn, 30,000 mg Zn, 300 mg I, 300 mg Se, 7,500,000 IU vitamin A, 1200, 000 IU vitamin D, and 40, 000 IU vitamin E.

2.2 Growth performance, slaughter procedures and sample collection

Body weight was recorded on two consecutive days at the start (day 1) and end (day 60) of the trial period before the morning feeding. Daily dry matter intake (DMI) was determined by subtracting orts from the feed provided. Feed conversion ratio (FCR) was calculated as total DMI divided by average daily gain (ADG).

On day 61, after a 12-h fast, five bulls per treatment group were randomly selected, transported to a slaughterhouse located 5 km from the farm, weighed, and humanely slaughtered according to standard halal procedures (11). Carcass weight was recorded immediately, and dressing percentage was calculated as carcass weight divided by live weight. Carcasses were chilled at 4 °C for 24 h before dissection. The loin-eye area was measured between the 12th and 13th ribs with a planimeter. Backfat thickness was determined with a digital caliper, positioned 4 cm from the carcass midline and 4 cm caudal to the last rib (12). Net meat weight was obtained by subtracting bone weight from carcass weight, and net meat percentage was derived as net meat weight divided by live weight.

A sample of approximately 10 g of longissimus thoracis (LT) was excised from the 12th rib region of the left side of the carcass, rapidly frozen in liquid nitrogen, and stored at −80 °C for subsequent fatty acid and gene expression analyses. Additional LT sections (approximately 500 g) spanning the 10th to 13th ribs were collected for meat quality and chemical composition assessment.

2.3 Meat quality

Muscle pH was measured at 45 min and 24 h post-mortem with a calibrated TESTO 205PH portable pH meter (TESTO Instruments, Germany) by inserting the probe at three standardized sites on the LT. To ensure the accuracy of the result, the mean value of three measurements for each sample was recorded at 25 °C. Meat color was evaluated at 24 h post-mortem using a Minolta CR-400 chromameter (Konica Minolta Sensing Inc., Japan), which was calibrated daily against a CR-A44 white reference plate under CLE LAB color space settings with a D65 illuminant, 2°standard observer, and 8 mm aperture (13). Three measurements per sample were averaged after rotating the probe 90°between each reading. For drip loss assessment, approximately 55 g of LT muscle was trimmed into 3.0 cm3 cubes, weighed (W1) at 24 h post-mortem, held in airtight bags at 4 °C for 24 h, and reweighed (W2). Drip loss was calculated as [(W1 − W2)/W1] × 100 (12). Cooking loss was determined by weighing (M1) a 100 g LT sample (6 × 6 × 4 cm), heating it in an 80 °C water bath until the internal temperature reached 70 °C, cooling and drying it, and then reweighing (M2). The mean of three measurements per sample was used to compute cooking loss as [(M1 − M2)/M1] × 100 (14). Shear force was analyzed according to Yu et al. (15) by cutting cooked samples into ten cuboids (1 × 1 × 3 cm) aligned with the muscle fiber and shearing them perpendicularly using a C-LT3B texture analyzer (Tenovo, China) equipped with a Warner-Bratzler blade, a 15 kg load cell, and a crosshead speed of 200 mm/min. The result represented the average of ten replicates.

Proximate composition of the LT muscle, including IMF, moisture, ash, and crude protein, was determined following AOAC (2000) guidelines (16). LT samples were homogenized using a Philips HR2657 grinder (Eindhoven, Netherlands), lyophilized, and pulverized. Lipids were extracted from the powder with petroleum ether using a Soxtec 2055 system (Foss Tecator AB, Höganäs, Sweden) for IMF quantification. Muscle triglyceride (TG) content was quantified using the GPO-PAP enzymatic assay (Nanjing Jiancheng Bioengineering Institute, China).

2.4 Antioxidant status

Antioxidant status was assessed by homogenizing 0.1 g of LT tissue in 0.9% saline (1:9, w/v) at 1,500 rpm for 2 min, centrifuging the homogenate at 3,500×g for 10 min at 4 °C, and analyzing the supernatant for total antioxidant capacity (T-AOC), malondialdehyde (MDA), catalase (CAT), glutathione peroxidase (GSH-Px), and superoxide dismutase (SOD) using commercial kits (Nanjing Jiancheng Bioengineering Institute) and a SpectraMax M5 microplate reader (Molecular Devices, USA).

2.5 Fatty acids profile

Fatty acid profiles were analyzed using a previously described method (17). Each 10 g sample was homogenized with 2 mL of an internal standard solution containing methyl heptadecanoate (1 mg/mL) and butylated hydroxytoluene (2 mg/mL), followed by methylation. After the reaction, fatty acid methyl esters (FAMEs) were extracted using n-hexane, and the upper organic phase was collected. Fatty acid concentrations were quantified via gas chromatography–mass spectrometry (GC2010 Plus GC–MS, Shimadzu Scientific Instruments, USA) based on the peak area of the internal standards. Fatty acid composition was identified by comparing retention times against those of FAME standards (CRM47885, Sigma, Darmstadt, Germany). The temperature program was configured as follows: injector temperature, 230 °C; detector temperature, 230 °C; initial column temperature, 55 °C held for 0.5 min, increased to 205 °C at 35 °C/min and held for 3 min, then raised to 230 °C at 5 °C/min and maintained for 2.5 min; injection volume, 1 μL; split ratio, 60:1; carrier gas, nitrogen at a flow rate of 1 mL/min. Results were expressed as the relative percentage of each fatty acid in the total IMF.

2.6 Quantitative real-time PCR analysis

Quantitative real-time PCR (RT–qPCR) was performed according to established protocols (18). Total RNA was extracted from LT muscle using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and RNA integrity was confirmed by agarose gel electrophoresis. Qualified RNA samples (1 μg) were reverse transcribed into cDNA using a PrimeScript RT Reagent Kit (Takara Biotechnology, Dalian, China). Quantitative PCR amplification was conducted in duplicate on an ABI QuantStudio™ RT–PCR system (Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences for target genes are listed in Table 2, and β-actin was used as the reference gene. The PCR amplification protocol followed established parameters (19). Relative gene expression was determined using the 2−ΔΔCT method.

Table 2

Gene namePrimer sequence (5′–3′)GenBank accession no.Size (bp)
β-actinF: CTCACGGAGCGTGGCTACA
R: GCCATCTCCTGCTCGAGGTC
NM_001009784.3107
FASF: GTGTGGTACAGCCCCTCAAG
R: ACGCACCTGAATGACCACTT
XM_027974304.3110
ACCF: GACACATCACATCCGTCCTCT
R: GTCCATCACCACAGCCTTCAT
XM_060394703.1188
SCD1F: TCCGACCTAAGAGCCGAGAA
R: AGCACAACAACAGGACACCA
NM_173959.473
DGAT1F: GCCCAAGGGTCTGAATGTGT
R: CCTCCTTCCCACAGCATGG
XM_059893129.1120
LPLF: CCCGGCTTTGATATTGGGAAG
R: TCAGGGACTTGTCATGGCATT
NM_001075120.1142
HSLF: AGAGTGCTTCTAGTCCTACTGC
R: GACACGGTGAAGCAGAGGTTC
NM_001080220.1117
CPT1BF: TGTTCAACACCACTCGCATC
R: CTCGTAGAGCCACAGCTTGA
XM_060411597.1116
FABP4F: AGATGGTGCTGGAATGTGTCA
R: GGAGTTCGATGCAAACGTCA
NM_174314.2103
SREBF1F: CGCAAAGCCATCGACTACATC
R: TGAGCTTCTGGTTGCTGTGCT
XM_027974786.252
PPARαF: GGCCCCAGGTGGTGGA
R: CCGGCCACAGACTGTTACTT
NM_001034036.1123
AMPKα2F: ATGAGGTGGTGGAGCAGAGG
R: CGTGAGAGAGCCAGAGAGTGAA
NM_001112816.1131

PCR primers for real-time quantitative PCR assays.

FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; SCD1, stearoyl-CoA desaturase 1; DGAT1, diacylglycerol O-acyltransferase homolog 1; LPL, lipoprotein lipase; HSL, hormone sensitive lipase; CPT1B, carnitine palmitoyltransferase 1B; FABP4, fatty acid binding protein 4; SREBF1, sterol regulatory element binding transcription factor 1; PPARα, peroxisome proliferate-activated receptor α; AMPKα2, protein kinase AMP-activated catalytic subunit α2.

2.7 Calculations and statistical analyses

Data were analyzed using SAS software (SAS Institute Inc., Cary, NC, USA) under a completely randomized experimental design (20). One-way ANOVA was applied to evaluate linear and quadratic responses to probiotic supplementation levels. The model was specified as Yij = μ + Fi + εij, where Yij represents the dependent variable, μ the overall mean, Fi the fixed effect of probiotic supplementation (i = 0, 0.1, 0.2, and 0.3 g probiotics/kg DM), and εij the residual error. Orthogonal polynomial contrasts were utilized to characterize dose–response trends. Post hoc analyses were performed using Duncan’s multiple range test. Each bull was considered an experimental unit. Data are presented as mean ±standard error of the mean (SEM), with statistical significance set as p < 0.05.

3 Results

3.1 Growth performance and carcass traits

As shown in Table 3, dietary probiotic supplementation had no impact on the DMI of bulls (p > 0.05). Initial BW was similar across all treatment groups (p > 0.05). Both final BW and ADG increased linearly (p = 0.001 and 0.001) with probiotic supplementation. ADG was 16.5% greater in the MP group compared to the control (p = 0.003). FCR decreased linearly (p = 0.001) and was 13.9% lower in the MP group than in the control (p = 0.005). As presented in Table 4, dietary probiotic supplementation did not affect carcass traits (p > 0.05).

Table 3

ItemTreatment1SEMp-values
ControlLPMPHPTreatmentLinearQuadratic
DMI (kg/d)12.2012.2212.2912.320.0710.1280.0520.990
Body weight (kg)
0 d563.2561.6562.0564.11.1550.3710.5320.101
60 d628.6b631.4b638.5a640.2a2.1300.0010.0010.767
ADG (kg/d)1.09b1.16ab1.27a1.26a0.3900.0030.0010.286
FCR (kg/kg)11.29a10.61ab9.72b9.80b0.3670.0050.0010.263

Effects of probiotics on growth performance of bulls (n = 40).

1

Control, LP, MP, and HP groups contained, respectively, 0, 0.1, 0.2 and 0.3 g probiotics/kg DM.

Different superscript letters in the same row differed significantly.

Table 4

ItemTreatment1SEMp-values
ControlLPMPHPTreatmentLinearQuadratic
Live weight (kg)616.0616.9619.3618.43.8270.8280.4460.729
Carcass weight (kg)318.7324.5325.8323.87.0690.8240.5240.499
Carcass yield (%)51.7352.6052.6052.361.0760.8640.6180.514
Backfat thickness (mm)14.1614.1914.3414.270.1830.8020.4480.755
Loin eye area (cm2)70.5071.3872.5072.221.2970.6770.2800.650
Net meat weight (kg)288.2293.5294.0288.07.2850.7810.9970.314
Net meat rate (%)46.7947.5647.4746.571.1970.7980.8480.337

Effects of probiotics on carcass traits of bulls (n = 20).

1

Control, LP, MP and HP groups contained, respectively, 0, 0.1, 0.2 and 0.3 g probiotics/kg DM.

Different superscript letters in the same row differed significantly.

3.2 Meat quality

As shown in Table 5, pH did not differ among the treatment groups (p > 0.05). The a* value increased linearly (p = 0.007) with probiotic supplementation and was 3.1% higher in the MP group relative to the control (p = 0.043). Probiotic supplementation did not affect b*, L* values, or drip loss (p > 0.05). Cooking loss decreased linearly (p = 0.022) and was 6.9% lower in the MP group than in the control (p = 0.049). Shear force declined linearly (p = 0.014) and was 6.7% smaller in the MP group than in the control group (p = 0.040).

Table 5

ItemTreatment1SEMp-values
ControlLPMPHPTreatmentLinearQuadratic
pH45min6.466.436.406.410.0620.8380.4490.694
pH24h5.625.595.575.580.0580.8780.5080.661
a*14.34b14.53ab14.79a14.83a0.1570.0430.0070.566
b*9.659.589.599.570.3260.9960.8440.925
L*36.2536.9837.4037.521.2560.7980.3520.758
Drip loss (%)3.833.703.713.690.2370.9430.6270.777
Cooking loss (%)26.12a24.92ab24.31b24.68b0.5330.0490.0220.089
Shear force (N)59.27a56.39b55.32b55.70b1.1070.0400.0140.108
Moisture (%)72.7972.2271.4371.400.5730.2230.0510.614
Crude protein (%)20.5820.9521.1021.120.2400.2460.0680.403
Ash (%)1.121.091.101.100.0550.9710.8540.718
IMF (%)4.05b4.24b4.59a4.31b0.1200.0040.0100.017
TG (mmol/gprot)0.40b0.42b0.48a0.46a0.0130.0010.0010.055

Effects of probiotics on beef quality (n = 20).

1

Control, LP, MP and HP groups contained, respectively, 0, 0.1, 0.2 and 0.3 g probiotics/kg DM.

Different superscript letters in the same row differed significantly.a*, meat redness; b*, meat yellowness; L*, meat lightness.

Moisture, crude protein, and ash contents were similar across groups (p > 0.05). IMF increased quadratically (p = 0.017) and was 13.3% higher in the MP group than in the control group (p = 0.004). TG increased linearly (p = 0.001) and was greater in the MP and HP groups than in the others (p = 0.001).

3.3 Antioxidant status

As shown in Table 6, T-AOC and GSH-Px activity increased linearly (p = 0.005 and 0.012) and were 46.6 and 6.5% higher in the MP group compared to the control (p = 0.023 and 0.049). Probiotic supplementation did not affect MDA or SOD (p > 0.05). CAT activity increased quadratically (p = 0.012) and was 22.5% higher in the MP group than in the control group (p = 0.001).

Table 6

ItemTreatment1SEMp-values
ControlLPMPHPTreatmentLinearQuadratic
T-AOC (U/mgprot)0.30b0.38ab0.44a0.43a0.0390.0230.0050.173
MDA (μmol/gprot)2.442.342.232.200.1110.2760.0620.683
SOD (U/mgprot)43.8444.3444.6044.631.2200.9200.5260.798
GSH-Px (U/mgprot)33.21b34.89ab35.39a35.53a0.8500.0490.0120.214
CAT (U/gprot)6.08c6.58bc7.45a6.83b0.2480.0010.0030.012

Effects of probiotics on antioxidant status of Longissimus thoracis in bulls (n = 20).

1

Control, LP, MP and HP groups contained, respectively, 0, 0.1, 0.2 and 0.3 g probiotics/kg DM.

Different superscript letters in the same row differed significantly.

3.4 Fatty acids

As shown in Table 7, the saturated fatty acids (SFA) content in beef from the MP and HP groups was significantly lower than in the control group (p = 0.001). Increasing the level of probiotics led to a linear reduction in SFA content (p = 0.001). The content of C16:0 was also markedly lower in the MP and HP groups compared to the control (p = 0.034), and decreased linearly with increasing probiotic supplementation (p = 0.008).

Table 7

ItemTreatment1SEMp-values
ControlLPMPHPTreatmentLinearQuadratic
C12:01.161.171.141.150.0420.9070.6710.975
C14:02.412.412.422.420.1660.9990.9300.999
C15:00.260.250.190.210.0280.2040.0810.585
C16:024.62a23.70ab21.86b22.20b0.7830.0340.0080.364
C16:12.782.852.882.900.2310.9700.8500.672
C17:00.980.770.860.980.1370.3890.8340.110
C17:10.760.680.800.780.0580.1940.2860.508
C18:016.8716.4616.2416.190.4870.4840.1510.595
C18:1n9c35.77b36.80ab38.17a37.79a0.6610.0450.0130.230
C18:1n9t1.421.391.341.370.1610.7340.2810.836
C18:23.183.513.773.730.2230.1210.0560.395
C18:3n6c1.291.361.451.380.1630.6840.2410.895
C20:00.100.110.110.100.0170.9850.9990.704
C20:10.280.260.290.300.0390.8190.5770.586
C20:21.171.161.161.170.1600.9840.8060.776
C20:3n6c3.423.493.633.650.1500.3960.1060.798
C20:42.122.082.112.090.0980.9660.8620.645
C22:00.150.120.120.120.0160.4600.2210.380
C22:5n30.38b0.51ab0.58a0.55a0.0620.0480.0170.117
C22:6n30.640.690.690.680.0900.9670.7580.721
C24:00.250.230.190.240.0320.4250.5890.208
ω6PUFA4.724.865.085.130.2240.4330.1150.840
ω3PUFA1.031.201.261.230.1200.2330.0950.224
ω6/ω34.674.194.114.250.4110.7290.4340.429
SFA46.78a45.22ab43.13c43.62bc0.6970.0010.0010.091
UFA53.22c54.78bc56.87a56.38ab0.6970.0010.0010.091
UFA/SFA1.14b1.21b1.32a1.30a0.0360.0010.0010.120
MUFA41.00b41.97ab43.50a42.91a0.6190.0260.0090.171
PUFA12.22b12.81ab13.36a13.47a0.3990.0440.0070.453
PUFA/MUFA0.2980.3060.3060.3160.0120.6240.2220.918

Effects of probiotics on fatty acid profiles of Longissimus thoracis (n = 20) (g/100 g fatty acids).

1

Control, LP, MP and HP groups contained, respectively, 0, 0.1, 0.2 and 0.3 g probiotics/kg DM.

SFA was saturated fatty acid; UFA was unsaturated fatty acid; MUFA was monounsaturated fatty acids; PUFA was polyunsaturated fatty acid. ω3PUFA = C22:5n3 + C22:6n3; ω6PUFA = C18:3n6c + C20:3n6c; ω9PUFA = C18:1n9c + C18:1n9t. Different superscript letters in the same row differed significantly.

The monounsaturated fatty acids (MUFA) content was significantly higher in the MP and HP groups than in the control (p = 0.026), and increased linearly with probiotic level (p = 0.009). In particular, C18:1n9c was elevated in the MP and HP groups relative to the control (p = 0.045), and exhibited a linear upward trend with increasing probiotics (p = 0.013). Similarly, polyunsaturated fatty acids (PUFA) content was higher in the MP and HP groups than in the control (p = 0.044), and increased linearly with probiotic supplementation (p = 0.007). Notably, C22:5n3 was also higher in the MP and HP groups compared to the control (p = 0.048), and rose linearly with probiotic level (p = 0.017). Overall, the UFA/SFA ratio was significantly greater in the MP and HP groups than in the other groups (p = 0.001).

3.5 The expression of lipid metabolism related genes

As shown in Table 8, the relative expression of FAS, ACC, and SREBF1 in the MP group was significantly increased by 76.2, 39.5 and 57.4%, compared to the control (p = 0.010, 0.001, and 0.021, respectively). Among all experimental groups, the MP group showed the highest expression of SCD1 and PPARα, with 1.74-fold and 0.32-fold upregulation relative to the control (p = 0.001 and 0.002). In contrast, CPT1B expression was the lowest in the MP group, showing a 0.29-fold downregulation compared to the control (p = 0.009). Increasing probiotic levels produced a linear upregulation in FAS, ACC, and SREBF1 expression (p = 0.002, 0.001, and 0.010), a quadratic upregulation in SCD1 and PPARα (p = 0.001 and 0.003), and a linear downregulation in CPT1B (p = 0.009).

Table 8

ItemTreatment1SEMp-values
ControlLPMPHPTreatmentLinearQuadratic
FAS1.26b1.68ab2.22a2.10a0.2840.0100.0020.177
ACC1.52b1.72b2.12a2.10a0.1230.0010.0010.303
SCD18.27d11.52c22.71a17.81b1.2690.0010.0010.001
DGAT16.216.596.666.721.1000.9710.6680.847
LPL14.0213.6210.5812.721.6880.3240.2750.368
HSL0.370.360.340.370.0580.9560.8810.640
CPT1B23.06a22.64a16.46b19.23ab1.8900.0090.0090.249
FABP42.702.773.393.540.4620.2180.0510.894
SREBF127.46b37.13ab43.23a39.76a4.6100.0210.0100.062
PPARα9.57c11.25ab12.61a11.06b0.6520.0020.0110.003
AMPKα20.960.920.870.900.0890.7600.4080.582

Effects of probiotics on genes expression related to lipid metabolism in the Longissimus thoracis of bulls (n = 20).

1

Control, LP, MP and HP groups contained, respectively, 0, 0.1, 0.2 and 0.3 g probiotics/kg DM.

FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; SCD1, stearoyl-CoA desaturase 1; DGAT1, diacylglycerol O-acyltransferase homolog 1; LPL, lipoprotein lipase; HSL, hormone sensitive lipase; CPT1B, carnitine palmitoyltransferase 1B; FABP4, fatty acid binding protein 4; SREBF1, sterol regulatory element binding transcription factor 1; PPARα, peroxisome proliferate-activated receptor α; AMPKα2, protein kinase AMP-activated catalytic subunit α2.

Different superscript letters in the same row differed significantly.

4 Discussion

4.1 Growth performance and carcass traits

Dietary supplementation with probiotics did not affect DMI in bulls, a result consistent with the findings of Zhang et al. (21). The observed increase in ADG, however, likely originated from probiotic-induced modulation of the gut microbiota, which enhanced nutrient digestion, absorption, and muscle metabolism. Supporting this mechanism, Jiang et al. (22) found that L. plantarum 299v supplementation increased fecal microbial diversity in preweaning calves, suggesting a pathway for improved growth performance. Further evidence indicated that the rumen microbiota supported bull growth by optimizing nutrient digestion, while lactic acid bacteria species improve intestinal nutrient absorption through villus elongation and functional maturation (19, 23). Additionally, emerging research highlighted the role of gut microbiota in regulating muscle metabolism via the gut-muscle axis (24). Short-chain fatty acids (SCFAs) modulate glucose metabolism by binding to free fatty acid receptor (FFAR1)/FFAR4 and stimulating glucagon-like peptide-1 (GLP-1), which regulates insulin and glucagon secretion. Gut microbes also convert primary to secondary bile acids, activating G protein coupled receptor for bile acids (TGR5) to maintain energy homeostasis. Meanwhile, intestinal genes including fasting induced adipose factor and PPARs regulate lipid metabolism by mediating fatty acid uptake and mitochondrial β-oxidation. Microbiota modulation improves systemic physiology, thereby indirectly supporting muscle development (25). For instance, supplementing bulls with Limosilactobacillus mucosae CRL2069 throughout a 104-day fattening cycle significantly improved growth performance (5). In contrast, carcass traits remained unaffected by probiotic supplementation, aligning with observations by Hernández-García et al. (26), who reported no significant effect of probiotics on carcass yield in goats. The reasons may be relation to limited trial duration and age factor. These findings collectively demonstrate that probiotics improve growth performance without modifying carcass characteristics.

4.2 Meat quality

Meat pH values were unaffected by probiotic supplementation and remained within the acceptable range of 5.5–5.9, confirming that treatment did not compromise meat quality. Similarly, meat color measurements, including lightness (L* = 30–45), redness (a* = 10–25), and yellowness (b* = 5–15), fell within consumer-accepted thresholds. Notably, dietary probiotic supplementation significantly increased the a* value of the LT muscle in bulls, indicating improved redness without affecting other color parameters. This enhancement in muscle redness may be attributed to the antioxidant properties of lactic acid bacteria. Meat color is primarily determined by the redox state of myoglobin: oxygen-bound oxymyoglobin (OxyMb) imparts a bright red color, whereas oxidation to metmyoglobin (MetMb) causes undesirable browning (27). Lactic acid bacteria likely reduces myoglobin oxidation through several mechanisms, including free radical scavenging, metal ion chelation, and upregulation of endogenous antioxidant enzymes (28). By inhibiting MetMb formation and promoting OxyMb stability, probiotic supplementation helped to preserve meat redness, an effect also reported in lactic acid bacteria-treated Sunit lamb (29). Water-holding capacity, reflected by drip loss and cooking loss, is largely influenced by muscle protein integrity and IMF content. Higher IMF levels correlated negatively with cooking loss, suggesting that lipid deposits help to preserve muscle structure (30). Shear force values remained below 60 N in all samples, meeting standards for fresh meat. Tenderness is influenced by factors such as pH, collagen cross-linking, fiber type distribution, and IMF content, with IMF contributing to tenderness by disrupting perimysial collagen networks (31). In this study, both shear force and cooking loss decreased following probiotic supplementation, likely due to changes in IMF deposition. Recent studies have shown that probiotic supplementation significantly reduced cooking loss and shear force in Sunit lamb (32).

Dietary supplementation with probiotics significantly increased IMF content in beef, likely by stimulating adipocyte activity and promoting fat deposition within skeletal muscle (33). This effect aligned with findings in Sunit lambs, where long-term supplementation with L. casei HM-09 and L. plantarum HM-10 also accelerated IMF accumulation (34). Probiotic supplementation also raised TG concentrations, further indicating enhanced lipid deposition. In ruminants, lactic acid bacteria species boost the production of short-chain fatty acids and facilitate fatty acid absorption into muscle via blood circulation (9). These findings suggest that probiotics modify carcass fat distribution by altering lipid metabolism. However, IMF and TG content did not increase further in the HP group, as excessive probiotic intake can disrupt the intestinal mucosal environment, lower intestinal pH, and impair digestive function, ultimately hindering lipid absorption (9).

4.3 Antioxidant status

Improvements in meat quality traits, including redness (a* value), and water-holding capacity, coincided with elevated T-AOC, GSH-Px, and CAT. Lipids and oxygen interact through free-radical chain reactions to form peroxides, but the antioxidant system mitigates oxidative damage by scavenging free radicals and decelerating oxidation (35). Probiotics such as lactic acid bacteria serve as natural antioxidants against reactive oxygen species via enzymatic and nonenzymatic mechanisms (36–38). Tang et al. (39) demonstrated the in vitro antioxidant potential of L. plantarum, and in vivo studies showed that probiotics raise T-AOC, SOD, and GSH-Px levels while reducing MDA content in mice (40). Notably, the dose–response behavior of IMF and TG to probiotics mirrored that of CAT activity. These findings lead us to conclude that moderate supplementation strengthens CAT-mediated protection of IMF, whereas excessive intake disrupts lipid homeostasis and promotes oxidative stress.

4.4 Fatty acids

Fatty acids constitute the primary component of IMF in beef and are key indicators of nutritional quality. SFA, particularly C16:0 and C18:0, which comprise roughly 40% of total fatty acids in beef, are linked to elevated risks of chronic diseases in humans. In contrast, UFA help to prevent the occurrence of cardiovascular diseases (41). Probiotic supplementation reduced the proportion of C16:0 and increased levels of C18:1n9c and C22:5n3 in beef, indicating that probiotics modulate fatty acid profiles to improve both tenderness and health benefits. Metabolites from lactic acid bacteria may inhibit ruminal biohydrogenation of dietary UFA, promoting their direct incorporation into muscle tissue (42). Probiotics can also upregulate SCD1 activity, thereby promoting the conversion of SFA to UFA (43). A recent study confirmed that probiotic supplementation increased MUFA content and the MUFA/SFA ratio in lamb meat (44).

4.5 The expression of lipid metabolism related genes

Probiotic supplementation upregulated lipogenic genes (FAS, ACC, SREBF1) and downregulated CPT1B expression, correlating with increased IMF and TG deposition. Probiotics modulate the gut microbiota, which in turn regulates lipid metabolism-related genes and subsequently influences fat content in skeletal muscle (7). In contrast, the absence of gut microbiota enhances fatty acid catabolism through elevated CPT1 activity. Therefore, appropriate supplementation with probiotics generally promotes IMF deposition. Lactic acid bacteria enhanced cellular lipid storage by upregulating ACC and downregulating CPT1B (45). By inhibiting AMPKα2 signaling, probiotics promoted expression of downstream targets SREBF1, FASN, and ACC, suppress CPT1B expression, and ultimately increase IMF deposition in the Sunit lambs (9). These results indicated that probiotics maintained IMF content by elevating lipogenesis and reducing lipolysis.

Furthermore, probiotics elevated SCD1 and PPARα mRNA levels, which coincided with increased UFA content in beef. PPARα activation stimulated fatty acid biosynthetic pathways. The desaturase SCD1 significantly influenced fatty acid metabolism by controlling de novo MUFA synthesis in muscle (43). Probiotics also regulated fatty acid metabolism in pig muscle by inducing SCD1 expression through PPARα-mediated signaling (8).

5 Conclusion

Dietary probiotic supplementation (0.2 g/kg DM) improved growth performance without affecting carcass traits. Notably, it enhanced beef redness and antioxidant capacity while reducing cooking loss and shear force. Probiotics also increased IMF content by upregulating lipogenic genes and suppressing lipolytic genes. Moreover, the observed shift in UFA profile could potentially involve probiotic-induced activation of the PPARα/SCD1 pathway. These findings support the use of probiotics as a sustainable strategy for quality beef production. Future studies should focus on evaluating long-term efficacy across different cattle breeds and production systems to facilitate broader application.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary material, further inquiries can be directed to the corresponding author.

Ethics statement

The animal studies were approved by the Animal Care and Use Committee of Lyuliang University. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.

Author contributions

YL: Conceptualization, Writing – review & editing, Writing – original draft. GW: Writing – review & editing, Resources. RW: Writing – review & editing, Data curation. YH: Supervision, Investigation, Validation, Writing – review & editing. XZ: Writing – review & editing, Data curation, Validation. CF: Resources, Project administration, Writing – review & editing.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This work was supported by the PhD Research Initial Fund of Lyuliang University in Shanxi (03012090083) and Key Laboratory for Healthy Breeding and Deep Processing of Characteristic Livestock and Poultry Products in Lvliang City (2025SYS05).

Acknowledgments

The authors wish to thank the staff of the Hong Kang Mu Ye Farm (Fangshan, China) for assistance in feeding and care of the animals.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that Generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fvets.2025.1690922/full#supplementary-material

References

  • 1.

    ColomboEACookeRFBrandaoAPWiegandJBSchubachKMSowersGCet al. Performance, health, and physiological responses of newly received feedlot cattle supplemented with pre- and probiotic ingredients. Animal. (2021) 15:100214. doi: 10.1016/j.animal.2021.100214

  • 2.

    HassanFULiuCMehboobMBilalRMArainMASiddiqueFet al. Potential of dietary hemp and cannabinoids to modulate immune response to enhance health and performance in animals: opportunities and challenges. Front Immunol. (2023) 14:1285052. doi: 10.3389/fimmu.2023.1285052

  • 3.

    LiuSMYangYYLuoHLPangWJMartinGB. Fat deposition and partitioning for meat production in cattle and sheep. Anim. Nutr. (2024) 17:376–86. doi: 10.1016/j.aninu.2024.03.003

  • 4.

    MurariuOCMurariuFFrunzaGCiobanuMMBoisteanuPC. Fatty acid indices and the nutritional properties of karakul sheep meat. Nutrients. (2023) 15:1061. doi: 10.3390/nu15041061

  • 5.

    MansillaFIMirandaMHUezenJDMaldonadoNCVillarMADMerinoLAet al. Effect of probiotic lactobacilli supplementation on growth parameters, blood profile, productive performance, and fecal microbiology in feedlot cattle. Res Vet Sci. (2023) 155:76–87. doi: 10.1016/j.rvsc.2023.01.003

  • 6.

    NallaKMandaNKDhillonHSKanadeSRRokanaNHessMet al. Impact of probiotics on dairy production efficiency. Front Microbial. (2022) 13:805963. doi: 10.3389/fmicb.2022.805963

  • 7.

    HeYWHuHLiangXQLiangJLiFNZhouXH. Gut microbes-muscle axis in muscle function and meat quality. Sci China Life Sci. (2025) 4:1–14. doi: 10.1007/s11427-024-2885-4

  • 8.

    TianZMCuiYYLuHJWangGMaXY. Effect of long-term dietary probiotic lactobacillus reuteri 1 or antibiotics on meat quality, muscular amino acids and fatty acids in pigs. Meat Sci. (2021) 171:108234. doi: 10.1016/j.meatsci.2020.108234

  • 9.

    ZhangYZhangMSuLZhaoLHSunLNJinYet al. Effect of different levels of lactobacillus added to diets on fat deposition and meat quality of Sunit lambs. Meat Sci. (2024) 213:109470. doi: 10.1016/j.meatsci.2024.109470

  • 10.

    National Academies of Sciences, Engineering, and Medicine of the United States. Nutrient requirements of beef cattle. 8th rev. ed. Washington, DC, USA: National Academies Press (2016).

  • 11.

    AbdullahFAABorilovaGSteinhauserovaI. Halal criteria versus conventional slaughter technology. Animals. (2019) 9:530. doi: 10.3390/ani9080530

  • 12.

    CañequeVPérezCVelascoSDiazMTLauzuricaSAlvarezIet al. Carcass and meat quality of light lambs using principal component analysis. Meat Sci. (2004) 67:595–605. doi: 10.1016/j.meatsci.2004.01.002

  • 13.

    BiffinTESmithMABushRDMorrisSHopkinsDL. The effect of whole carcase medium voltage electrical stimulation, tenderstretching and longissimus infusion with actinidin on alpaca meat quality. Meat Sci. (2020) 164:108107. doi: 10.1016/j.meatsci.2020.108107

  • 14.

    HonikelKO. Reference methods for the assessment of physical characteristics of meat. Meat Sci. (1998) 49:447–57. doi: 10.1016/S0309-1740(98)00034-5

  • 15.

    YuMLiZRongTWangGLiuZChenWet al. Different dietary starch sources alter the carcass traits, meat quality, and the profile of muscle amino acid and fatty acid in finishing pigs. J Anim Sci Biotechno. (2020) 11:78. doi: 10.1186/s40104-020-00484-9

  • 16.

    AOAC. Official methods of analysis. 17th ed. Gaithersburg, MD, Washington: Association of Official Analytical Chemists (2000).

  • 17.

    CuiYTianZYuMLiuZRongTMaX. Effect of guanidine acetic acid on meat quality, muscle amino acids, and fatty acids in Tibetan pigs. Front Vet Sci. (2022) 9:998956. doi: 10.3389/fvets.2022.998956

  • 18.

    YuMLiZChenWRongTWangGLiJet al. Use of hermetia illucens larvae as a dietary protein source: effects on growth performance, carcass traits, and meat quality in finishing pigs. Meat Sci. (2019) 158:107837. doi: 10.1016/j.meatsci.2019.05.008

  • 19.

    LiuYQWangCLiuCZhangJLiuQ. Effects of coated folic acid and coated methionine on growth performance, nutrient digestibility and rumen fermentation in Simmental bulls. Anim Feed Sci Tech. (2023) 298:115596. doi: 10.1016/j.anifeedsci.2023.115596

  • 20.

    SAS/STAT®9.0 user’s guide. Cary, NC, USA: SAS Institute Inc. (2002).

  • 21.

    ZhangJPLiRYLiSJLiJGShenYZLiQFet al. Effects of dietary fermented jujube powder on growth performance, immune performance and antioxidant performance of Holstein bulls during hot season. Chin J Anim Nutr. (2022) 34:1027–39. doi: 10.3969/j.issn.1006-267x.2022.02.034

  • 22.

    JiangXXuHJCuiZQZhangYG. Effects of supplementation with lactobacillus plantarum 299v on the performance, blood metabolites, rumen fermentation and bacterial communities of preweaning calves. Livest Sci. (2020) 239:104120. doi: 10.1016/j.livsci.2020.104120

  • 23.

    Ayala-MonterMAHernández-SánchezDGonzález-MuozSPinto-RuizRMartínez-AispuroJATorres-SaladoNet al. Growth performance and health of nursing lambs supplemented with inulin and lactobacillus casei. Asian Australas J Anim Sci. (2019) 32:1137–44. doi: 10.5713/ajas.18.0630

  • 24.

    LahiriSKimHGarcia-PerezIRezaMMPetterssonS. The gut microbiota influences skeletal muscle mass and function in mice. Sci Transl Med. (2019) 11:5662. doi: 10.1126/scitranslmed.aan5662

  • 25.

    SuMTangTTangWLongYWangLLiuM. Astragalus improves intestinal barrier function and immunity by acting on intestinal microbiota to treat T2DM: a research review. Front Immunol. (2023) 14:1243834. doi: 10.3389/fimmu.2023.1243834

  • 26.

    Hernández-GarcíaPALara-BuenoAMendoza-MartínezGDBárcena-GamaJRPlata-PérezFXLópez-OrdazRet al. Effects of feeding yeast (saccharomyces cerevisiae), organic selenium and chromium mixed on growth performance and carcass traits of hair lambs. Integr Agric. (2015) 14:575–82. doi: 10.1016/S2095-3119(14)60833-9

  • 27.

    ManciniRHuntM. Current research in meat color. Meat Sci. (2005) 71:100–21. doi: 10.1016/j.meatsci.2005.03.003

  • 28.

    LiuCHouYSuRLuoYDouLYangZet al. Effect of dietary probiotics supplementation on meat quality, volatile flavor compounds, muscle fiber characteristics, and antioxidant capacity in lambs. Food Sci Nutr. (2022) 10:2646–58. doi: 10.1002/fsn3.2869

  • 29.

    DuRJinYWangBH. Dietary probiotics affect gastrointestinal microflora and metabolites and consequently improves meat quality in sunit lambs. Food Sci. (2020) 41:14–21. doi: 10.7506/spkx1002-6630-20190714-181

  • 30.

    TichenorDA. Effects of rate of gain, slaughter weight and castration on selected chemical, histological and organoleptic characteristics of ovine muscle and adipose tissue. (eurekamag.com) Diss Abstr (1970) 30:3442–3443. Available online at: https://api.semanticscholar.org/CorpusID:82178416 (Accessed August 1, 2025).

  • 31.

    WangXLiGP. Meat quality traits of cattle and it influence factors. Chin J Anim Nutr. (2019) 31:4949–58.

  • 32.

    LiuTBaiYWangCZhangTSuRWangBet al. Effects of probiotics supplementation on the intestinal metabolites, muscle fiber properties, and meat quality of sunit lamb. Animals. (2023) 13:762. doi: 10.3390/ani13040762

  • 33.

    SahaSFukuyamaKDebnathMNamaiFNishiyamaKKitazawaH. Recent advances in the use of probiotics to improve meat quality of small ruminants: a review. Microorganisms. (2023) 11:1652. doi: 10.3390/microorganisms11071652

  • 34.

    ZhangYYaoDHuangHZhangMSunLSuLet al. Probiotics increase intramuscular fat and improve the composition of fatty acids in sunit sheep through the adenosine 5′-monophosphate-activated protein kinase (AMPK) signaling pathway. Food Sci Anim Resour. (2023) 43:805–25. doi: 10.5851/kosfa.2023.e37

  • 35.

    ChanKMDeckerEAFeustmanC. Endogenous skeletal muscle antioxidants. Crit Rev Food Sci. Nutr. (1994) 34:403–26. doi: 10.1080/10408399409527669

  • 36.

    DowarahRVermaAKAgarwalNSinghP. Efficacy of species-specific probiotic pediococcus acidilactici FT28 on blood biochemical profile, carcass traits and physicochemical properties of meat in fattening pigs. Res Vet Sci. (2017) 117:60–4. doi: 10.1016/j.rvsc.2017.11.011

  • 37.

    LiuSWangKLinSZhangZChengMHuSet al. Comparison of the effects between tannins extracted from different natural plants on growth performance, antioxidant capacity, immunity, and intestinal flora of broiler chickens. Antioxidants. (2023) 12:441. doi: 10.3390/antiox12020441

  • 38.

    ChenJChenFPengSOuYHeBLiYet al. Effects of artemisia argyi powder on egg quality, antioxidant capacity, and intestinal development of roman laying hens. Front Physiol. (2022) 13:902568. doi: 10.3389/fphys.2022.902568

  • 39.

    TangWLiCHeZPanFPanSWangY. Probiotic properties and cellular antioxidant activity of lactobacillus plantarum ma2 isolated from Tibetan kefir grains. Probiotics Antimicro. (2018) 10:523–33. doi: 10.1007/s12602-017-9349-8

  • 40.

    LiAWangYLiZQamarHMehmoodKZhangLHet al. Probiotics isolated from yaks improves the growth performance, antioxidant activity, and cytokines related to immunity and inflammation in mice. Microb Cell Factories. (2019) 18:112. doi: 10.1186/s12934-019-1161-6

  • 41.

    SchwingshacklLHesekerHKiesswetterEKoletzkoB. Reprint of: dietary fat and fatty foods in the prevention of non-communicable diseases: a review of the evidence. Trends Food Sci Tech. (2022) 45:893–905. doi: 10.1016/j.tifs.2022.10.011

  • 42.

    TaboadaNSalomMFCordobaAGonzálezSNAlzogaraySLVan-NieuwenhoveC. Administration of selected probiotic mixture improves body weight gain and meat fatty acid composition of creole goats. Food Biosci. (2022) 49:101836. doi: 10.1016/j.fbio.2022.101836

  • 43.

    AminABMaoS. Influence of yeast on rumen fermentation, growth performance and quality of products in ruminants: a review. Anim Nutr. (2021) 7:31–41. doi: 10.1016/j.aninu.2020.10.005

  • 44.

    TomaszDJanMRomanWDawidTGrzegorzZTulegenKet al. The effect of probiotic supplementation in kamieniec lambs on meat quality. Small Rumin Res. (2025) 244:107444. doi: 10.1016/j.smallrumres.2025.107444

  • 45.

    NguyenHTGuMWerlingerPChoJChengJSuhJ. Lactobacillus sakei MJM60958 as a potential probiotic alleviated non-alcoholic fatty liver disease in mice fed a high-fat diet by modulating lipid metabolism, inflammation, and gut microbiota. Int J Mol Sci. (2022) 23:13436. doi: 10.3390/ijms232113436

Summary

Keywords

lactobacillus, growth, meat quality, intramuscular fat, bulls

Citation

Liu Y, Wang G, Wang R, He Y, Zhang X and Feng C (2026) Effects of probiotic supplementation on growth and meat quality of Simmental bulls. Front. Vet. Sci. 12:1690922. doi: 10.3389/fvets.2025.1690922

Received

22 August 2025

Revised

05 November 2025

Accepted

14 November 2025

Published

12 February 2026

Volume

12 - 2025

Edited by

Matteo Dell'Anno, University of Messina, Italy

Reviewed by

Shahid Ali Rajput, Muhammad Nawaz Shareef University of Agriculture, Pakistan

Gang Yao, Xinjiang Agricultural University, China

Updates

Copyright

*Correspondence: Caiping Feng,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics