ORIGINAL RESEARCH article

Front. Cardiovasc. Med., 19 February 2026

Sec. Cardiovascular Genetics and Systems Medicine

Volume 13 - 2026 | https://doi.org/10.3389/fcvm.2026.1726536

Characterization of the R893C NaV1.5 mutation in Brugada syndrome

  • 1. Department of Biophysics and Cell Biology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary

  • 2. Division of Cardiology, Department of Cardiology, Faculty of Medicine, University of Debrecen, Debrecen, Hungary

  • 3. Doctoral School of Molecular Medicine, Debrecen, Hungary

  • 4. Institute of Physiology II, University of Münster, Münster, Germany

  • 5. Department of Human Genetics, Faculty of Medicine, University of Debrecen, Debrecen, Hungary

Article metrics

View details

298

Views

60

Downloads

Abstract

Brugada syndrome (BrS) is a genetically determined cardiac arrhythmogenic syndrome with increased risk of sudden cardiac death. BrS is mostly caused by mutations in SCN5A gene encoding the primary ɑ-subunit of the cardiac sodium channel NaV1.5. We aimed at characterizing the functional alterations caused by the R893C mutation, identified in a proband diagnosed with BrS, and establishing whether the mutation is associated with BrS. Although several mutations have been reported in the close vicinity of R893, the functional role of this region remains unknown and, in addition, exploring SCN5A mutations in patients with inherited arrhythmogenic syndromes is critical for understanding the pathogenesis of arrhythmias. The mutations were introduced by site-directed mutagenesis. The variants were transiently expressed in CHO cells and potassium currents were measured using the whole-cell patch clamp technique. Patch clamp recordings have demonstrated that R893C almost completely abolished the sodium current, INa, though the mutation did not exert dominant-negative effect on wild-type NaV1.5 channels. We also observed significant decrease in channel activation and a depolarized shift of steady–state inactivation curve, however, the kinetics of inactivation and recovery from fast inactivation were not changed by the mutation. Moreover, the reducing agent Dithiotreitol partially restored the normal function of NaV1.5 in the R893C mutant highlighting a likely mechanism for loss of conduction via formation of disulphide bridges. We showed that R893H channels also failed to produce any detectable INa that confirms the importance of the highly conserved R893 in gating. Our study reveals R893C is a loss-of-function mutation with altered electrophysiological characteristics of NaV1.5. Thus, R893C may contribute to the BrS phenotype of the proband. Our findings may facilitate the understanding of the mechanisms of arrhythmogenesis in BrS, as it helps to identify mutational hotspots in BrS. Moreover, our work may improve novel gene therapy and new therapeutic drug design targeting NaV1.5 channelopathies.

1 Introduction

NaV1.5 plays a key role in the generation of action potential in cardiomyocytes; therefore, its normal function is essential for a normal heart rhythm. Consequently, alterations of the sodium current (INa), conducted by NaV1.5 in the human heart, may lead to diseases responsible for cardiac arrhythmias, such as the Brugada Syndrome (BrS), which is a potentially lethal, heritable arrhythmia syndrome. BrS, first described in 1992, is characterized by an ST segment elevation in the right precordial leads of the 12-lead electrocardiogram (ECG) and an increased risk for sudden cardiac death (SCD) due to ventricular fibrillation (VF), without major structural alterations in the heart (1, 2). The prevalence of BrS is in the range of 1–5 in every 10,000 individuals, and approximately 4% of all SCD cases and 20% of all unexplained sudden deaths with structurally normal heart are related to BrS (3). More than ten different genes have been associated with BrS (3, 4), but the most demonstrated one is SCN5A, a gene encoding the α subunit of NaV1.5. Approximately 10%–30% of subjects with BrS carry an SCN5A gene mutation with autosomal dominant inheritance (1, 5). The α subunit of the NaV1.5 protein is composed of 2016 amino acids and consists of four homologous domains (designated as DI-DIV) forming a pseudo tetrameric structure. Each domain contains six transmembrane helical segments (S1–S6) linked by intra- and extracellular loops. Of these, segments S1−S4 from each domain form the voltage sensor domain (VSD) that regulates channel opening upon depolarization. Segments S5, S6, and the connecting extracellular pore-loops (P-loops) of domains DI to DIV form the channel pore and the selectivity filter (SF). To date, more than 300 SCN5A mutations affecting different structural parts of NaV1.5 have been identified in BrS patients, most of them are loss-of-function (LOF) mutations resulting in either reduced channel expression in the plasma membrane, current density, or alterations in gating kinetics of NaV1.5, such as the voltage dependence of activation or inactivation (68). To identify and characterize novel NaV1.5 mutations in patients with BrS is critical for a better understanding of the arrhythmogenesis including the structural-functional relationship of the Nav1.5 during gating transitions, which may promote the invention of new and more efficacious drug therapy for NaV1.5 channelopathies. Further, the exploration of the relationship between a specific mutation and the clinical presentation may provide practical and helpful information for risk stratification in a disease with strikingly variable clinical course and prognosis (912).

Herein, we report a study that characterizes a missense R893C mutation in Nav1.5. Position 893 is in the highly conserved pore region (S5-S6) in domain II of NaV1.5 (Figure 1). The mutation was associated with the clinical phenotype of BrS in a patient diagnosed previously by the Cardiology department at our university (13). The proband is a 41-year-old man referred for urgent coronary intervention because of a recent onset sharp chest pain. The clinical course of the patient has been described in detail (13), herein, we summarize the most relevant features. The chest pain was considered atypical for acute coronary syndrome, and the levels of electrolytes and cardiac biomarkers were repeatedly within the normal range. The 12-lead trans telephonic electrocardiogram (TTECG) sent by the emergency team from the patient's home demonstrated coved ST-segment elevation >2 mm, followed by negative T waves in leads V1-V2, corresponding to Brugada type I ECG pattern (Supplementary Figure S1A). These abnormalities, however, were resolved spontaneously and a normal ECG was recorded upon arrival at the hospital (Supplementary Figure S1B). Transthoracic echocardiography demonstrated normal left ventricular function with no wall motion abnormality. Aorta dissection and pulmonary embolism were excluded by cardiac CT angiography. Further diagnostic workup focused on BrS. Polymorphic ventricular tachycardias were induced with both programmed ventricular stimulation and with the administration of 400 mg intravenous procainamide (Supplementary Figure S2). In both instances, the arrhythmia terminated spontaneously within one minute and the patient remained responsive during the episodes. The patient's history also showed multiple episodes of loss of consciousness with seizure since the age of 16, which was attributed to epilepsy, although the results of repeated electroencephalographic (EEG) exams were normal. Antiepileptic therapy with different medications failed to prevent the convulsive attacks which occurred during the night usually 5 to 10 times annually, throughout the past 25 years. As the diagnosis of Brugada syndrome was established, a dual-chamber implantable cardioverter-defibrillator (ICD) was implanted. At this point, we considered the possibility that the nighttime seizure attacks, or at least some of them could have been the consequence of VTs with spontaneous termination related to BrS. However, several seizure spells occurred during a more than 10-year follow up after the ICD implantation, and the ECG recovered from device memory showed normal sinus rhythm or sinus tachycardia during all these episodes. Moreover, repeated EEG monitoring with 24-hour sleep deprivation eventually provided diagnostic findings: the electrical signals recorded during a habitual seizure together with the clinical presentation were suggestive of the autosomal dominant nocturnal frontal lobe epilepsy.

Figure 1

Based on the decrease in the current density of cells expressing the R893C mutant and reported by (12, 14), the mutation was classified as pathogenic. However, the detailed biophysical analysis of the gating parameters of the NaV current of the R893C mutant were not revealed in the previous reports, and the potential of its dominant-negative effect was not elucidated either. The analysis of the R893C mutation presented here extends our knowledge from its clinical manifestations to detailed biophysical characterization and modelling.

2 Methods

2.1 Ethics statement

This study was approved by the local Ethics Committee of the University of Debrecen (Debrecen, Hungary) and conforms with the principles outlined in the Declaration of Helsinki. Blood samples were obtained after participants signed a written informed consent. The collection and patients' involvement in the study were recruited between 01/04/2018 and 01/04/2019.

2.2 Genetic analysis

Genetical analysis was performed via whole genome sequencing, which was performed by Novogene (Cambridge, UK). Data analysis was done using GATK pipeline. The detected possible causative variant (SCN5A R893C) was confirmed using Sanger sequencing by the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's protocol. Primer sequences were: 5'-tcccctcctcttcctccttc-3' and 5'-gatggatggacggatgggta-3'.

2.3 Site-directed mutagenesis

Wild-type (WT) human SCN5A (Uniprot reference: Q14524-1) was subcloned and GFP-tagged (at N-terminal) into pcDNA3.1/Zeo(+) vector previously (kindly provided by H. Abriel, University of Bern, Switzerland). Both R893C- and R893H-Nav1.5 mutations were created by site-directed mutagenesis using overlap extension PCR. R893C mutation was carried out by UD-GenoMed Kft. (Debrecen, Hungary), the mutant clone was confirmed by direct sequencing. R893H mutation was performed using the following primers (mutation underlined):

NaV1.5_Flank F 5' GTGAATTCGAGGAGATGCTGCAG 3'

NaV1.5_Flank R 5' CAGGTACCCGGCCCC 3'

NaV1.5_Mut F 5‘ CATCATCTTCCACATCCTCTGTG 3’

NaV1.5_Mut R 5' CACAGAGGATGTGGAAGATGATG 3'

The mutant DNA fragment was substituted in the WT-Nav1.5GFP coding plasmid using EcoRI and KpnI restriction enzymes. The mutant clone was directly sequenced to verify the presence of the desired mutation and the absence of additional variations.

2.4 Cell culture and transfection

Chinese hamster ovary (CHO) and human embryonic kidney (HEK) cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, Cat# 11965084)) containing 10% fetal bovine serum (FBS, Sigma-Aldrich), 2 mM L-glutamine and 100 µg/mL streptomycin and 100 U/mL penicillin-g (Sigma-Aldrich) at 37 °C in 5% CO2% and 95% air humidified atmosphere and were passaged twice per week following a 2–3 min incubation in trypsin-EDTA (Invitro-gen). Cells were transiently transfected with 1 µg of the plasmid containing either the wild type human NaV1.5 ion channel gene tagged with a GFP at the N-terminus (WT-NaV1.5GFP), or the same construct containing R893C mutation (R893C-NaV1.5GFP) or with the human wild type NaV1.5 lacking the GFP tag (WT-NaV1.5, a kind gift from F. Bosmans, Ghent University, Gent, Belgium), using Lipofectamine 2,000 kit (Invitrogen, Carlsbad, CA), as described by the manufacturer's protocol. Transfected cells were trypsinized with trypsin-EDTA allowing the effective re-suspension of the cell cultures, washed twice with 2 mL of ECS (see below), and seeded onto 35-mm polystyrene cell culture dishes (Cellstar, Greiner Bio-One) to a density that enabled single cells to be identified. GFP-positive transfectants were identified with a Nikon Eclipse TS100 fluorescence microscope (Nikon, Tokyo, Japan) using bandpass filters of 455–495 nm and 515–555 nm for excitation and emission, respectively, and were used for current recordings (>70% success rate for co-transfection). Ionic currents were typically recorded 24 to 36 h after transfection.

2.5 Confocal microscopy

CHO cells were plated one day before the transfection on 8-well chambered coverslips (7,000/well, ibidi GmbH, Gräfelfing, Germany). 0.4 µL FuGene HD (Promega, Madison, WI) was mixed with 120 or 140 ng DNA (per well) in serum- and phenol red-free Opti-MEM (Thermo Fisher Scientific, Waltham, MA) and added to the cells. The cells were labeµLled with Alexa Fluor ™ 647 NHS (succinimidyl) ester dissolved in 1 × TBS (Tris-buffered saline; 25 mM Tris–HCl, 150 mM NaCl, pH = 7.5) for 20 min on ice before the measurements. Confocal microscopic measurements were carried out at room temperature 48 h after labelling. Confocal images were taken using an A1 confocal microscope (Nikon, Tokyo, Japan). Based on the fluorescent intensity of the GFP and Alexa Fluor™ 647 NHS Ester signals, the overlapping part of the signals was determined by using the Intensity Plot Profile tool of the ImageJ software. The intensity values were normalized to the maximum intensity.

2.6 Detection of GFP-tagged ion channels protein in the membrane fraction

Cells were transiently transfected with WT-NaV1.5GFP or R893C-NaV1.5GFP encoding gene, and 48 h later the membrane proteins were extracted from the cells using Subcellular Protein Fractionation Kit for Cultured Cells (ThermoScientific, 78840) according to manufacturer's protocol. Proteins from the membrane fraction were separated using 6% SDS–polyacrylamide gel. NaV1.5 channel proteins together with the GFP were detected using Alpha Innotech gel documentation system. The protein extraction was confirmed using Coomassie blue staining.

2.7 Cellular electrophysiology

Whole-cell Na+ (INa) currents were recorded by patch-clamp recordings with patch pipettes pulled from GC150F-7.5 borosilicate capillaries (Harvard Apparatus Co., Holliston, MA) with tip diameters between 0.5 and 1 μm and heat polished to a tip resistance ranging typically 2–8 MΩ. The micropipettes were pulled in four stages by using a Flaming Brown automatic pipette puller (Sutter Instruments, San Rafael, CA). INa recordings were carried out using an Axopatch 200B amplifier (Axon Instruments, Foster City, CA, USA), connected to personal computers using Digidata 1550A data acquisition hardware (Molecular Devices Inc., Sunnyvale, CA). In general, the holding potential was −120 mV and series resistance errors were reduced by approximately 70%–80% with electronic compensation. The cutoff threshold for acceptable series resistance values was 15 MOhm. Records were discarded when leak at the holding potential was more than 10% of the peak current at the given test potential. Online leak correction was used with P/4 leak subtraction. The sampling frequency was set accordingly to the desired voltage protocol (see below). The liquid junction potential (LJP) between ECS and ICS solutions (see below) was estimated as −8.9 mV using the built-in function of pClamp and was also experimentally measured according to Neher (15). The measured LJP was −9.1 ± 0.1 mV (n = 4). The Vm values reported in the manuscript are values without LJP correction. Thus, the real membrane potential is the reported Vm−∼9 mV. We have used the same extra- and intracellular solutions for the biophysical characterization of all constructs, therefore, the same LJP applies to all records. Experiments were performed at room temperature ranging between 20 and 24 °C. Data were analyzed using the pClamp10 software package (Molecular Devices Inc., Sunnyvale, CA) and GraphPad Prism 8 (GraphPad, CA). Before analysis, current traces were digitally filtered with a three-point boxcar smoothing filter.

2.8 Solutions

For INa recordings the extracellular (bath) solution (ECS) contained 145 mM NaCl, 5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, 10 mM [4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid] (HEPES), and 5.5 mM glucose (pH = 7.35 titrated with NaOH). To avoid the recordings of endogenous K+ currents a Cs + -based intracellular (pipette) solution (ICS) was used, thus, the ICS consisted of (in mM) 10 NaCl, 105 CsF, 10 HEPES, and 10 [ethylene glycol-bis(β-aminoethyl ether)-N,N,N′, N′-tetraacetic acid] (EGTA) (pH = 7.2 titrated with CsOH). The osmolarity of ECS and ICS were between 302 and 308 mOsm/L and ∼295 mOsm/L, respectively. Bath perfusion around the measured cell with different extracellular solutions was achieved using a gravity flow micro perfusion system at a rate of 200 uL/min. Excess fluid was removed continuously. Solutions containing pharmacology agents, e.g., Tetrodotoxin (TTX, Sigma-Aldrich), 1,4-Dithiotreitol (DTT, Sigma-Aldrich), or procainamide (Vifor Pharma España, S.L.) were made fresh in ECS from stocks. Stock solutions were prepared from powder dissolved in de-ionized water. The effect of the tested compounds at a given concentration was characterized as the normalized current calculated as I/I0, where I0 and I are the peak currents in the absence and presence of the compound at the indicated concentration, respectively. A choline-based ECS was used as a perfusion control, its composition was (in mM) 145 Choline-Cl, 5 KCl, 10 HEPES, 5.5 glucose, 2.5 CaCl2, and 1 MgCl2. The prominent change in the current amplitude upon perfusion with the choline-based solution was an indicator of both the successful expression of the NaV1.5 constructs and the proper operation of the perfusion system.

2.9 Voltage protocols

To determine the biophysical properties of the NaV1.5 variants, we studied the kinetics of activation, fast inactivation, the kinetics of recovery from fast inactivation, and the voltage dependence of steady-state activation and inactivation. To study activation and fast inactivation kinetics, cells were depolarized to 0 mV for 15 ms from a holding potential of −120 mV every 5 s (sampling frequency was 20 kHz). To avoid the model dependence of the reported parameter characterizing NaV channel activation kinetics, we assessed the time-to-peak variable (16). Time-to-peak was measured as the time between the initiation of the depolarizing pulse and the time point when INa reached the peak. The average of the time-to-peak for a particular cell was determined as the average of time-to-peak values obtained for 4–5 depolarizing pulses to 0 mV repeated at every 5 s. The current densities in pA/pF for a particular cell were defined as the ratio of the average of peak currents, obtained for at least three depolarizing pulses to the appropriate test potentials repeated at every 5 s in a sequence, to the cell capacitance. The rapid activation of the current is followed by a decay corresponding to fast inactivation of NaV1.5. To obtain the time constant of inactivation (τi) a single exponential function was fitted to the decaying part of the current traces , where I0 is the amplitude of the inactivating component of the current, τi is the inactivation time constant, and C is the steady-state current at the end of the depolarizing pulse. To determine the voltage dependence of steady-state activation of the Na+ current, the cells were held at −120 mV and depolarized for 100 ms to test potentials ranging from −70 to +50 mV in 10-mV increments every 5 s (sampling frequency was 50 kHz). Peak conductance [G(V)] at each test potential was calculated using , where Ipeak is the peak current at a test potential of Vm and VNa is the reversal potential of Na+ (+68.7 mV, based on the Nernst equation using the ionic composition of ECS and ICS). The G(V) values were then normalized for the maximum conductance (G/G0) and plotted as a function of test potential along with the best-fit Boltzmann function , where Vm is the actual test potential, V½ is the midpoint voltage, and s is the slope factor of the function. To describe the voltage dependence of steady-state inactivation (termed as h∞), the fraction of non-inactivated channels at each test potential was calculated as I/I−120, where I is the peak current evoked by a test pulse to 0 mV for 15 ms from a given prepulse potential, and I−120 is the peak current evoked by the test pulse from the holding potential of −120 mV. The duration of the time interval between the test pulses was 5 s. V1/2 and s were determined by fitting a Boltzmann function to the data points. To evaluate the late INa, we analyzed the steady-state Na+ current during the last 5 ms of the 15-ms-long depolarizing pulses to 0 mV i.e., between 10 and 15 ms. TTX-sensitive late Na+ current was defined as the magnitude of the steady-state current in the presence of 0.5 µM TTX and subtracted this value from the current measured in the absence of TTX in the same time-window. To study the kinetics of recovery from inactivation, pairs of depolarizing pulses were applied from the holding potential of −120 to 0 mV for 100 ms (sampling frequency was 20 kHz). The duration of the first step was used to inactivate channels and measure initial peak current amplitude (I1). After a recovery period, defined as the interpulse interval (ipi) at −120 mV, the second identical voltage step was applied, and peak amplitude of the recovered current (I2) was measured. The interpulse interval (ipi) at −120 mV varied between 0.25 and 60 ms. The fractional recovery (FR) at a given ipi was calculated as FR = (I2)/(I1). The FR vs. ipi plot was fit with an exponential function rise to a maximum containing a single term, to give the time constant of recovery from inactivation, τr. Prior to analysis, current traces were corrected for ohmic leak. Nonlinear least squares fits were done using the Levenberg-Marquardt algorithm. For all data acquisition the filter frequency (8 pole Bessel filter) was set to half of the sampling frequency, according to the Nyquist theorem.

2.10 Protein structure modeling

Structural modeling was performed using the cryo-EM structure of the human NaV1.5 [PDB: 7DTC (17)]. Conserved regions, including regions around the R893C mutant, are fully resolved in this structure with 3.30 Å resolution. Based on the crystal structure, R893 was mutated to cysteine with UCSF Chimera X (18), followed by a protonation and an energy minimization step (GAFF force field). Putative ligand interactions were plotted with LigPlot (19).

2.11 Statistical analysis

The number of experiments on different cells (n) involved in the given analysis is shown in the text. The number of independent transfections/biological replicates (N) was at least 4 in most sets of experiments. Data are presented as means ± SEM, individual data points are indicated in the bar graphs. Statistical significance was estimated with GraphPad Prism 8 software (version 8.0.1, La Jolla, CA). The Shapiro–Wilk test was used to test for normality of the given set of data. For pairwise comparisons Student's t test or Mann–Whitney rank sum test (nonnormal distribution population) was applied. For multiple comparisons one-way ANOVA with post hoc Tukey's test was applied. Statistical significance is indicated in terms of P values. However, when P < 0.0001 was reported, our statistical program was unable to determine the exact P value. In these cases, we indicated P < 0.0001.

2.12 Limitations

The number of cells investigated in our study was different for the different voltage protocols and pharmacological experiments. Most cells had to be excluded from the data analysis regarding the determination of the time constant of activation and inactivation. However, the number of these cells did not exceed 10, either. In the case of pharmacological measurements, the number of these cells was negligible (only 1–2 cells had to be eliminated).

3 Results

3.1 Family pedigree and identification of R893C NaV1.5 channel mutation

Mutation screening via next generation whole genome sequencing identified a single heterozygous nucleotide transition (C-to-T) at position 2,677 of the SCN5A gene (c.2677C > T), leading to the missense mutation in which an arginine, R, was replaced by cysteine, C, at position 893 (R893C). Algorithms developed to predict the effect of missense changes on protein structure and function (SIFT, PolyPhen-2, Align-GVGD) all suggested that this variant is likely to disrupt Nav channel function SCN5A 893C was absent in a large cohort (6,500) of healthy individuals (6), and was not found in the Human Gene Mutation Database (HGMD) (20), Ensembl, HapMap, and 1,000 genomes project. Thus, R893C in Nav1.5 may be responsible for BrS in harmony with previous findings (6, 21). Position 893 is in the extracellular linker between S5 and S6 transmembrane segments in domain II (DII) of the Nav1.5 protein (Figure 1) and located in the pore near the selectivity filter. Although the precise role of R893 in NaV1.5 is unknown, the presence of and arginine at this position has been evolutionary favored. Comparison of aligned amino acid sequences demonstrates that R893 is highly conserved among different human Nav channel isoforms (Figure 2A). Furthermore, it is also highly conserved among SCN5A in different species including mice, rat and human (Figure 2B).

Figure 2

The proband has 2 sons (III-1 and III-2, Figure 3), both are completely asymptomatic with no signs of structural heart disease during transthoracic echocardiography. One of them (III-1) showed normal pattern, the other one (III-2) had an incomplete right bundle branch block (RBBB) on the resting 12-lead ECG. No genetical abnormality was found in any of them and both refused invasive EP study. Although one of the proband's brother died at his early age, but he died due to consequences of hepatocellular carcinoma and not by cardiac arrhythmia.

Figure 3

3.2 Biophysical characterization of WT-NaV1.5GFP

First, we tested the effect of the GFP-tag located at the N-terminus of NaV1.5 (WT-NaV1.5GFP) by comparing the gating characteristics to wild-type NaV1.5 (WT-NaV1.5). Sodium currents were recorded in CHO cells in whole-cell configuration and the essential gating parameters were determined including the voltage-dependence of steady-state activation and steady-state inactivation, the kinetics of activation, inactivation, and recovery from inactivation. The currents were fully activated by 15-ms-long depolarizing pulses to 0 mV for both WT-NaV1.5 and WT-NaV1.5GFP (Supplementary Figure S3A). CHO cells transfected with plasmid for WT-NaV1.5 showed average peak current densities of 311.8 ± 31.8 pA/pF (n = 15) (Supplementary Figure S3B). Similar currents were observed at a mean peak level of 340.6 ± 36.2 pA/pF (n = 31) for WT-NaV1.5GFP, showing no significant difference compared to WT-NaV1.5 (P = 0.6150) (Supplementary Figure S3B and Table 1). The activation kinetics showed a small, but biologically not relevant difference: the time-to-peak values were 0.413 ± 0.019 ms (n = 15) for WT-NaV1.5 and 0.493 ± 0.018 (n = 31) for WT-NaV1.5GFP (P = 0.008) (Supplementary Figure S3B). Time constants of fast inactivation (τi) were obtained by fitting decaying exponential functions to the current traces recorded during 15-ms-long depolarizing pulses to 0 mV (Supplementary Figure S3A). τi for WT-NaV1.5 and WT-NaV1.5GFP were 0.719 ± 0.065 ms (n = 15) and 0.869 ± 0.047 ms (n = 26), respectively (Supplementary Figure S3B, Table 1) the difference was not statistically significant (P = 0.0658). The G-V curve was calculated from the current-voltage relationship, which was obtained using a series of 100-ms-long depolarizing pulses ranging from −70 mV to +50 mV in 10-mV increments every 5 s. The voltage dependence of the conductance was determined by fitting a Boltzmann function to the normalized conductance (G/G0)-test potential relationships to give the midpoint voltage (V1/2) and slope factor (s) (Supplementary Figure S3C; see Methods for details). We found that the GFP tag does not modify either the midpoint voltage or the slope factor of the function for NaV1.5, as the midpoint voltages were V1/2 = –30.1 ± 2.4 mV and s = 5.8 ± 0.4 mV (n = 6) for WT-NaV1.5 and V1/2 = –34.2 ± 1.8 mV and s = 6.1 ± 0.3 mV (n = 23) for WT-NaV1.5GFP (P = 0.2846 and P = 0.6591 for V1/2 and s, respectively) (Supplementary Figure S3C, inset). To assess the voltage-dependence of steady-state inactivation, we applied 5-s-long prepulse potentials from −120 to −10 mV in 10-mV increments before stepping the test potential to 0 mV for 15 ms. The fraction of non-inactivated channels at each voltage was calculated as I/I−120 and plotted as a function of prepulse potential and the voltage dependence of steady-state inactivation was characterized by V1/2 and a slope factor determined from Boltzmann fits (see Materials and Methods) (Supplementary Figure S3D). The GFP tag did not cause a shift in the h∞ curves: the V1/2 values were V1/2 = –54.2 ± 2.9 mV and s = –8.4 ± 0.5 mV (n = 10) for WT-NaV1.5 and −59.1 ± 2.1 mV and s = –9.5 ± 0.5 mV (n = 12) for WT-NaV1.5GFP (P = 0.1676 for V1/2 and P = 0.1461 for s), respectively (Supplementary Figure S3D, inset). The kinetics of recovery from inactivation were studied using depolarizing pulse pairs and varying the interpulse interval (ipi) between the depolarization steps (see Materials and Methods for details). The two steps voltage protocol and a representative INa recording for characterizing the kinetics of recovery WT-NaV1.5GFP are shown in Supplementary Figure S4. The recovered fraction (FR) of the channels vs. ipi plot was fit with a single-exponential function to give the time constant of recovery from inactivation (τr) (Supplementary Figure S3 E). τr for WT-NaV1.5 and WT-NaV1.5GFP were 3.20 ± 0.40 (n = 9) and 3.40 ± 0.20 (n = 22) ms, respectively (P = 0.6283) (Supplementary Figure S3E, inset). The essential gating parameters of WT-NaV1.5 and WT-NaV1.5GFP are summarized in Table 2.

Table 1

Current density
pA/pFN
WT-NaV1.5311.8 ± 31.8
(P = 0.6150)
15
WT-NaV1.5GFP340.6 ± 36.231
R893C-NaV1.5GFP15.8 ± 2.2
(P < 0.0001)
19
Mixed373.4 ± 33.9
(P = 0.7560)
47
R893H-NaV1.5GFP17.3 ± 3.5
(P < 0.0001)
28

Current densities of NaV1.5 constructs expressed in CHO cells.

Values are expressed as mean ± SEM. P values are indicated vs. WT-NaV1.5GFP group.

Table 2

VariantActivation kineticsInactivation kineticsVoltage-dependence of steady-state activationVoltage-dependence of steady-state inactivationRFI
time to peak at 0 mV (ms)nτi at 0 mV (ms)nV1/2 (mV)s (mV)nV1/2 (mV)s (mV)nτr (ms)n
WT-NaV1.50.413 ± 0.019
(P = 0.008)
150.719 ± 0.065
(P = 0.0658)
15−30.1 ± 2.4
(P = 0.2846)
5.8 ± 0.4
(P = 0.6591)
6−54.2 ± 2.9
(P = 0.1676)
−8.4 ± 0.5
(P = 0.1461)
103.2 ± 0.40
(P = 0.6283)
9
WT-NaV1.5GFP0.493 ± 0.018310.869 ± 0.04726−34.2 ± 1.86.1 ± 0.323−59.1 ± 2.1−9.5 ± 0.5123.4 ± 0.2022
R893C-NaV1.5GFP0.779 ± 0.079
(P < 0.0001)
200.933 ± 0.085
(P = 0.4892)
20−24.9 ± 2.1
(P = 0.0033)
8.9 ± 0.7
(P = 0.0002)
12−47.4 ± 3.0
(P = 0.0037)
−11.3 ± 0.7
(P = 0.0455
103.65 ± 0.36
(P = 0.4798)
12
Mixed0.532 ± 0.013
(P = 0.0515)
461.082 ± 0.045
(P = 0.0457)
47−29.4 ± 1.5
(P = 0.0520)
7.6 ± 0.3
(P = 0.0047)
44−52.1 ± 2.2
(P = 0.0578)
−9.7 ± 0.5
(P = 0.7522)
273.90 ± 0.19
(P = 0.1020)
45

Gating parameters of NaV1.5 constructs expressed in CHO cells.

The kinetics of activation was obtained from time to peak at 0 mV are indicated in the Activation kinetics column. The inactivation time constants (τi) obtained from single-exponential fits and the time constants for the fast components of the decay are indicated in the Inactivation kinetics column. V1/2 and s values were obtained by the Boltzmann function to the data. τr is the time constant for recovery from inactivation (RFI), n indicates the number of independent experiments. See the Materials and methods for the equations used for fitting. Statistical significance against WT-NaV1.5GFP is indicated.

3.3 R893C dramatically decreases peak INa and modifies NaV1.5 channel activation kinetics

A heterozygous variation at position 2,677 of the SCN5A gene (c.2677 C > T) was identified in the proband's DNA that leads to an arginine to cysteine substitution at position 893 (p.R893C) of the NaV1.5 protein (R893C-NaV1.5GFP). The mutation was proposed earlier to contribute to the BrS phenotype (12, 14); thus, we conducted patch-clamp studies to assess the effect of the mutation R893C in whole cell configuration. Cells, transfected with R893C-NaV1.5GFP coding plasmid, were clamped at a holding potential of −120 mV and subjected to 15 ms duration depolarization pulses to 0 mV at pulse frequency of 0.2 Hz. Current traces in Figures 4A,B show that INa is dramatically reduced by the R893C mutation. The peak Na+ current density values, calculated at different test potentials for the R893C-NaV1.5GFP, were smaller than in WT-NaV1.5GFP transfected cells (Figure 4C, Table 1). Figure 4D shows the current densities determined at 0 mV that were (in pA/pF) 340.6 ± 36.2 (n = 31) for WT-NaV1.5GFP and 15.8 ± 2.2 (n = 19) for R893C-NaV1.5GFP, respectively (P < 0.0001). This may mean that the R893C mutation causes gross structural changes in the channel thereby disrupting Na+ conduction, gating, or channel trafficking/stability and/or the combination of these.

Figure 4

We recorded very small Na+ currents in our experimental system in non-transfected CHO cells (current density at 0 mV is 4.6 ± 1.2 pA/pF, n = 15, Supplementary Figure S5). To eliminate the possibility that the recorded Na+ currents upon transfection with R893C-NaV1.5GFP are endogenous currents, we tested the effect of 0.5 µM tetrodotoxin (TTX) applied extracellularly, since endogenous Na+ channels are sensitive to 0.5 µM TTX [INa in CHO cells could be fully eliminated after treatment with 0.5 µM TTX (22)], whilst the cardiac NaV1.5 is not (23, 24). Macroscopic currents were recorded in the continuous presence of 0.5 µM TTX (dissolved freshly in the ECS, see Materials and Methods) in WT- and R893C-NaV1.5GFP transfected cells at 0 mV every 5 s (Figures 4A,B). The currents recorded in the presence or absence of TTX were virtually overlapping for both WT-NaV1.5GFP and R893C-NaV1.5GFP transfected cells upon ∼3 min continuous perfusion of the cells with TTX. The normalized current, calculated as I/I0, where I0 is the peak current in the absence, and I is the peak current at equilibrium block by 0.5 µM TTX), was 0.927 ± 0.013 (n = 4) and 0.913 ± 0.025 (n = 6) for WT-NaV1.5GFP and R893C-NaV1.5GFP, respectively (P = 0.7029) (Figure 4E). We also determined the current densities of late INa as the TTX sensitive current. To do this, we measured the magnitude of the steady-state current (average of the last 5 ms of the depolarizing steps) in the presence of 0.5 µM TTX and subtracted this value from the current measured in the absence of TTX in the same time-window. The TTX sensitive current then was expressed in pA/pF. The values were 3.3 ± 0.9 (n = 4) and 1.8 ± 0.5 (n = 6) for WT-NaV1.5GFP and R893C-NaV1.5GFP, respectively (P = 0.1680) (Figure 4F). Moreover, additional experiments were performed in HEK cells to exclude the possibility that our observations, i.e., the reduced current density of R893C-NaV1.5GFP were specific to the CHO expression system. The Na+ current density at 0 mV was even smaller when R893C-NaV1.5GFP was expressed in HEK (5.4 ± 0.7 pA/pF, n = 9, Supplementary Figure S5) as compared to CHO.

To address whether the decreased current density in R893C-NaV1.5GFP transfected cells is a consequence of biogenesis/trafficking deficiency, we used confocal microscopy and SDS-page analysis. In confocal microscopy experiments we took advantage of the GFP tag on the N-termini of WT-NaV1.5GFP and R893C-NaV1.5GFP channels. The plasma membrane localization of the GFP-tagged constructs was assessed by comparing the GFP fluorescence signal to the Alexa Fluor™ 647 NHS Ester fluorescence intensity emitted from the plasma membrane. The normalized pixel-by-pixel intensity profile analysis of WT-NaV1.5GFP and R893C-NaV1.5GFP transfected cells confirm the same GFP expression pattern for both WT-NaV1.5GFP and R893C-NaV1.5GFP (Supplementary Figure S6). These results suggest persistent trafficking and expression of mutant channel R893C-NaV1.5GFP to the plasma membrane. Plasma membrane expression of the WT-NaV1.5GFP or R893C-NaV1.5GFP proteins was also confirmed by the comparison of the GPF signal of the proteins extracted from the membrane fractions of the transiently transfected cells (Supplementary Figure S7). The protein extraction was verified using Coomassie blue staining of the same SDS–polyacrylamide gel. Supplementary Figure S7 indicates the expression of NaV1.5 constructs in the membrane in comparable amount. The negative control was the extract of native i.e., non-transfected CHO cells for which, therefore, no GFP signal was detected (Supplementary Figure S7). Taking together all these findings, we suggest that the loss of Na+ current resulting from the R893C mutation is caused by the loss of function of Nav1.5 channels, rather than altered trafficking of otherwise functional channels.

In addition to the reduction in current density for the R893CNaV1.5GFP construct (Figure 4B), the mutation confers altered kinetic properties to WT-NaV1.5GFP, as well (Table 2). Figure 5 shows the essential biophysical parameters of R893C-NaV1.5GFP as compared to WT-NaV1.5GFP. The kinetics of activation and inactivation were determined using 15-ms-long depolarizing pulses to 0 mV every 5 s. To describe the activation kinetics, we determined the time-to-peak variable (see Methods for details). We found that R893C has significant effect on channel activation: time-to-peak is 0.493 ± 0.018 ms (n = 31) and 0.779 ± 0.079 ms (n = 20) for WT- and R893C-NaV1.5GFP, respectively (P < 0.0001) (Figure 5A). The inactivation time constant of the currents were determined by fitting a single exponential function to the decaying part of the currents shown in Figures 4A,B. In contrast to the kinetics of activation, we did not observe significant change in the inactivation kinetics; τi was (in ms) 0.869 ± 0.05 (n = 26) and 0.933 ± 0.08 (n = 20) for WT- and R893C-NaV1.5GFP, respectively (P = 0.4892) (Figure 5A). We have also studied the voltage dependence of the activation kinetics in a range between −30 to +30 mV in 10-mV steps (Supplementary Figure S8). The activation kinetics of the current is faster with increasing depolarizations, and the time constants are greater (i.e., kinetics is slower) for the R893C-NaV1.5GFP at each test potential. Moreover, we found that the R893C-NaV1.5GFP displays a ∼10 mV positive shift in the voltage-dependence of the steady-state activation toward more positive potentials together with a significant increase in the slope factor (V1/2 = –34.2 ± 1.8 mV and s = 6.1 ± 0.3 mV, n = 23, for WT-NaV1.5GFP and V1/2 = –24.9 ± 2.1 mV and s = 8.9 ± 0.7 mV, n = 12 for R893C-NaV1.5GFP; P = 0.0033 and 0.0002 for V1/2 and s, respectively) (Figure 5B). Similarly, the voltage-dependence of steady-state inactivation was shifted by ∼10 mV to more depolarized potentials with a shallower slope for the R893C-NaV1.5GFP construct (V1/2 = –59.1 ± 2.1 mV and s = –9.5 ± 0.5 mV, n = 12, for WT-NaV1.5GFP; V1/2 = –47.4 ± 3.0 mV and s = –11.3 ± 0.7 mV, n = 10 for R893C-NaV1.5GFP; P = 0.0037 and P = 0.0455 for V1/2 and s, respectively) (Figure 5C). We also compared the kinetics of recovery from inactivation induced by a 100-ms depolarization to 0 mV, followed by a variable recovery interval interpulse (ipi) at −120 mV (the voltage protocol is shown in Supplementary Figure S4). The kinetics of recovery from inactivation for both WT- and R893C-NaV1.5GFP were well-fit using a single-exponential component. Our data showed that the τr in R893C-NaV1.5GFP is not different from that of the WT-NaV1.5GFP channels (Figure 5D); τr was (in ms) 3.38 ± 0.19 (n = 22) and 3.65 ± 0.36 (n = 12) for WT-NaV1.5GFP and R893C-NaV1.5GFP, respectively (P = 0.4798).

Figure 5

3.4 The R893C-NaV1.5GFP mutant channels do not exert a dominant negative effect on WT- NaV1.5GFP

To test whether R893C has a dominant-negative effect on WT channels, we recorded INa in CHO cells co-transfected with the WT-NaV1.5GFP and R893C-NaV1.5GFP channels at 1:1 ratio (later termed as Mixed) (Figures 6A–C). We maintained the concentration each construct the same as in single-transfection experiments (section 3.3) i.e., 1 µg WT and 1 µg R893C plasmids were used in the co-transfection experiments. In this scenario, any dominant-negative effect of the R893C-NaV1.5GFP construct should be reflected in a reduction of the peak INa as compared to WT-NaV1.5GFP single-transfection data. We found that the trafficking competent but gating-defective R893C mutant does not exert a dominant-negative effect, as we did not observe a significant reduction in the peak current densities compared to the WT. The current densities at 0 mV were (in pA/pF) 340.6 ± 36.2 (n = 31) for WT-NaV1.5GFP and 373.4 ± 33.9 (n = 47) for Mixed channels, respectively (P = 0.7560) (Table 1 and Figure 6D). In cells co-expressing WT and R893C channels there was no shift of the V1/2 of activation and inactivation compared with WT expressed alone (WT: V1/2 = –34.2 ± 1.8 and s = 6.1 ± 0.3 mV, n = 23; Mixed: V1/2 = –29.4 ± 1.5, s = 7.6 ± 0.3 mV, n = 44; P = 0.0520 for V1/2 and P = 0.0047 for s for steady-state activation; WT: V1/2 = –59.1 ± 2.1 and s = –9.5 ± 0.5 mV, n = 12; Mixed: V1/2 = –52.1 ± 2.2 and s = –9.7 ± 0.5 mV, n = 27; P = 0.0578 for V1/2 and P = 0.7522 for s, for steady state inactivation) (Figure 6F,Table 2). Similarly, we did not observe significant differences in the activation kinetics of the currents (WT: time-to-peak=0.493 ± 0.018 ms, n = 31; Mixed: time-to-peak = 0.532 ± 0.013, n = 46; P = 0.0515) (Figure 6E,Table 2). The kinetics of recovery from inactivation were also similar for the WT and Mixed records: τr were (in ms) 3.38 ± 0.20 (n = 22) and 3.90 ± 0.19 (n = 45) (P = 0.1020) for WT and Mixed channels, respectively (Figure 6G,Table 2). On the other hand, a slight but statistically significant increase was observed in the time constant of fast inactivation when cells expressed the Mixed population of channels as compared to WT single transfected ones. The τi were (in ms) 0.869 ± 0.05 ms (n = 26) and 1.082 ± 0.05 (n = 47) (P = 0.0457); for WT and Mixed channels, respectively (Figure 6E,Table 2).

Figure 6

3.5 Procainamide inhibits the NaV1.5 regardless of the R893C mutation

BrS was triggered in the proband by procainamide administration (Supplementary Figure S2) (13). Therefore, the sustained sensitivity of the mutant current to procainamide had to be demonstrated. The procainamide sensitivity of the WT current is in Figure 7A. The current was eliminated upon perfusion of the bath solution with 1 mM procainamide (25, 26). Figure 7B shows a similar phenomenon for the R893C-NaV1.5GFP. The current is eliminated, the record obtained in the presence of procainamide overlaps with the one obtained in Na + -free extracellular solution. We also took advantage of the experimental layout in section 3.4, i.e., we repeated the experiments for mixed channel as well, where WT-NaV1.5GFP and R893C-NaV1.5GFP were co-expressed to mimic the heterozygous state of the patient. The inhibition of INa current was also complete in the presence of procainamide for the “Mixed” channels (Figure 7C). The quantitative analysis in Figure 7D shows that the remaining fraction of the peak currents is less than 0.12 in the presence of 1 mM procainamide, regardless of the constructs transfected; normalized currents were 0.018 ± 0.005 (n = 3), 0.117 ± 0.028 (n = 3, P = 0.0198), 0.069 ± 0.015 (n = 4, P = 0.1796) for WT-NaV1.5GFP, R893C-NaV1.5GFP, and Mixed channels, respectively.

Figure 7

3.6 Dithiotreitol treatment increases the R893C-NaV1.5GFP current

We hypothesized that the LOF current phenotype of R893C can be, at least partially, the consequence of the formation of disulfide bonds involving 893C. To explore this scenario as the molecular mechanism of the current loss caused by the arginine to cysteine substitution, we recorded Na+ currents in the presence of the reducing agent dithiotreitol (DTT) at 1 mM. Voltage protocols shown in Figure 8 were used for recording Na+ currents in the continuous presence of 1 mM DTT, and its effect was expressed as normalized current calculated as I/I0, where I0 is the peak current at 0 mV prior to application of DTT and I is the peak current upon DTT application for 3 min. Exposure of CHO cells expressing WT-NaV1.5 to the reducing agent DTT for 3 min produced no functional changes in INa (Figure 8A), the normalized current was 1.02 ± 0.01 (n = 8). Importantly, DTT significantly enhanced the R893C-NaV1.5GFP current; the normalized current was 1.39 ± 0.03 (n = 8) (P < 0.0001) (Figures 8B,C). These results suggest that R893C spontaneously form a disulfide bond with native cysteines in the vicinity of residue 893 that leads to the loss of the channel function. Moreover, reducing these disulfide bonds with DTT may help to restore the normal channel function in R893C-NaV1.5GFP.

Figure 8

3.7 The NaV1.5 Na+ channel functions critically depending on the R893 residue

To further address the importance of the R893 in the gating machinery of NaV1.5, we studied the functional consequence of the arginine to histidine mutation at the same site (R893H). If the conserved R893 plays an important role in channel gating, then substitution with histidine, although having similar physicochemical properties like arginine, may also reduce the Na+ conductance, as well. In these experiments, we recorded whole cell Na+ currents at membrane potentials between −70 and +100 mV in CHO cells expressing R893H-NaV1.5GFP (Figure 9A). When R893H-NaV1.5GFP was expressed alone, very little current was observed. The current density was ∼3% of the WT-NaV1.5GFP channels; at 0 mV current densities were (in pA/pF) 340.6 ± 36.2 (n = 31) for WT- NaV1.5GFP and 17.3 ± 3.5 (n = 28) for R893H-NaV1.5GFP, respectively (P < 0.0001) (Figure 9B). We observed the same dramatic reduction in peak current densities by expressing R893H-NaV1.5GFP in HEK cells (data not shown).

Figure 9

The findings above suggest that arginine at 893 is essential for the functional NaV1.5 channel activity. To better understand the structural implications of R893, we examined the cryo-EM structure of the human NaV1.5 channel (PDB: 7DTC). Indeed, R893 appears to play a critical role in stabilizing the pore helix by forming three hydrogen bonds with the side chains of glutamate residues E898 and E901 (Figure 10A), thereby coordinating their negatively charged side chains towards the pore (Figure 10B). This coordination likely helps maintain a negatively charged electrostatic environment (Figure 10C) that is favorable for Na⁺ conductance. In contrast, the R893C mutant lacks the conservative bulky arginine side chain necessary for this coordination, resulting in a disruption of these interactions (Figures 10D,E). Consequently, the negative charge density in this region is significantly reduced (Figure 10F), which may impair Na⁺ ion permeation through the pore.

Figure 10

4 Discussion

In this study, we functionally characterized an SCN5A mutation (c.2677C > T) associated with a peculiar clinical phenotype in a Hungarian proband, a 41-year-old male patient diagnosed with BrS. A marked variability in the clinical presentation ranging from the absence of any symptom to SCD can be observed in individuals carrying SCN5A mutations (27). Due to its heterogeneity, the functional characterization of any mutation in patients with BrS may provide further contribution to the understanding of the disease.

The c.2677 C > T nucleotide change causes an arginine-to-cysteine substitution at position 893 (p.R893C), localized in the S5-S6 extracellular linker in DII (Figure 4). The region of our interest is a hotspot for several mutations causing BrS (6). For example, e.g., R878C was examined in a Chinese family (28) that, and a decreased Na+ conductance was reported without dominant negative effect on the WT channels. Another mutation in the same position, R878 K (28), also resulted in the loss of the Na+ current, highlighting the importance of the highly conserved Arg residues in the pore region. We hypothesized that the R893C heterozygous mutation is pathogenic based on the followings: (1) sequence alignment demonstrated that R893 is highly conserved in human NaV channel isoforms and across mammal species (Figures 5A,B) suggesting that R893 is likely to be essential for normal channel function; (2) algorithms developed to predict the effect of missense changes on protein structure and function (SIFT, PolyPhen-2, Align-GVGD) all suggested that R893C variant is likely to be disruptive; 3) SCN5A c.2677C > T was absent in a large cohort (6,500) of healthy individuals (ClinVar and Ensemble database) and was not found in the Human Gene Mutation Database (HGMD) (20), Ensembl, HapMap, and 1,000 genomes projects, thereby excluding a single nucleotide polymorphism. Our study confirmed the hypothesis, the R893C NaV1.5 displayed significant loss of channel function, i.e., dramatically decreased current density. The LOF phenotype reported in our study is in a good agreement with previous findings i.e., the current density of R893C is approximately 5%–10% of WT NaV1.5 expressing HEK cells (12, 14). To provide a detailed biophysical characterization of R893C-NaV1.5 and shed light on the molecular mechanism of the significant Na+ current loss we followed the principles in the literature regarding the characterization of genotype-phenotype relationships in BrS (2931).

For strategic purposes we used NaV1.5 constructs carrying GFP-tag at the N-terminus that allowed us to track the expression level of the different NaV1.5 constructs in the membrane or the localization of the proteins in the cell. We clearly showed that the GFP-tag does not modify the gating behavior of NaV1.5 (Supplementary Figure S3) similarly to the observations for the human heart Na+ channel (hH1) protein (32).

We argue that the small INa recorded in R893C-NaV1.5 expressing cells is conducted by the R893C-NaV1.5 channels, rather than the endogenous NaV channels know to be expressed in CHO (22), as follows: (1) We observed a very low background Na+ current in non-transfected CHO (Supplementary Figure S5); (2) The R893C-NaV1.5 current retained its TTX resistant phenotype (Figure 4B) characteristic of NaV1.5 [IC50 = 5.7 µM (23, 24),]. Contrary to this, endogenous Na+ channels in CHO can be completely inhibited by nanomolar concentrations of TTX (22). In addition, R893C-NaV1.5 channels are expressed in membrane as reported by fluorescence confocal microscopy and SDS-PAGE (Supplementary Figure S6 and S7). Based on these we conclude that the Na+ current measured in R893C-NaV1.5 expressing cells is the consequence of the expression of non- or reduced function of NaV1.5 channels. Moreover, changes in the biophysical parameters of the currents discussed below are due to altered intrinsic properties of the R893C-NaV1.5 channel.

Most NaV1.5 mutations associated with BrS are LOF mutations and are commonly due to disruption of activation or impaired recovery from inactivation (33, 34). We also observed slower activation kinetics of INa current for R893C channels, together with a depolarizing shift in the voltage dependence of steady-state activation with a shallower slope (Figures 5A,B). Moreover, the activation kinetics showed similar voltage sensitivity both for the WT and the R893C variants (Supplementary Figure S8). The slowing of the activation kinetics maintained fast inactivation kinetics (Figure 5A) may contribute partially to the decreased Na+ current density since channels are more likely to inactivate before they the current would reach its maximum at a given membrane potential (35). This, together with the depolarizing shift in the voltage-dependence of steady-state activation of the R893C variant may reduce the currents at physiologically relevant membrane potentials.

Surprisingly, the R893C mutation also caused a 10-mV shift towards more positive membrane potentials in the voltage dependence of steady-state inactivation (Figure 5C). Similarly, a relatively large depolarizing shift in the voltage dependence of steady state inactivation was observed in the LOF mutant T1857I-NaV1.5, that is linked to a family with a catecholaminergic polymorphic ventricular tachycardia (CPVT)-like phenotype characterized by a strong family history of SCD (36). The depolarizing shift in the voltage dependence of steady-state inactivation increases the number of available channels that can be active, that, therefore, may compensate the reduced current density, as it widens the window of potentials (i.e., window current) over which a fraction of sodium channels can be activated, but not inactivated i.e., functional.

To mimic the heterozygous condition of the patient and test a potential dominant-negative effect of the mutation, we co-transfected WT- and R893C-NaV1.5GFP at 1:1 molar ratio (using 1-1 ug DNA) into CHO cells and determined the peak current amplitudes and kinetic parameters of the whole-cell Na+ currents (Figure 6). Our analysis showed that the presence of the R893C-NaV1.5GFP channels in the membrane did not exert a dominant negative phenotypic effect. Our results are in good agreement with earlier reports, e.g., T187I, D356N, K1578fs/52, and R1623X, that were similarly linked to BrS, SSS and atrioventricular block, also lacked a dominant-negative effect (37). Furthermore, confocal microscope imaging yielded similar plasma membrane expression of both WT-NaV1.5GFP and R893C-NaV1.5GFP channels (Supplementary Figures S6 and S7). There are, however, limitations for the interpretation of the “mixed” co-expression data, where WT- and R893C-NaV1.5GFP were expressed simultaneously, for mimicking heterozygosity. We assumed that both constructs have equally expressed. Co-expression of wild-type and mutant NaV1.5 channels were reported to form dimers, and due to their interaction, coupled gating of voltage-gated Na+ channels may result in a dominant negative effect. Nevertheless, we have not seen a dominant negative effect, i.e., the gating and permeability changes reported in our paper may not couple like in case of L325R (38), even if dimers are formed.

Sodium channel blocker procainamide is frequently used to unmask the Brugada ECG whenever the disease is suspected (25, 26). Accordingly, the transformation of a normal ECG pattern to a coved ST elevation in response to the procainamide administration is specific for BrS (39), as observed in the proband (13). We observed almost complete inhibition of INa by 1 mM procainamide in all variants (Figure 7). This finding supports that the mutant channel retained its procainamide sensitivity which correlates well with the clinical findings during BrS induction.

We found that extracellularly applied DTT at 1 mM partially restored the normal function of NaV1.5 in the R893C-NaV1.5GFP variant (Figure 8). Based on the domain structure and the available cryo-EM structure of NaV1.5 (17, 40), we propose the idea that the cysteine at 893 could form disulphide bridges with native cysteine residues in the close vicinity of R893C, e.g., C896. Other cysteines in the same linker, such as C906 and C915, and more distant cysteines located in other domains (e.g., C373 in DI, C1272 in DIII, or C1703 in DIV) are too far away to form plausible bonds with R893C. Based on these we propose that the second component of the reduction in the INa in the R893C-NaV1.5 in may be attributed to the formation of disulphide bridges that disrupt Na+ permeation (see below).

To further test the critical role of the conserved R893, we studied the electrophysiological properties of R893H-NaV1.5GFP expressed in CHO cells. This mutation is also a missense pathogenic mutation that was identified in patients with BrS (6, 41). Patch-clamp recordings revealed that R893H-NaV1.5GFP failed to show detectable macroscopic INa (Figure 9).

Our findings complement and confirm previous reports of highly conserved arginine residues at different positions in NaV-s that are critical for channel function (6). For example, R878 is similarly highly conserved, and the replacements of either R878C or R878 K failed to produce any detectable INa (26).

Closer inspection of the wild-type and mutant structures revealed additional mechanistic insights for the decrease in the INa for the R893 mutants. The positively charged bulky arginine R893 in the WT channel appears to stabilize the pore loop by forming three hydrogen bonds with the side chains of two glutamates, E898, and E901 (Figure 10A). By sterically coordinating the negatively charged glutamate sidechains towards the pore (Figure 10B), these interactions likely maintain a negatively charged electrostatic environment favorable for Na⁺ conductance (Figure 10C). However, the energy-minimized structure indicates that sterically more favorable interactions might occur between R893C and the backbones of adjacent residues such as L889, G897, E898 (Figure 10D). Therefore, the R893C mutant lacks the ability to coordinate E898, and E901 (Figure 10E), leading to a significant reduction in negative charge density in this region (Figure 10F), which may impair ion permeation. A similar disruption was observed in the R893H mutant, which lacks sufficient size and charge to stabilize E901 effectively (not shown). These structural predictions corroborate our electrophysiological experimental data and support the notion that R893 is essential for channel function and plausibly explain its evolutionary conservation. A similar mechanism has already been highlighted for the R878C mutant in NaV1.5 which failed to show detectable INa, and proposed to be associated with familiar sick sinus syndrome (SSS) in a Chinese family (28).

Moreover, Arg residues behind the SF, such as R367, R383, R878, R893, form salt bridges with negatively charged residues (42). Breaking critical salt bridges in these Arg mutations can induce conformational changes of the SF and then reduce the ion permeability (42). Due to their location, these Arg residues may also play key roles in fast inactivation, persistent current, membrane protein orientation, protein-lipid interactions and protein-protein interactions (4345). Disruption of these mechanisms may also contribute to the pathogenic nature of the aforementioned Arg mutations. Since R893 directly forms salt bridges with two glutamate residues, E898 and E901 in DII (42), the R893C mutation may disrupt these critical interactions adjacent to the SF thereby inducing conformational changes in the SF region and consequently reduce Na+ permeability. In harmony with these both R893C and E901 K have been associated with BrS (6). Similarly to this, R878 forms a salt bridge with D1430 in DIII from the neighboring repeat (42). In summary, a third mechanism for the reduction in the INa in the R893C-NaV1.5 may be attributed to the disruption of the interaction network required for Na+ conductance, that is maintained by a critical Arg (R893) in the WT channel.

Based on our results, we argue that the abnormal Na+ homeostasis, caused by the loss of function of R893 mutations, plays a critical role in creating an arrhythmia-prone substrate as well as in generating a trigger for the rhythm disorder. Reduced sodium current decreases AP's upstroke velocity causing longer AP, leading to atrial and ventricular conduction slowing accompanied by prolongation of PR- and QRS-intervals on the ECG. According to one possible scenario, the sodium current reduction may cause an endo-epicardial potential gradient underlying the right precordial ST-segment elevation that may further exacerbate right ventricular activation delay and subsequent ECG changes (41, 46). This endo-epicardial potential gradient and the consequential repolarization heterogeneity may act as the electrophysiological substrate to ventricular arrhythmias. Moreover, the decreased Na+ conductance makes the AP more vulnerable to early and delayed afterdepolarizations (EAD and DAD): if these afterdepolarizations reach the activation threshold, a new AP can be triggered before the first one ended, which can cause an “R on T” phenomenon, inducing polymorphic VT.

In summary, we have characterized a NaV1.5 pore mutation, R893C, in a male patient diagnosed with BrS. This mutation causes an evident reduction in INa, which originates from multiple components including alerted time- and voltage-depend gating of the mutant channels; disulphide bridge formation between R893C and an adjacent cysteine residue; and a disrupted interaction network of amino acid side chains required for Na+ conductance. The mutation-dependent effects create the conditions for the pathophysiological manifestations observed in the patient. Although the changes in the function of the mutant channel are significant, we cannot exclude that the functional consequences of R893C mutation in native myocytes are different from those observed in our CHO cell experimental model, due to different regulatory factors. We strongly believe that our results hold the promise that correlations among channel structure, functional effects of mutations and clinical studies can lead to better understanding of arrythmia-related channelopathies, such as BrS. Moreover, understanding the structure-function relationship of Nav1.5 may improve novel gene therapy and shed new light on exploiting efficient medication for SCN5A channelopathies.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.

Ethics statement

The studies involving humans were approved by Ministry Of Human Resources Deputy State Secretary Responsible For National Chief Medical Officer Duties Health Administration Department. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.

Author contributions

SG: Data curation, Validation, Investigation, Software, Formal analysis, Writing – original draft, Writing – review & editing. BM: Formal analysis, Methodology, Visualization, Conceptualization, Writing – review & editing, Validation, Investigation. JV: Formal analysis, Writing – review & editing, Investigation, Visualization. NB: Investigation, Writing – review & editing. MUN: Writing – review & editing. ZP: Visualization, Software, Writing – review & editing. GS: Writing – review & editing, Methodology. GM: Investigation, Writing – review & editing, Formal analysis. OV: Methodology, Investigation, Writing – review & editing, Visualization. IB: Conceptualization, Supervision, Methodology, Writing – review & editing, Validation. GP: Supervision, Data curation, Conceptualization, Funding acquisition, Writing – review & editing, Writing – original draft, Methodology. ZC: Funding acquisition, Writing – review & editing, Conceptualization, Supervision, Methodology. TGS: Writing – review & editing, Methodology, Supervision, Writing – original draft, Investigation, Formal analysis, Visualization, Funding acquisition, Project administration, Data curation, Validation.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This work was supported by the Ministry of Culture and Innovation of Hungary from the National Research, Development and Innovation Fund, grant 2024-1.2.3-HU-RIZONT-2024-00099 (to G. Panyi), University of Debrecen, Bridging Fund No: 1D00BKBOBFST 247 and University of Debrecen DETKA grant (to T. G. Szanto), Ministry of Culture and Innovation of Hungary from the National Research, project TKP2021-EGA-18 (to Z. Csanadi and Sz. Gaal) and by the Deutsche Forschungsgemeinschaft (DFG; grant Nr. PE 3917/2-1, to Z. Pethő).

Acknowledgments

We thank the expert technical assistance of Cecilia Nagy and Adrienn Bagosi. The authors declare no competing financial interests.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcvm.2026.1726536/full#supplementary-material

References

  • 1.

    JuangJJHorieM. Genetics of brugada syndrome. J Arrhythm. (2016) 32(5):41825. 10.1016/j.joa.2016.07.012

  • 2.

    ChenPSPrioriSG. The brugada syndrome. J Am Coll Cardiol. (2008) 51(12):117680. 10.1016/j.jacc.2007.12.006

  • 3.

    AntzelevitchCBrugadaPBorggrefeMBrugadaJBrugadaRCorradoDet alBrugada syndrome: report of the second consensus conference: endorsed by the heart rhythm society and the European heart rhythm association. Circulation. (2005) 111(5):65970. 10.1161/01.CIR.0000152479.54298.51

  • 4.

    BrugadaJBrugadaP. Further characterization of the syndrome of right bundle branch block, ST segment elevation, and sudden cardiac death. J Cardiovasc Electrophysiol. (1997) 8(3):32531. 10.1111/j.1540-8167.1997.tb00796.x

  • 5.

    WangQLiZShenJKeatingMT. Genomic organization of the human SCN5A gene encoding the cardiac sodium channel. Genomics. (1996) 34(1):916. 10.1006/geno.1996.0236

  • 6.

    KapplingerJDTesterDJAldersMBenitoBBerthetMBrugadaJet alAn international compendium of mutations in the SCN5A-encoded cardiac sodium channel in patients referred for brugada syndrome genetic testing. Heart Rhythm. (2010) 7(1):3346. 10.1016/j.hrthm.2009.09.069

  • 7.

    ZengZZhouJHouYLiangXZhangZXuXet alElectrophysiological characteristics of a SCN5A voltage sensors mutation R1629Q associated with brugada syndrome. PLoS One. (2013) 8(10):e78382. 10.1371/journal.pone.0078382

  • 8.

    ZimmerTSurberR. SCN5A Channelopathies–an update on mutations and mechanisms. Prog Biophys Mol Biol. (2008) 98(2-3):12036. 10.1016/j.pbiomolbio.2008.10.005

  • 9.

    AizawaTMakiyamaTHuangHImamuraTFukuyamaMSonodaKet alSCN5A Variant type-dependent risk prediction in brugada syndrome. Europace. (2025) 27(2). 10.1093/europace/euaf024

  • 10.

    AkaiJMakitaNSakuradaHShiraiNUedaKKitabatakeAet alA novel SCN5A mutation associated with idiopathic ventricular fibrillation without typical ECG findings of brugada syndrome. FEBS Lett. (2000) 479(1-2):2934. 10.1016/S0014-5793(00)01875-5

  • 11.

    BensonDWWangDWDymentMKnilansTKFishFAStrieperMJet alCongenital sick sinus syndrome caused by recessive mutations in the cardiac sodium channel gene (SCN5A). J Clin Invest. (2003) 112(7):101928. 10.1172/JCI200318062

  • 12.

    IshikawaTKimotoHMishimaHYamagataKOgataSAizawaYet alFunctionally validated SCN5A variants allow interpretation of pathogenicity and prediction of lethal events in brugada syndrome. Eur Heart J. (2021) 42(29):285463. 10.1093/eurheartj/ehab254

  • 13.

    SandorfiGClemensBCsanadiZ. Electrical storm in the brain and in the heart: epilepsy and brugada syndrome. Mayo Clin Proc. (2013) 88(10):116773. 10.1016/j.mayocp.2013.06.019

  • 14.

    O'NeillMJMuhammadALiBWadaYHallLSolusJFet alDominant negative effects of SCN5A missense variants. Genet Med. (2022) 24(6):123848. 10.1016/j.gim.2022.02.010

  • 15.

    NeherE. Correction for liquid junction potentials in patch clamp experiments. Methods Enzymol. (1992) 207:12331. 10.1016/0076-6879(92)07008-C

  • 16.

    KellerDIRougierJSKuceraJPBenammarNFressartVGuicheneyPet alBrugada syndrome and fever: genetic and molecular characterization of patients carrying SCN5A mutations. Cardiovasc Res. (2005) 67(3):5109. 10.1016/j.cardiores.2005.03.024

  • 17.

    LiZJinXWuTZhaoXWangWLeiJet alStructure of human na(v)1.5 reveals the fast inactivation-related segments as a mutational hotspot for the long QT syndrome. Proc Natl Acad Sci U S A. (2021) 118(11):e2015505118. 10.1073/pnas.2100069118

  • 18.

    MengECGoddardTDPettersenEFCouchGSPearsonZJMorrisJHet alUCSF Chimerax: tools for structure building and analysis. Protein Sci. (2023) 32(11):e4792. 10.1002/pro.4792

  • 19.

    LaskowskiRASwindellsMB. Ligplot+: multiple ligand-protein interaction diagrams for drug discovery. J Chem Inf Model. (2011) 51(10):277886. 10.1021/ci200227u

  • 20.

    StensonPDMortMBallEVChapmanMEvansKAzevedoLet alThe human gene mutation database (HGMD(®)): optimizing its use in a clinical diagnostic or research setting. Hum Genet. (2020) 139(10):1197207. 10.1007/s00439-020-02199-3

  • 21.

    YamagataKHorieMAibaTOgawaSAizawaYOheTet alGenotype-Phenotype correlation of SCN5A mutation for the clinical and electrocardiographic characteristics of probands with brugada syndrome: a Japanese multicenter registry. Circulation. (2017) 135(23):225570. 10.1161/CIRCULATIONAHA.117.027983

  • 22.

    LalikPHKrafteDSVolbergWACiccarelliRB. Characterization of endogenous sodium channel gene expressed in Chinese hamster ovary cells. Am J Physiol. (1993) 264(4 Pt 1):C8039. 10.1152/ajpcell.1993.264.4.C803

  • 23.

    GellensMEGeorgeALJrChenLQChahineMHornRBarchiRLet alPrimary structure and functional expression of the human cardiac tetrodotoxin-insensitive voltage-dependent sodium channel. Proc Natl Acad Sci U S A. (1992) 89(2):5548. 10.1073/pnas.89.2.554

  • 24.

    LeeCHRubenPC. Interaction between voltage-gated sodium channels and the neurotoxin, tetrodotoxin. Channels (Austin, Tex). (2008) 2(6):40712. 10.4161/chan.2.6.7429

  • 25.

    VeltmannCWolpertCSacherFMaboPSchimpfRStreitnerFet alResponse to intravenous ajmaline: a retrospective analysis of 677 ajmaline challenges. Europace. (2009) 11(10):134552. 10.1093/europace/eup189

  • 26.

    AntzelevitchCBrugadaPBorggrefeMBrugadaJBrugadaRCorradoDet alBrugada syndrome: report of the second consensus conference. Heart Rhythm. (2005) 2(4):42940. 10.1016/j.hrthm.2005.01.005

  • 27.

    YanGXAntzelevitchC. Cellular basis for the brugada syndrome and other mechanisms of arrhythmogenesis associated with ST-segment elevation. Circulation. (1999) 100(15):16606. 10.1161/01.CIR.100.15.1660

  • 28.

    ZhangYWangTMaAZhouXGuiJWanHet alCorrelations between clinical and physiological consequences of the novel mutation R878C in a highly conserved pore residue in the cardiac na+ channel. Acta physiologica (Oxford. England. (2008) 194(4):31123. 10.1111/j.1748-1716.2008.01883.x

  • 29.

    Martinez-MorenoRCarrerasDSarquella-BrugadaGPerezGJSelgaEScornikFSet alLoss of sodium current caused by a brugada syndrome-associated variant is determined by patient-specific genetic background. Heart Rhythm. (2024) 21(3):3319. 10.1016/j.hrthm.2023.11.019

  • 30.

    TanBYYongRYBarajas-MartinezHDumaineRChewYXWasanPSet alA brugada syndrome proband with compound heterozygote SCN5A mutations identified from a Chinese family in Singapore. Europace. (2016) 18(6):897904. 10.1093/europace/euv058

  • 31.

    NakajimaTDharmawanTKawabata-IwakawaRTamuraSHasegawaHKobariTet alReduced current density, partially rescued by mexiletine, and depolarizing shift in activation of SCN5A W374G channels as a cause of severe form of brugada syndrome. Ann Noninvasive Electrocardiol. (2021) 26(3):e12828. 10.1111/anec.12828

  • 32.

    ZimmerTBiskupCDugarmaaSVogelFSteinbisMBohleTet alFunctional expression of GFP-linked human heart sodium channel (hH1) and subcellular localization of the a subunit in HEK293 cells and dog cardiac myocytes. J Membr Biol. (2002) 186(1):112. 10.1007/s00232-001-0130-1

  • 33.

    ViswanathanPCBalserJR. Inherited sodium channelopathies: a continuum of channel dysfunction. Trends Cardiovasc Med. (2004) 14(1):2835. 10.1016/j.tcm.2003.10.001

  • 34.

    TanHLBezzinaCRSmitsJPVerkerkAOWildeAA. Genetic control of sodium channel function. Cardiovasc Res. (2003) 57(4):96173. 10.1016/S0008-6363(02)00714-9

  • 35.

    RichardsKLMilliganCJRichardsonRJJancovskiNGrunnetMJacobsonLHet alSelective na(V)1.1 activation rescues dravet syndrome mice from seizures and premature death. Proc Natl Acad Sci U S A. (2018) 115(34):E8077E85. 10.1073/pnas.1804764115

  • 36.

    GhovanlooMRAtallahJEscuderoCARubenPC. Biophysical characterization of a novel SCN5A mutation associated with an atypical phenotype of atrial and ventricular arrhythmias and sudden death. Front Physiol. (2020) 11:610436. 10.3389/fphys.2020.610436

  • 37.

    MakiyamaTAkaoMTsujiKDoiTOhnoSTakenakaKet alHigh risk for bradyarrhythmic complications in patients with brugada syndrome caused by SCN5A gene mutations. J Am Coll Cardiol. (2005) 46(11):21006. 10.1016/j.jacc.2005.08.043

  • 38.

    ClatotJA-OZhengYGirardeauALiuHLauritaKRMarionneauCet alMutant voltage-gated na(+) channels can exert a dominant negative effect through coupled gating. Am J Physiol Heart Circ Physiol. (2018) 315(5):H12507. 10.1152/ajpheart.00721.2017

  • 39.

    BrugadaJBrugadaRBrugadaP. Determinants of sudden cardiac death in individuals with the electrocardiographic pattern of brugada syndrome and no previous cardiac arrest. Circulation. (2003) 108(25):30926. 10.1161/01.CIR.0000104568.13957.4F

  • 40.

    BiswasRLopez-SerranoALPurohitARamirez-NavarroAHuangHLGrandinettiGet alStructural basis of human na(v)1.5 gating mechanisms. Proc Natl Acad Sci U S A. (2025) 122(20):e2416181122. 10.1073/pnas.2416181122

  • 41.

    PostemaPGvan DesselPFde BakkerJMDekkerLRLinnenbankACHoogendijkMGet alSlow and discontinuous conduction conspire in brugada syndrome: a right ventricular mapping and stimulation study. Circulation Arrhythmia and Electrophysiology. (2008) 1(5):37986. 10.1161/CIRCEP.108.790543

  • 42.

    AhangarAAElhanafyEBlantonHLiJ. Mapping structural distribution and gating-property impacts of disease-associated missense mutations in voltage-gated sodium channels. iScience. (2023) 27:110678. 10.1016/j.isci.2024.110678

  • 43.

    NilssonJPerssonBvon HeijneG. Comparative analysis of amino acid distributions in integral membrane proteins from 107 genomes. Proteins. (2005) 60(4):60616. 10.1002/prot.20583

  • 44.

    SchmidtDJiangQXMacKinnonR. Phospholipids and the origin of cationic gating charges in voltage sensors. Nature. (2006) 444(7120):7759. 10.1038/nature05416

  • 45.

    ShaoDOkuseKDjamgozMB. Protein-protein interactions involving voltage-gated sodium channels: post-translational regulation, intracellular trafficking and functional expression. Int J Biochem Cell Biol. (2009) 41(7):147181. 10.1016/j.biocel.2009.01.016

  • 46.

    CoronelRCasiniSKoopmannTTWilms-SchopmanFJVerkerkAOde GrootJRet alRight ventricular fibrosis and conduction delay in a patient with clinical signs of brugada syndrome: a combined electrophysiological, genetic, histopathologic, and computational study. Circulation. (2005) 112(18):276977. 10.1161/CIRCULATIONAHA.105.532614

Summary

Keywords

arginine, Brugada syndrome, DTT reagent, gating, loss-of-function

Citation

Gaal S, Meszaros B, Volko J, Bilakovics N, Naseem MU, Pethő Z, Sandorfi G, Menko G, Voros O, Balogh I, Panyi G, Csanadi Z and Szanto TG (2026) Characterization of the R893C NaV1.5 mutation in Brugada syndrome. Front. Cardiovasc. Med. 13:1726536. doi: 10.3389/fcvm.2026.1726536

Received

16 October 2025

Revised

28 January 2026

Accepted

04 February 2026

Published

19 February 2026

Volume

13 - 2026

Edited by

Luca Esposito, Institut Cardiovasculaire Paris Sud, France

Reviewed by

Deni Kukavica, University of Pavia, Italy

Irene Paula Popa, Grigore T. Popa University of Medicine and Pharmacy, Romania

Updates

Copyright

*Correspondence: Tibor G. Szanto

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics