ORIGINAL RESEARCH article

Front. Microbiol., 02 September 2019

Sec. Plant Pathogen Interactions

Volume 10 - 2019 | https://doi.org/10.3389/fmicb.2019.01936

High Genetic Diversity and Species Complexity of Diaporthe Associated With Grapevine Dieback in China

  • 1. Beijing Key Laboratory of Environment Friendly Management on Fruit Diseases and Pests in North China, Institute of Plant and Environment Protection, Beijing Academy of Agriculture and Forestry Sciences, Beijing, China

  • 2. Center of Excellence in Fungal Research, Mae Fah Luang University, Mueang Chiang Rai, Thailand

  • 3. Center for Bioinformatics, School of Life Science and Technology, University of Electronic Science and Technology of China, Chengdu, China

  • 4. Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Science, Kunming, China

  • 5. Department of Biology, McMaster University, Hamilton, ON, Canada

  • 6. College of Plant Protection, China Agricultural University, Beijing, China

Article metrics

View details

94

Citations

12,8k

Views

5,4k

Downloads

Abstract

Grapevine trunk diseases have become one of the main threats to grape production worldwide, with Diaporthe species as an emerging group of pathogens in China. At present, relatively little is known about the taxonomy and genetic diversity of Chinese Diaporthe populations, including their relationships to other populations worldwide. Here, we conducted an extensive field survey in six provinces in China to identify and characterize Diaporthe species in grape vineyards. Ninety-four isolates were identified and analyzed using multi-locus phylogeny. The isolates belonged to eight species, including three novel taxa, Diaporthe guangxiensis (D. guangxiensis), Diaporthe hubeiensis (D. hubeiensis), Diaporthe viniferae (D. viniferae), and three new host records, Diaporthe gulyae (D. gulyae), Diaporthe pescicola (D. pescicola), and Diaporthe unshiuensis (D. unshiuensis). The most commonly isolated species was Diaporthe eres (D. eres). In addition, high genetic diversity was observed for D. eres in Chinese vineyards. Haplotype network analysis of D. eres isolates from China and Europe showed a close relationship between samples from the two geographical locations and evidence for recombination. In comparative pathogenicity testing, D. gulyae was the most aggressive taxon, whereas D. hubeiensis was the least aggressive. This study provides new insights into the Diaporthe species associated with grapevines in China, and our results can be used to develop effective disease management strategies.

Introduction

In natural ecosystems, plant pathogens play important roles such as regulating host populations and host plant geographic and ecological distributions. Consequently, they can affect the availability of food sources to other living organisms (Lindahl and Grace, 2015). Most microbial pathogens have short generation times and large population sizes, which can result in high genetic variations and rapid adaptations to environmental stresses and to human-mediated factors such as fungicide resistance (Alberts et al., 2002; Lindahl and Grace, 2015). Hence, it is important to understand the genetic diversity and population variation of plant pathogens to develop sustainable control measures.

Grape is one of the most important fruit crops in China. China is the second largest grape-cultivating country and the top producer in the world (OIV, 2016). In 2016, the total grape cultivation area was estimated at 847 kha, and 14.5 million metric tons of fresh grapes were produced in China (OIV, 2016). Therefore, infectious diseases with significant risks to grape production have drawn broad attention from the grapevine industry. Grapevines are affected by several foliar diseases (Gadoury et al., 2012; Zhang et al., 2017), fruit diseases (Daykin and Milholland, 1984; Hong et al., 2008; Greer et al., 2011; Jayawardena et al., 2015), and trunk diseases (Yan et al., 2013; Dissanayake et al., 2015a,b). Grapevine trunk diseases have drawn considerable attention, as these diseases affect the perennial parts of the vine and can limit grape production for many years (Yan et al., 2013, 2015).

The genus Diaporthe Nitschke., belongs to the family Diaporthaceae, and is typified by Diaporthe eres (D. eres) Nitschke (Senanayake et al., 2017). Following the nomenclature rules Rossman et al. (2014) proposed that the genus name Diaporthe over Phomopsis as it was introduced first, represents the majority of species. In earlier species names were given to Diaporthe taxa based on their host specificity. This resulted in over 100 names listed under the genus Diaporthe (http://www.indexfungorum.org/Names/Names.asp and http://www.mycobank.org). With advances in molecular techniques, multi-locus DNA sequence data together with morphological characteristics have been extensively used for the delimitation of Diaporthe species (Udayanga et al., 2011; Gomes et al., 2013; Gao et al., 2017). The internal transcribed spacer (ITS), translation elongation factor-1a (EF-1α), β-tubulin, partial histone H3 (HIS), calmodulin (CAL), genes are the most commonly used gene regions for molecular characterization (Udayanga et al., 2011; Gao et al., 2017; Guarnaccia et al., 2018; Yang et al., 2018). Multiple studies have used different gene combinations to resolve the species boundaries in this genus (Udayanga et al., 2011, 2014a,b; Gao et al., 2017; Marin-Felix et al., 2019). Species belonging to genus Diaporthe are endophytes, pathogenic, and saprobic on wide range of hosts worldwide (Liu et al., 2015; Hyde et al., 2016; Marin-Felix et al., 2019). They are well-known pathogens on economically important crops (Udayanga et al., 2011). Several common disease among those are dieback on forest trees (Yang et al., 2018), leaf spots on tea (Guarnaccia and Crous, 2017), leaf and pod blights and seed decay on soybean (Udayanga et al., 2015), melanose, stem-end rot, and gummosis on Citrus spp. (Mondal et al., 2007; Udayanga et al., 2014a; Guarnaccia and Crous, 2017, 2018) and stem canker on sunflower (Muntañola-Cvetković et al., 1981; Thompson et al., 2011).

Phomopsis cane and leaf spot caused by Diaporthe species on grapevine is one of the most complex grapevine trunk diseases worldwide (Úrbez-Torres et al., 2013; Dissanayake et al., 2015a; Guarnaccia et al., 2018). The disease symptoms of Diaporthe Dieback include shoots breaking off at the base, stunting, dieback, loss of vigor, reduced bunch set, and fruit rot (Pine, 1958, 1959; Pscheidt and Pearson, 1989; Pearson and Goheen, 1994; Wilcox et al., 2015). In woods brown to black necrotic irregular-shaped lesions could be observed. Once clusters are infected rachis necrosis and brown, shriveled berries close to harvest could be observed (Pearson and Goheen, 1994). More than one Diaporthe species is frequently reported as causative agents from one country (Dissanayake et al., 2015a; Guarnaccia et al., 2018). Currently, 27 species have been identified as causal organisms of Diaporthe dieback in grape-producing countries worldwide (Mostert et al., 2001; Van Niekerk et al., 2005; Udayanga et al., 2011, 2014a,b; White et al., 2011; Baumgartner et al., 2013; Úrbez-Torres et al., 2013; Hyde et al., 2014; Dissanayake et al., 2015a; Guarnaccia et al., 2018; Lesuthu et al., 2019). Even though these species characterized under the one disease, disease symptoms, and aggressiveness are varying according to the species. Diaporthe ampelina (D. ampelina) has a long history as the most common and severe pathogenic species together with D. amygdali (Mostert et al., 2001; Van Niekerk et al., 2005). Diaporthe ampelina and Diaporthe kyushuensis (D. kyushuensis) are the causal agent of grapevine swelling arm (Kajitani and Kanematsu, 2000; Van Niekerk et al., 2005). Diaporthe perjuncta (D. perjuncta) and D. ampelina caused cane bleaching (Kuo and Leu, 1998; Kajitani and Kanematsu, 2000; Mostert et al., 2001; Van Niekerk et al., 2005; Rawnsley et al., 2006). Lesuthu et al. (2019) showed that D. ampelina, Diaporthe novem (D. novem), and Diaporthe nebulae (D. nebulae) as the most virulent species of Diaporthe associated with grapevines in South Africa. Diaporthe eres was found as a weak to moderate pathogen in several different studies (Kaliterna et al., 2012; Baumgartner et al., 2013). These results indicate the complexity and high species richness of Diaporthe associated with the grapevines. Up to now in China four Diaporthe species have been reported causing grapevine dieback (Dissanayake et al., 2015a). Those are D. eres, Diaporthe hongkongensis (D. hongkongensis), Diaporthe phaseolorum (D. phaseolorum), and Diaporthe sojae (D. sojae). Their taxonomic placements and pathogenicity under a controlled environment were also studied.

The study conducted by Guarnaccia et al. (2018) showed that species of Diaporthe also associated as endophytes on grapes as well. In that study they observed that Diaporthe bohemiae (D. bohemiae), which was isolated from grape was unable to induce lesions. In addition to grapevines, Diaporthe have been reported on broad range of hosts (Udayanga et al., 2011). However, the most important charter is the ability of endophytic Diaporthe species to be opportunistic pathogens. Huang et al. (2015) observed that some Diaporthe species associated with citrus in China shown to act as opportunistic plant pathogens. Diaporthe foeniculina (D. foeniculina) has been found as both endophyte and opportunistic pathogen on various herbaceous weeds, ornamentals, and fruit trees (Udayanga et al., 2014a; Guarnaccia et al., 2016). So far it is not confirmed the factor that driven into pathogenicity from endophytes either due to environmental changes or the reduction of host's defense. Therefore, further studies are required to understand this in both field level and genomic level.

However, the genetic diversity of Diaporthe spp. associated with Vitis spp., relationships among isolates from different geographical regions, and relationships among isolates from China and those from other countries were not investigated. Therefore, to expand our knowledge on these issues, we performed an extensive field survey to isolate and identify Diaporthe species associated with grapevine dieback in China. We reconstructed a phylogenetic tree for the genus Diaporthe. The present study analyzed the genetic diversity of Diaporthe species associated with grapevines in China and constructed haplotype networks for Diaporthe species from different geographical origins for the first time. Finally, we analyzed the relationship between Diaporthe species from European and Chinese grape vineyards, as Diaporthe dieback is becoming an emerging trunk disease in both regions (Guarnaccia et al., 2018).

Materials and Methods

Sampling and Pathogen Isolation

Field surveys were conducted during 2014 and 2015 in 20 vineyards in the six following provinces in China: Guangxi, Heilongjiang, Hubei, Jilin, Liaoning, and Sichuan (Figure 1). Samples were collected from symptomatic grapevine woody branches that exhibited bark discoloration, shoots breaking off at the base, stunting, wedge-shaped cankers, and light brown streaking of the wood from the following Vitis vinifera (V. vinifera) cultivars: Centennial Seedless, Red Globe, and Summer Black (Figure 2). Symptomatic tissue samples were collected into zip-lock plastic bags that contained wet sterilized tissue papers to maintain humidity. Once the samples were taken into the laboratory, infected trunks or shoots were photographed, and symptoms, location, and other relevant data were documented. The fungal pathogens were isolated using the following procedures. Infected shoots/trunks were cut into small pieces (1–3 mm thick). These pieces were then surface-sterilized by dipping into 70% ethanol for 30 s and then transferred into 1% NaOCl for 1 min. This step was followed by two washes with sterile distilled water. Once the wood pieces were dried, they were placed onto potato dextrose agar (PDA) plates supplemented with ampicillin (0.1 g L−1) and incubated at 25°C. After 5–7 days of incubation, hyphal tips of fungi immerging from wood pieces were transferred onto new PDA plates and incubated until they produce conidia. Once the conidia were developed single spore isolation was done. For the strains do not developed conidia after 4 weeks two-three times hyphal tip isolation was done. All the pure cultures obtained in this study were deposited in the culture collection of Institute of Plant and Environment Protection of Beijing Academy of Agriculture and Forestry Sciences (JZB culture collection) at 4°C.

Figure 1

Figure 2

DNA Extraction, PCR Amplification, and Sequence Assembly

Approximately 10 mg of aerial mycelium was scraped from 5–7 days old isolates grown on PDA (Potato Dextrose Agar) at 25°C. Total genomic DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN GmbH, QIAGEN Strasse 1, 40742 Hilden, Germany). For species confirmation, the internal transcribed spacer (ITS) regions were sequenced for all isolates. The obtained sequences were compared to those in GenBank using the MegaBLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). After isolates were confirmed as belonging to the genus Diaporthe, six additional gene regions, those encoding translation elongation factor-1α (EF-1α), β-tubulin, calmodulin (CAL), partial histone H3 (HIS), partial actin (ACT), and DNA-lyase (Apn2), were sequenced. Table 1 presents the primer pairs with their respective amplification conditions for each of the above gene regions. PCR mixtures of 25 μl total volume consisted of 0.3 μl of TaKaRa Ex-Taq DNA polymerase, 2.5 μl of 10 × Ex-Taq DNA polymerase buffer, 3.0 μl of dNTPs, 2 μl of genomic DNA, 1 μl of each primer, and 15.2 ddH2O. The PCRs were conducted in a Bio-Rad C1000 thermal cycler (Germany). The resulting products were visualized on a 1% agarose gel stained with ethidium bromide under UV light using a Gel DocTM XR Molecular Imager (Bio Rad, USA). All positive amplicons were sequenced by Beijing Biomed Gene Technology Co LTD. The sequence quality was confirmed by checking chromatograms using BioEdit v. 5 (Hall, 2006). Sequences were obtained using both forward and reverse primers, and consensus sequences were generated using DNAStar v. 5.1 (DNASTAR, Inc.). The sequence data generated in the present study have been deposited in GenBank (Table 2).

Table 1

Gene regionPrimersSequence 5′-3′Optimized PCR protocolsReferences
ACTACT-512FATGTGCAAGGCCGGTTTCGC95°C: 5 min, (95°C: 30 s, 55°C: 50 s,72°C: 1 min)
× 39 cycles 72°C: 10 min
Carbone and Kohn, 1999
ACT-783RTACGAGTCCTTCTGGCCCAT
Apn2 (DNA lyaseapn2fw2GCMATGTTYGAMATYCTGGAG94°C: 1 min, (95°C: 30 s, 54°C: 50 s, 72°C: 1 min)
× 39 cycles 72°C: 10 min
Udayanga et al., 2012a,b
apn2rw2CTT GGTCTCCCAGCAGGTG AAC
CALCAL-228FGAGTTCAAGGAGGCCTTCTCCC95°C: 5 min, (95°C: 30 s, 55°C: 50 s, 72°C: 1 min)
× 34 cycles 72°C: 10 min
Carbone and Kohn, 1999
CAL-737RCATCTTCTGGCCATCATGG
EF1-αEF1-728FCATCGAGAAGTTCGAGAAGG95°C: 5 min, (95°C: 30 s, 58°C: 30 s, 72°C: 1 min)
× 34 cycles 72°C: 10 min
Carbone and Kohn, 1999
EF1-986RTACTTGAAGGAACCCTTACCUdayanga et al., 2012a,b
HISCYLH3FAGGTCC ACTGGTGGCAAG96°C: 5 min, (96°C: 30 s, 58°C: 50 s, 72°C: 1 min)
× 30 cycles 72°C: 5 min
Crous et al., 2004
H3-1bGCGGGCGAGCTGGATGTCCTTGlass and Donaldson, 1995
ITSITS1TCCGTAGGTGAACCTGCGG94°C: 5 min, (94°C: 30 s, 55°C: 50 s, 72°C: 1 min)
× 34 cycles 72°C: 10 min
White et al., 1990
ITS4TCCTCCGCTTATTGATATGCUdayanga et al., 2012a,b
β-tubulinBT2aGGTAACCAAATCGGTGCTGCTTTC94°C: 5 min, (94°C: 30 s, 58°C: 50 s, 72°C: 1 min)
× 34 cycles 72°C: 10 min
Glass and Donaldson, 1995
Bt2bACCCTCAGTGTAGTGACCCTTGGCUdayanga et al., 2012a,b

Gene regions and respective primer pairs used in the study.

Table 2

NoSpeciesLocationYearJZB numberSequence data
ITSβ-tubulinCALEF-1α
01Diaporthe eresSichuan2015JZB320020*MK500169MK500062MK523586
02Sichuan2015JZB320021*MK335710MK500170MK500063MK523587
03Sichuan2015JZB320022*MK335711MK500171MK500064MK523588
04Sichuan2015JZB320023*MK335712MK500172MK500065MK523589
05Sichuan2015JZB320024*MK335713MK500173MK500066
06Sichuan2015JZB320026MK335714MK500174MK500067MK523591
07Sichuan2015JZB320027*MK335715MK500175MK500068MK523619
08Sichuan2015JZB320028*MK335716MK500176MK500069MK523592
09Sichuan2015JZB320029*MK335717MK500177MK500070MK523620
10Lioning2015JZB320030MK335718MK500178MK500071MK523621
11Hubei2015JZB320033*MK335719MK500179MK500072MK523622
12Hubei2015JZB320034*MK335720MK500180MK500073MK523623
13Hubei2015JZB320035*MK335721MK500181MK500074MK523593
14Hubei2015JZB320036*MK335722MK500182MK500075
15Hubei2015JZB320037*MK335723MK500183MK500076
16Hubei2015JZB320038*MK335724MK500184MK500077MK523594
17Hubei2015JZB320039*MK335725MK500185MK500078MK523595
18Hubei2015JZB320040*MK335726MK500186MK500079MK523596
19Hubei2015JZB320041*MK335727MK500187MK500080
20Hubei2015JZB320043*MK335728MK500188MK500081MK523624
21Hubei2015JZB320044*MK335729MK500189MK500082
22Hubei2015JZB320045*MK335730MK500083MK523597
23Hubei2015JZB320046*MK335731MK500190MK500084MK523598
24Hubei2015JZB320047MK335732MK500191MK500085
25Hubei2015JZB320048*MK335733MK500192MK500086MK523599
26Hubei2015JZB320049*MK335734MK500193MK500087MK523625
27Hubei2015JZB320051*MK335735MK500194MK500088MK523600
28Hubei2015JZB320052MK335736MK500195MK500089
29Heilongjiang2015JZB320053*MK335737MK500196MK500090MK523601
30Jilin2015JZB320054MK335738MK500197MK500091MK523602
31Jilin2015JZB320055*MK335739MK500198MK500092MK523617
32Jilin2015JZB320056*MK335740MK500199MK500093MK523618
33Jilin2015JZB320057*MK335741MK500200MK500094MK523603
34Jilin2015JZB320058*MK335742MK500201MK500095MK523604
35Jilin2015JZB320059*MK335743MK500202MK500096MK523605
36Jilin2015JZB320060MK335744MK500203MK500097MK523606
37Jilin2015JZB320061*MK335745MK500204MK500098MK523607
38Jilin2015JZB320062*MK335746MK500205MK500099MK523614
39Jilin2015JZB320063*MK335747MK500206MK500100MK523608
40Jilin2015JZB320064*MK335748MK500207MK500101MK523609
41Jilin2015JZB320065MK335749MK500208MK500102MK523615
42Jilin2015JZB320066MK335750MK500209MK500103MK523610
43Jilin2015JZB320067MK335751MK500210MK500104MK523611
44Jilin2015JZB320068*MK335752MK500211MK500105MK523612
45Jilin2015JZB320069*MK335753MK500212MK500106MK523616
46Jilin2015JZB320070*MK335754MK500213MK523613
47Diaporthe guangxiensisGuangxi2015JZB320082MK335760MK500156MK736715MK523557
48Guangxi2015JZB320083MK335761MK500157MK736716MK523558
49Guangxi2015JZB320084MK335762MK500158MK736717
50Guangxi2015JZB320085MK335763MK500159MK736718
51Guangxi2015JZB320086MK335764MK500160MK736719MK523559
52Guangxi2015JZB320087*MK335765MK500161MK736720MK523560
53Guangxi2015JZB320088MK335766MK500162MK736721MK523561
54Guangxi2015JZB320089MK335767MK500163MK736722MK523562
55Guangxi2015JZB320090MK335768MK500164MK736723MK523563
56Guangxi2015JZB320091*MK335769MK500165MK736724MK523564
57Guangxi2015JZB320092MK335770MK500166MK736725
58Guangxi2015JZB320093*MK335771MK500167MK736726MK523565
59Guangxi2015JZB320094*MK335772MK500168MK736727MK523566
60Diaporthe gulyaeHeilongjiang2015JZB320118KY400792KY400856KY400824
61Heilongjiang2015JZB320119KY400793KY400857KY400825
62Diaporthe hubeiensisHubei2015JZB320120MK335806MK500144MK500232MK523567
63Hubei2015JZB320121*MK335807MK500146MK500233MK523568
64Hubei2015JZB320122*MK335808MK500147MK500234MK523569
65Hubei2015JZB320123*MK335809MK500148MK500235MK523570
66Hubei2015JZB320124*MK335810MK500149MK500236MK523571
67Hubei2015JZB320125*MK335811MK500150MK500237
68Hubei2015JZB320126MK335812MK500151MK500238
69Hubei2015JZB320127*MK335813MK500152MK500239MK523572
70Hubei2015JZB320128*MK335814MK500153MK500240MK523573
71Hubei2015JZB320139*MK335815MK500154MK500241
72Hubei2015JZB320130MK335816MK500155MK500242
73Diaporthe pescicolaHubei2015JZB320095KY400784KY400890KY400817
74Hubei2015JZB320096KY400785KY400891KY400831
75Diaporthe sojaeSichuan2015JZB320097MK335826MK500126MK500214MK523574
76Hubei2015JZB320098MK335827MK500127MK500215MK523575
77Hubei2015JZB320099MK335828MK500128MK500216MK523576
78Hubei2015JZB320100MK335829MK500217
79Guangxi2015JZB320101MK335830MK500129MK500218MK523577
80Guangxi2015JZB320102MK335831MK500130MK500219MK523578
81Guangxi2015JZB320103MK335832MK500131MK500220MK523579
82Guangxi2015JZB320104MK335833MK500132MK500221MK523580
83Guangxi2015JZB320105MK335834MK500133MK500222
84Guangxi2015JZB320106MK335835MK500134MK500223
85Guangxi2015JZB320107MK335836MK500135MK500224
86Guangxi2015JZB320108MK335837MK500136MK500225MK523581
87Guangxi2015JZB320109MK335838MK500137MK500226MK523582
88Guangxi2015JZB320110MK335839MK500138MK500227
89Hubei2015JZB320111MK335840MK500139MK500228
90Hubei2015JZB320112MK335841MK500140MK500228MK523583
91Hubei2015JZB320113MK335842MK500141MK500230MK523584
92Hubei2015JZB320114MK335843MK500142MK500231MK523585
93Hubei2015JZB320115MK500143
94Diaporthe unshiuensisHubei2015JZB320116KY400790KY400854KY400822
95Hubei2015JZB320117KY400791KY400855KY400823
96Diaporthe viniferaeGuangxi2015JZB320071*MK341551MK500112MK500119MK500107
97Guangxi2015JZB320072MK341552MK500113MK500120MK500108
98Guangxi2015JZB320076*MK341553MK500115MK500122
99Guangxi2015JZB320077MK341554MK500116MK500123MK500109
100Guangxi2015JZB320078*MK341555MK500117MK500124MK500110
101Guangxi2015JZB320079*MK341556MK500118MK500125MK500111

Diaporthe species isolated and characterized in the present study.

JZB: Culture collection of Institute of Plant and Environment Protection, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, China. Ex-type cultures are indicated in bold. Isolates used in pathogenicity test are Italic. ITS, internal transcribed spacers 1 and 2 together with 5.8S nrDNA; β-tubulin, partial beta-tubulin gene; CAL, partial calmodulin gene; EF-1α, partial translation elongation factor 1-α gene.

*

Strains used in phylogenetic analysis (Figure 3).

Phylogenetic Analyses

For the phylogenetic analyses, reference sequences representing related taxa in Diaporthe were downloaded from GenBank (Guarnaccia et al., 2018; Yang et al., 2018; Table 3) and aligned with the sequences obtained in this study (Table 2). The sequences were aligned using MAFFT (Katoh and Toh, 2010) (http://www.ebi.ac.uk/Tools/msa/mafft/) and manually adjusted using BioEdit v. 5 (Hall, 2006) whenever necessary. Phylogenetic relationships were inferred using maximum parsimony (MP) implemented in PAUP (v4.0) (Swofford, 2003), maximum likelihood (ML) in RAxML (Silvestro and Michalak, 2010) and Bayesian analyses in MrBayes v. 3.0b4 (Ronquist and Huelsenbeck, 2003). In phylogenetic analysis, single-gene trees were constructed first using ML in RAxML. The phylogenetic tree topologies for different gene fragments were compared for evidence of incongruences with a focus on comparing branches with high bootstrap values. If no conflict was observed, a combined phylogenetic tree was generated.

Table 3

SpeciesIsolateHostLocationGenBank accession numbers
ITSβ-tubulinCALEF-1α
D. acaciarumCBS 138862Acacia tortilisTanzaniaKP004460KP004509N/AN/A
D. acaciigenaCBS 129521Acacia retinodesAustraliaKC343005KC343973KC343247KC343731
D. acericolaMFLUCC 17-0956Acer negundoItalyKY964224KY964074KY964137KY964180
D. acerigenaCFCC 52554Acer tataricumChinaMH121489N/AMH121413MH121531
CFCC 52555Acer tataricumChinaMH121490N/AMH121414MH121532
D. acutisporaCGMCC 3.18285Coff sp.ChinaKX986764KX999195KX999274KX999155
D. alangiiCFCC 52556Alangium kurziiChinaMH121491MH121573MH121415MH121533
D. alleghaniensisCBS 495.72Betula alleghaniensisCanadaKC343007KC343975KC343249KC343733
D. alneaCBS 146.46Alnussp.NetherlandsKC343008KC343976KC343250KC343734
D. ambiguaCBS 114015Pyrus communisSouth AfricaKC343010KC343978KC343252KC343736
D. ampelinaSTEU2660Vitis viniferaFranceAF230751JX275452AY745026AY745056
D. amygdaliCBS 115620Prunus persica.USAKC343020KC343988KC343262KC343746
CBS111811Vitis viniferaSouth AfricaKC343019KC343987KC343261KC343745
CBS120840Prunus salicinaSouth AfricaKC343021KC343989KC343263KC343747
CBS 126679Prunus dulcisPortugalKC343022KC343990KC343264KC343748
D. anacardiiCBS 720.97Anacardium occidentaleEast AfricaKC343024KC343992KC343266KC343750
D. angelicaeCBS 111592Heracleum sphondyliumAustriaKC343027KC343995KC343269KC343753
D. apiculateCGMCC 3 17533Camellia sinensisChinaKP267896KP293476N/AKP267970
LC3187Camellia sinensisChinaKP267866KP293446N/AKP267940
D. arengaeCBS 114979Arenga engleriHong KongKC343034KC344002KC343276KC343760
D. aquaticaIFRDCC 3051Aquatic habitatChinaJQ797437N/AN/AN/A
D. arctiiCBS 139280Arctium lappaAustriaKJ590736KJ610891KJ612133KJ590776
D. arengaeCBS 114979Arenga enngleriHong KongKC343034KC344002KC343276KC343760
D. aseanaMFLUCC 12-0299aUnknown dead leafThailandKT459414KT459432KT459464KT459448
D. asheicolaCBS 136967Vaccinium asheiChileKJ160562KJ160518KJ160542KJ160594
D. aspalathiCBS 117169Aspalathus linearisSouth AfricaKC343036KC344004KC343278KC343762
D. australafricanaCBS 111886Vitis viniferaAustraliaKC343038KC344006KC343280KC343764
D. baccaeCBS 136972Vacciniumsp.ItalyKJ160565N/AN/AKJ160597
D. batatasCBS 122.21Ipomoea batatasUSAKC343040KC344008KC343282KC343766
D. beilharziaeBRIP 54792Indigofera australisAustraliaJX862529KF170921N/AJX862535
D. benedictiBPI 893190Salix sp.USAKM669929N/AKM669862KM669785
D. betulaeCFCC 50469Betula platyphyllaChinaKT732950KT733020KT732997KT733016
D. betulicolaCFCC 51128Betula albo-sinensisChinaKX024653KX024657KX024659KX024655
CFCC 52560Betula albo- sinensisChinaMH121495MH121577MH121419MH121537
D. betulinaCFCC 52561Betula costataChinaMH121496MH121578MH121420MH121538
D. bicinctaCBS 121004Juglanssp.USAKC343134KC344102KC343376KC343860
D. biconisporaCGMCC 3.17252Citrus grandisChinaKJ490597KJ490418KJ490539KJ490476
D. biguttulataCFCC 52584Juglans regiaChinaMH121519MH121598MH121437MH121561
D. biguttusisCGMCC 317081Lithocarpus glabraChinaKF576282KF576306N/AKF576257
CGMCC 317081Lithocarpus glabraChinaKF576283KF576307N/AKF576258
D. bohemiaeCBS 1433477Vitis viniferaCzech RepublicMG281015MG281188MG281710MG281536
CBS 1433478Vitis viniferaCzech RepublicMG281016MG281189MG281711MG281537
D. brasiliensisCBS 133183Aspidosperma sp.BrazilKC343042KC344010KC343284KC343768
D. caatingaensisCBS 141542Tacinga inamoenaBrazilKY085927KY115600N/AKY115603
D. camptothecicolaCFCC 51632Camptotheca sp.ChinaKY203726KY228893KY228877KY228887
D. canthiiCBS 132533Canthium inermeSouth AfricaJX069864KC843230KC843174KC843120
D. caryaeCFCC 52563Carya illinoensisChinaMH121498MH121580MH121422MH121540
CFCC 52564Carya illinoensisChinaMH121499MH121581MH121423MH121541
D. cassinesCPC 21916Cassine peraguaSouth AfricaKF777155N/AN/AKF777244
D. caulivoraCBS 127268Glycine maxCroatiaKC343045KC344013KC343287KC343771
D. celerisCBS143349Vitis viniferaCzech RepublicMG281017MG281190MG281712MG281538
CBS143350Vitis viniferaCzech RepublicMG281018MG281191MG281713MG281539
D. celastrinaCBS 139.27Celastrussp.USAKC343047KC344015KC343289KC343773
D. cf nobilisCBS 113470Castanea sativaSouth KoreaKC343146KC344114KC343388KC343872
CBS 587 79Pinus pantepellaJapanKC343153KC344121KC343395KC343879
D. cercidisCFCC 52565Cercis chinensisChinaMH121500MH121582MH121424MH121542
D. chamaeropisCBS 454.81Chamaerops humilisGreeceKC343048KC344016KC343290KC343774
D. charlesworthiiBRIP 54884mRapistrum rugostrumAustraliaKJ197288KJ197268N/AKJ197250
D. chensiensisCFCC 52567Abies chensiensisChinaMH121502MH121584MH121426MH121544
CFCC 52568Abies chensiensisChinaMH121503MH121585MH121427MH121545
D. cichoriiMFLUCC 17-1023Cichorium intybusItalyKY964220KY964104KY964133KY964176
D. cinnamomiCFCC 52569Cinnamomum sp.ChinaMH121504MH121586N/AMH121546
D. cissampeliCBS 141331Cissampelos capensisSouth AfricaKX228273KX228384N/AN/A
D. citriCBS 135422Citrussp.Florida, USAKC843311KC843187KC843157KC843071
AR4469Citrus sp.Florida, USAKC843321KC843167KC843197KC843081
D. citriasianaCGMCC 3.15224Citrus unshiuChinaJQ954645KC357459KC357491JQ954663
D. citrichinensisZJUD34Citrussp.ChinaJQ954648N/AKC357494JQ954666
ZJUD85Citrus sp.ChinaKJ490620KJ490441N/AKJ490499
D. collarianaMFLU 17-2770Magnolia champacaThailandMG806115MG783041MG783042MG783040
D. compactaCGMCC 3.17536Camellia sinensisChinaKP267854KP293434N/AKP267928
D. conicaCFCC 52571Alangium chinenseChinaMH121506MH121588MH121428MH121548
D. convolvuliCBS 124654Convolvulus arvensisTurkeyKC343054KC344022KC343296KC343780
D. crotalariaeCBS 162.33Crotalaria spectabilisUSAKC343056KC344024KC343298KC343782
D. cucurbitaeCBS 136.25Arctium sp.UnknownKC343031KC343999KC343273KC343757
D. cuppateaCBS 117499Aspalathus linearisSouth AfricaKC343057KC344025KC343299KC343783
D. cynaroidisCBS 122676Protea cynaroidesSouth AfricaKC343058KC344026KC343300KC343784
D. cytosporellaFAU461Citrus limonItalyKC843307KC843221KC843141KC843116
D. diospyricolaCPC 21169Diospyros whyteanaSouth AfricaKF777156N/AN/AN/A
D. discoidisporaZJUD89Citrus unshiuChinaKJ490624KJ490445N/AKJ490503
D. dorycniiMFLUCC 17-1015Dorycnium hirsutumItalyKY964215KY964099N/AKY964171
D. elaeagni-glabraeCGMCC 3.18287Elaeagnus glabraChinaKX986779KX999212KX999281KX999171
D.ellipicolaCGMC 3 17084Lithocarpus glabraChinaKF576270KF576291N/AKF576245
D.endophyticaCBS133811Schinus terebinthifoliusBrazilKC343065KC343065KC343307KC343791
LGMF911Schinus terebinthifoliusBrazilKC343066KC344034KC343308KC343792
D.eresAR3519Corylus avellanaAustriaKJ210523KJ420789KJ435008KJ210547
CBS 109767 = AR3538Acer sp.AustriaDQ491514 KC344043KC343317 KC343801
AR3560Viburnum sp.AustriaJQ807425KJ420795KJ435011JQ807351
AR3723Rubus fruticosusAustriJQ807428 KJ420793KJ435024 JQ807354
AR4346Prunus mumeKoreaJQ807429KJ420823KJ435003JQ807355
AR4373Ziziphus jujubaKoreaJQ807442KJ420798KJ435013JQ807368
AR4348Prunus persicaKoreaJQ807431KJ420811KJ435004JQ807357
AR4363Malus sp.KoreaJQ807436KJ420809KJ435033JQ807362
AR4369Pyrus pyrifoliaKoreaJQ807440KJ420813KJ435005JQ807366
AR4371Malus pumilaKoreaJQ807441KJ420796KJ435034JQ807367
AR5193Ulmussp.GermanyKJ210529KJ420799KJ434999KJ210550
AR5197Rhododendron sp.GermanyKJ210531KJ420812KJ435014KJ210552
CBS113470Castanea sativaAustraliaKC343146KC344114KC343388KC343872
CBS135428Juglans cinereaUSAKC843328KC843229KC843155KC843121
CBS138594Ulmus laevisGermanyKJ210529KJ420799KJ434999KJ210550
CBS138595Ulmus laevisGermanyKJ210533KJ420817KJ435006KJ210554
CBS138597Vitis viniferaFranceKJ210518KJ420783KJ434996KJ210542
CBS138598Ulmus sp.USAKJ210521KJ420787KJ435027KJ210545
CBS138599Acer nugundoGermanyKJ210528KJ420830KJ435000KJ210549
CBS439.82Cotoneaster sp.UKFJ889450JX275437JX197429GQ250341
DNP128.1Castaneae mollissimaeChinaJF957786KJ420801KJ435040KJ210561
DNP129Castanea mollissimaChinaJQ619886KJ420800KJ435039KJ210560
DP0177Pyrus pyrifoliaNew ZealandJQ807450KJ420820KJ435041JQ807381
DP0179Pyrus pyrifoliaNew ZealandJQ807452KJ420803KJ43502JQ807383
DP0180Pyrus pyrifoliaNew ZealandJQ807453KJ420804KJ435029JQ807384
DP0438Ulmus minorAustriaKJ210532KJ420816KJ435016KJ210553
FAU506Cornus floridaUSAKJ210526KJ420792KJ435012JQ807403
DP0590Pyrus pyrifoliaNew ZealandJQ807464KJ420810KJ435037JQ807394
DP0591Pyrus pyrifoliaNew ZealandJQ807465KJ420821KJ435018JQ807395
DP0666Juglans cinereaUSAKJ210522KJ420788KJ435007KJ210546
FAU483Malus sp.NetherlandsKJ210537KJ420827KJ435022KJ210556
FAU522Sassafras albidumUSAKJ210525KJ420791KJ435010JQ807406
FAU532Chamaecyparis thyoidesUSAJQ807333KJ420815KJ435015JQ807408
LCM11401bUlmus sp.USAKJ210520KJ420786KJ435026KJ210544
LCM11401Ulmus sp.USAKJ210521KJ420787KJ435027KJ210545
M1118Vitis viniferaFranceKJ210519KJ420784KJ434997KJ210543
M1115Daphne laureolaFranceKJ210516KJ420781KJ434994KJ210540
MAFF625033Pyrus pyrifoliaJapanJQ807468KJ420814KJ435017JQ807417
MAFF625034Pyrus pyrifoliaJapanJQ807469KJ420819KJ435023JQ807418
D. eucalyptorumCBS 132525Eucalyptus sp.AustraliaNR120157N/AN/AN/A
D. foeniculaceaCBS 123208Foeniculum vulgarePortugalKC343104KC344072KC343346KC343830
D. fraxini- angustifoliaeBRIP 54781Fraxinus angustifoliaAustraliaJX862528KF170920N/AJX862534
D. fraxinicolaCFCC 52582Fraxinus chinensisChinaMH121517N/AMH121435MH121559
D. fukushiiMAFF 625034Pyrus pyrifoliaJapanJQ807469N/AN/AJQ807418
D. fusicolaCGMCC 3.17087Lithocarpus glabraChinaKF576281KF576305KF576233KF576256
D. ganjaeCBS 180.91Cannabis sativaUSAKC343112KC344080KC343354KC343838
D. garethjonesiiMFLUCC 12-0542aUnknown dead leafThailandKT459423KT459441KT459470KT459457
D. goulteriBRIP 55657aHelianthus annuusAustraliaKJ197290KJ197270N/AKJ197252
D. gulyaeBRIP 54025Helianthus annuusAustraliaJF431299JN645803N/AKJ197271
D. helianthiCBS 592.81Helianthus annuusSerbiaKC343115KC344083KC343357KC343841
D. helicisAR5211Hedera helixFranceKJ210538KJ420828KJ435043KJ210559
D. heterophyllaeCBS 143769Acacia heterohpyllaFranceMG600222MG600226MG600218MG600224
D. hickoriaeCBS 145.26Carya glabraUSAKC343118KC344086KC343360KC343844
D. hispaniaeCPC 30321Vitis viniferaSpainMG281123MG281296MG281820MG281644
D. hongkongensisCBS 115448Dichroa febrífugaChinaKC343119KC344087KC343361KC343845
D.hungariaeCBS143353Vitis viniferaHungaryMG281126MG281299MG281823MG281647
D. incompletaCGMCC 3.18288Camellia sinensisChinaKX986794KX999226KX999289KX999186
D. inconspicuaCBS 133813Maytenus ilicifoliaBrazilKC343123KC344091KC343365KC343849
D. infecundaCBS 133812Schinus sp.BrazilKC343126KC344094KC343368KC343852
D. isoberliniaeCPC 22549Isoberlinia angolensisZambiaKJ869133KJ869245N/AN/A
CFCC 51135Juglans mandshuricaChinaKU985102KX024635KX024617KX024629
D. kadsuraeCFCC 52587Kadsura longipedunculataChinaMH121522MH121601MH121440MH121564
D. kochmaniiBRIP 54033Helianthus annuusAustraliaJF431295N/AN/AJN645809
D. kochmaniiBRIP 54034Helianthus annuusAustraliaJF431296N/AN/AJN645810
D. kongiiBRIP 54031Portulaca grandifl aAustraliaJF431301KJ197272N/AJN645797
D. litchicolaBRIP 54900Litchi chinensisAustraliaJX862533KF170925N/AJX862539
D. lithocarpusCGMCC 3.15175Lithocarpus glabraChinaKC153104KF576311KF576235KC153095
D. longicicolaCGMCC 3.17089Lithocarpus glabraChinaKF576267KF576291N/AKF576242
CGMCC 3 17090Lithocarpus glabraChinaKF576268KF576292N/AKF576243
D. longisporaCBS 194.36Ribes sp.CanadaKC343135KC344103KC343377KC343861
D. loniceraeMFLUCC 17-0963Lonicera sp.ItalyKY964190KY964073KY964116KY964146
D. lusitanicaeCBS 123212Foeniculum vulgarePortugalKC343136KC344104KC343378KC343862
D. macinthoshiiBRIP 55064aRapistrum rugostrumAustraliaKJ197289KJ197269N/AKJ197251
D. mahothocarpusCGMCC 3.15181Lithocarpus glabraChinaKC153096KF576312N/AKC153087
D. malorumCAA734Malus domesticaPortugalKY435638KY435668KY435658KY435627
D.momicolaMFLUCC 16-0113Prunus persicaHubei, ChinaKU557563KU557587KU557611KU557631
D. maritimaDAOMC 250563Picea rubensCanadaN/AKU574616N/AN/A
D. masireviciiBRIP 57892aHelianthus annuusAustraliaKJ197277KJ197257N/AKJ197239
D. mayteniCBS 133185Maytenus ilicifoliaBrazilKC343139KC344107KC343381KC343865
D. maytenicolaCPC 21896Maytenus acuminataSouth AfricaKF777157KF777250N/AN/A
D. melonisCBS 507.78Cucumis meloUSAKC343142KC344110KC343384KC343868
D. middletoniiBRIP 54884eRapistrum rugostrumAustraliaKJ197286KJ197266N/AKJ197248
D. miriciaeBRIP 54736jHelianthus annuusAustraliaKJ197282KJ197262N/AKJ197244
D. multigutullataZJUD98Citrus grandisChinaKJ490633KJ490454N/AKJ490512
D. musigenaCBS 129519Musa sp.AustraliaKC343143KC344111KC343385KC343869
D. neilliaeCBS 144.27Spiraea sp.USAKC343144KC344112KC343386KC343870
D. neoarctiiCBS 109490Ambrosia trifiUSAKC343145KC344113KC343387KC343871
D.neoraonikayaporumMFLUCC 14-1136Tectona grandisThailandKU712449KU743988KU749356KU749369
D. nobilisCBS 113470Castanea sativaKoreaKC343146KC344114KC343388KC343872
D. nothofagiBRIP 54801Nothofagus cunninghamiiAustraliaJX862530KF170922N/AJX862536
D. novemCBS 127270Glycine maxCroatiaKC343155KC344123KC343397KC343881
D. ocoteaeCBS 141330Ocotea obtusataFranceKX228293KX228388N/AN/A
D. oracciniiCGMCC 3.17531Camellia sinensisChinaKP267863KP293443N/AKP267937
D. ovalisporaICMP20659Citrus limonChinaKJ490628KJ490449N/AKJ490507
D. ovoicicolaCGMCC 3.17093Citrus sp.ChinaKF576265KF576289KF576223KF576240
D. oxeCBS 133186Maytenus ilicifoliaBrazilKC343164KC344132KC343406KC343890
D. padinaCFCC 52590Padus racemosaChinaMH121525MH121604MH121443MH121567
CFCC 52591Padus racemosaChinaMH121526MH121605MH121444MH121568
D. pandanicolaMFLU 18-0006Pandanus sp.ThailandMG646974MG646930N/AN/A
D. paranensisCBS 133184Maytenus ilicifoliaBrazilKC343171KC344139KC343413KC343897
D. parapterocarpiCPC 22729Pterocarpus brenaniiZambiaKJ869138KJ869248N/AN/A
D. pascoeiBRIP 54847Persea americanaAustraliaJX862532KF170924N/AJX862538
D. passifl aeCBS 132527Passifl a edulisSouth AmericaJX069860N/AN/AN/A
D. passiflCBS 141329Passifl a foetidaMalaysiaKX228292KX228387N/AN/A
D. penetriteumCGMCC 3.17532Camellia sinensisChinaKP714505KP714529N/AKP714517
D. perjunctaCBS 109745Ulmus glabraAustriaKC343172KC344140KC343414KC343898
D. perseaeCBS 151.73Persea gratissimaNetherlandsKC343173KC344141KC343415KC343899
D. pescicolaMFLU 16-0105Prunus persicaHubei, ChinaKU557555KU557579KU557603KU557623
D. phaseolorumAR4203Phaseolus vulgarisUSAKJ590738KP004507N/AN/A
D.phragmitisCBS 138897Phragmites australisChinaKP004445KP004507N/AN/A
D. podocarpi- macrophylliCGMCC 3.18281Podocarpus macrophyllusChinaKX986774KX999207KX999278KX999167
D. pseudomangiferaeCBS 101339Mangifera indicaDominican RepublicKC343181KC344149KC343423KC343907
D.pseudophoenicicolaCBS 462.69Phoenix dactyliferaSpainKC343184KC344152KC343426KC343910
D. pseudotsugaeMFLU 15-3228Pseudotsuga menziesiiItalyKY964225KY964108KY964138KY964181
D. psoraleaeCBS 136412Psoralea pinnataSouth AfricaKF777158KF777251N/AKF777245
D. psoraleae- pinnataeCBS 136413Psoralea pinnataSouth AfricaKF777159KF777252N/AN/A
D. pterocarpiMFLUCC 10-0571Pterocarpus indicusThailandJQ619899JX275460JX197451JX275416
D. pterocarpicolaMFLUCC 10-0580Pterocarpus indicusThailandJQ619887JX275441JX197433JX275403
D. pullaCBS 338.89Hedera helixYugoslaviaKC343152KC344120KC343394KC343878
D. pyracanthaeCAA483Pyracantha coccineaPortugalKY435635KY435666KY435656KY435625
D. racemosaeCBS 143770Euclea racemosaSouth AfricaMG600223MG600227MG600219MG600225
D. raonikayaporumCBS 133182Spondias mombinBrazilKC343188KC344156KC343430KC343914
D. ravennicaMFLUCC 15-0479Tamarix sp.ItalyKU900335KX432254N/AKX365197
D. rhusicolaCBS 129528Rhus pendulinaSouth AfricaJF951146KC843205KC843124KC843100
D. rosaeMFLU 17-1550Rosa sp.ThailandMG828894MG843878N/AN/A
D. rosicolaMFLU 17-0646Rosa sp.UKMG828895MG843877N/AMG829270
D. rostrataCFCC 50062Juglans mandshuricaChinaKP208847KP208855KP208849KP208853
D. rudisAR3422Laburnum anagyroidesAustriaKC843331KC843177KC843146KC843090
D. saccarataCBS 116311Protea repensSouth AfricaKC343190KC344158KC343432KC343916
D. sackstoniiBRIP 54669bHelianthus annuusAustraliaKJ197287KJ197267N/AKJ197249
D. salicicolaBRIP 54825Salix purpureaAustraliaJX862531JX862531N/AJX862537
D. sambucusiiCFCC 51986Sambucus williamsiiChinaKY852495KY852511KY852499KY852507
D. schiniCBS 133181Schinus terebinthifoliusBrazilKC343191KC344159KC343433KC343917
D. schisandraeCFCC 51988Schisandra chinensisChinaKY852497KY852513KY852501KY852509
D. schoeniMFLU 15-1279Schoenus nigricansItalyKY964226KY964109KY964139KY964182
D. sclerotioidesCBS 296.67Cucumis sativusNetherlandsKC343193KC344161KC343435KC343919
D. sennaeCFCC 51636Senna bicapsularisChinaKY203724KY228891KY228875KY228885
D. sennicolaCFCC 51634Senna bicapsularisChinaKY203722KY228889KY228873KY228883
D. serafiBRIP 55665aHelianthus annuusAustraliaKJ197274KJ197254N/AKJ197236
D. siamensisMFLUCC 10-573aDasymaschalon sp.ThailandJQ619879JX275429N/AJX275393
D. sojaeFAU635Glycine maxOhio, USAKJ590719KJ610875KJ612116KJ590762
BRIP 54033Helianthus annuusAustraliaJF431295KJ160528KJ160548JN645809
CBS116019Caperonia palustrisUSAKC343175KJ610862KJ612103KC343901
DP0601Glycine maxUSAKJ590706N/AN/AKJ590749
DP0605Glycine maxUSAKJ590707KJ610863KJ612104KJ590750
DP0616Glycine maxUSAKJ590715KJ610871KJ612112KJ590758
FAU455Stokesia laevisUSAKJ590712KJ610870KJ612111KJ590755
FAU458Stokesia laevisUSAKJ590710KJ610866KJ612107KJ590753
FAU459Stokesia laevisUSAKJ590709KJ610865KJ612106KJ590752
FAU499Asparagus officinalisUSAKJ590717KJ610873KJ612114KJ590760
FAU604Glycine maxUSAKJ590716KJ610872KJ612113KJ590759
FAU636Glycine maxUSAKJ590718KJ610874KJ612115KJ590761
ZJUD68Glycine maxUSAKJ490603KJ490424N/AKJ490482
ZJUD69Citrus reticulataChinaKJ490604KJ490425N/AKJ490483
ZJUD70Citrus limonChinaKJ490605KJ490426N/AKJ490484
D. spartinicolaCBS 140003Spartium junceumSpainKR611879KC344180KC343454N/A
D. sterilisCBS 136969Vaccinium corymbosumItalyKJ160579KJ490408N/AKJ160611
D. sticticaCBS 370.54Buxus sampervirensItalyKC343212MG746631N/AKC343938
D. subclavataICMP20663Citrus unshiuChinaKJ490587MG746634N/AKJ490466
D. subcylindrosporaMFLU 17-1195Salix sp.ChinaMG746629KC344182KC343456MG746630
D. subellipicolaMFLU 17-1197on dead woodChinaMG746632KU557591KU557567MG746633
D. subordinariaCBS 464.90Plantago lanceolataNew ZealandKC343214KU557592KU557568KC343940
D. taoicolaMFLUCC 16 0117Prunus persicaHubei, ChinaNR154923KU743977KU712430KU557635
D. tectonaeMFLUCC 12 0777Tectona grandisThailandNR147590KU743977KU749345KU749359
D. tectonigenaMFLUCC 12-0767Tectona grandisChinaKU712429JX275449JX197440KU749371
D. terebinthifoliiCBS 133180Schinus terebinthifoliusBrazilKC343216N/AN/AKC343942
D. thunbergiiMFLUCC 10-576aTh laurifoliaThailandJQ619893MF279873MF279888JX275409
D. thunbergiicolaMFLUCC 12-0033Th laurifoliaThailandKP715097MF279874MF279889KP715098
D. tibetensisCFCC 51999Juglandis regiaChinaMF279843KY964096KY964127MF279858
D. torilicolaMFLUCC 17-1051Torilis arvensisItalyKY964212KR936132N/AKY964168
D. toxicaCBS 534.93Lupinus angustifoliusAustraliaKC343220KJ610881KJ612122KC343946
D. tulliensisBRIP62248aTheobroma cacaoAustraliaKR936130N/AMH121445KR936133
D. ueckeraeFAU656Cucumis meloUSAKJ590726N/AMH121446KJ590747
D. ukurunduensisCFCC 52592Acer ukurunduenseChinaMH121527KX999230N/AMH121569
CFCC 52593Acer ukurunduenseChinaMH121528KJ490408N/AMH121570
D. undulataCGMCC 3.18293Leaf of unknown hostChina-Laos borderKX986798KJ490406N/AKX999190
D. unshiuensisZJUD50Fortunella margaritaChinaKJ490585KC344195KC343469KJ490464
D. vacciniCBS160 32Oxycoccus macrocarposUSAKC343228KJ869247N/AKC343954
D. vangueriaeCPC 22703Vangueria infaustaZambiaKJ869137KX999223N/AN/A
D. vawdreyiBRIP 57887aPsidium guajavaAustraliaKR936126KP247575N/AKR936129
D. velutinaCGMCC 3.18286Neolitsea sp.ChinaKX986790KX999216N/AKX999182
D. virgiliaeCMW40748Virgilia oroboidesSouth AfricaKP247566KX999228KX999290N/A
D. xishuangbanicaCGMCC 3.18282Camellia sinensisChinaKX986783KC343972KC343246KX999175
D. yunnanensisCGMCC 3.18289Coff sp.ChinaKX986796N/AKX999290KX999188
Diaporthella corylinaCBS 121124Corylussp.ChinaKC343004KC343972KC343246KC343730

Diaporthe taxa used in the phylogenetic analysis.

BRIP, Plant Pathology Herbarium, Department of Primary Industries, Dutton Park, Queensland, Australia; CPC, Culture collection of P.W. Crous, housed at Westerdijk Fungal Biodiversity Institute; CBS, Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; DAOM, Canadian Collection of Fungal Cultures or the National Mycological Herbarium, Plant Research Institute, Department of Agriculture (Mycology), Ottawa, Canada; ICMP, International Collection of Microorganisms from Plants, Landcare Research, Auckland, New Zealand. MFLUCC, Mae Fah Luang University culture collection, Mae Fah Luang University, Chiang Rai, 57100, Thailand. JZB, Culture collection of Institute of Plant and Environment Protection, Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, China. AR, DAN, DNP, FAU, DLR, DF, DP, LCM, M, isolates in SMML culture collection, USDA-ARS, Beltsville, MD, USA, and MAFF, NIAS Genebank Project, Ministry of Agriculture, Forestry and Fisheries, Japan. Ex-type and ex-epitype cultures are indicated in bold. ITS, internal transcribed spacers 1 and 2 together with 5.8S nrDNA; β-tubulin, partial beta-tubulin gene; CAL, partial calmodulin gene and EF-1α, partial translation elongation factor 1-α gene.

In PAUP, ambiguous regions in the alignment were excluded for further analyses, and gaps were treated as missing data. The stability of the trees was evaluated by 1000 bootstrap replications. Branches of zero length were collapsed, and all multiple parsimonious trees were saved. Parameters, including tree length (TL), consistency index (CI), retention index (RI), relative consistency index (RC), and homoplasy index (HI) were calculated. Differences between the trees inferred under different optimality criteria were evaluated using Kishino-Hasegawa tests (KHT) (Kishino and Hasegawa, 1989). The evolutionary models for each locus used in Bayesian analysis and ML were selected using MrModeltest v. 2.3 (Nylander, 2004). ML analyses were accomplished using RAxML-HPC2 on XSEDE (8.2.8) (Stamatakis et al., 2008; Stamatakis, 2014) in the CIPRES Science Gateway platform (Miller et al., 2010) using the GTR + I + G model of evolution with 1000 non-parametric bootstrapping iterations. Bayesian analysis was performed in MrBayes v. 3.0b4 (Ronquist and Huelsenbeck, 2003), and posterior probabilities (PPs) were determined by Markov chain Monte Carlo sampling (MCMC). Six simultaneous Markov chains were run for 106 generations, sampling the trees at every 100th generation. From the 10,000 trees obtained, the first 2,000 representing the burn-in phase were discarded. The remaining 8,000 trees were used to calculate PPs in a majority rule consensus tree. Alignment generated in this study is submitted to TreeBASE (https://treebase.org/treebase-web/home.html) under the submission number 24324. Taxonomic novelties were submitted to the Faces of Fungi database (Jayasiri et al., 2015) and Index fungorum (http://www.indexfungorum.org). New species are described following Jeewon and Hyde (2016).

Morphology and Culture Characteristics

Colony morphology and conidial characteristics were examined for Diaporthe species identified by phylogenetic analysis. Colony colors were examined according to Rayner (1970) after 7 days of growth on PDA in the dark at 25°C. Digital images of morphological structures mounted in water were taken using an Axio Imager Z2 photographic microscope (Carl Zeiss Microscopy, Oberkochen, Germany). Measurements were taken using ZEN PRO 2012 (Carl Zeiss Microscopy). Conidial length and width were measured for 40 conidia per isolate, and the mean values were calculated for all measurements. Conidial shape, color, and guttulation were recorded.

Genetic Diversity and Population Structure Analysis

Among the identified species, only one, Diaporthe eres, had a count of >20 individuals. As a result, only D. eres was selected for the analysis of genetic diversity and population relationships. For the D. eres population, diversity indices were calculated for each gene region and the combined sequence dataset. DnaSP v. 6.12 (Librado and Rozas, 2009) was employed to calculate haplotype richness (hR), the total number of haplotypes, Watterson's theta (Θw), and pairwise nucleotide diversity (JI). To overcome the population size effects, hR, Θw and JI were calculated after 1,000 repetitions, and the median estimate was recorded for each parameter. To understand the potential departure from an equilibrium model of evolution, Tajima's D was calculated using DnaSP v. 6.12 with a permutation test of 1,000 replicates. The minimum numbers of recombination events (ZnS) used by Kelly (1997) and the recombination parameters Za and ZZ used by Hudson (1983) were calculated for each gene region and the combined data set. Diaporthe eres haplotype networks were constructed using Network v. 5.0 (Bandelt et al., 1999).

Network Analysis

To understand the relationship among different geographical populations, recombination parameters were calculated, and haplotype networks were constructed. In this analysis, the combined dataset of Diaporthe eres isolates from China alone and Chinese isolates combined with European isolates (Guarnaccia et al., 2018) were used. ZnS, used by Kelly (1997), and the recombination parameters Za and ZZ (Hudson, 1983; Kelly, 1997) were calculated using DnaSP v. 6.12. The haplotype data generated using DnaSP v. 6 were used to construct a median-joining network in Network v. 5.0 (Bandelt et al., 1999).

Pathogenicity Assay

The pathogenicity and aggressiveness of the Diaporthe species were tested using detached green shoots of the V. vinifera cultivar Summer Black. Healthy, 30–50 cm long green shoots (including at least two nodes) were obtained from “Shunyi Xiangyi” vineyard in Beijing, China, where Diaporthe species were not recorded. The cuttings were surface-sterilized with 70% ethanol by wiping with cotton swabs. A shallow wound (5 mm length, 2 mm deep) was made in the center of each shoot using a sterilized scalpel. Mycelial plugs were taken from the growing margin of a 5-day-old culture grown in PDA and inoculated at the wound site. Non-colonized sterile PDA plugs were used for inoculation of shoots as a negative control. To prevent drying, all inoculated areas were covered with Para-film (Bemis, USA). Inoculated shoots were kept in a growth chamber for 21 days at 25°C with a 12 h photoperiod. The experiment was organized with 10 replicates for each isolate. Pathogenicity test was repeated three times with same controlled environment. A total of 16 strains from eight species were tested. The presence of lesions advancing beyond the original 0.5 cm diameter inoculation point was considered indicative of pathogenicity. The experimental design was completely randomized. Data were analyzed with a one-way ANOVA (analysis of variance) using Minitab v. 16.0 (Minitab Inc., Boston, MA, USA), with statistical significance set at the 5% level. The pathogens were re-isolated to confirm their identity.

Results

Initial Species Identification and Phylogenetic Analyses

During our field survey on six grape-growing provinces in China (Figure 1), we collected samples with typical symptoms associated with Diaporthe dieback, such as wedge-shaped cankers, and light brown streaking of the wood (Figure 2). However, these symptoms are sometimes confused with other grape trunk disease symptoms caused by Botryosphaeria dieback, Eupta, and Esca (Mondello et al., 2018). Hence, further confirmation is required by isolating and identifying causal organisms. One hundred and eleven Diaporthe isolates were initially identified by colony characteristics, such as abundant tufted white aerial mycelia on agar medium. The ITS gene regions were sequenced for all fungi isolated from diseased shoots and compared with those in GenBank using the MegaBLAST tool in GenBank. The isolates showed 95–99% similarity to known Diaporthe species in GenBank, and these closely related known species were included in the phylogenetic analysis.

To understand the taxonomic placements of our isolates, additional gene regions, including those encoding EF-1α, β-tubulin, and CAL, were sequenced. Then, phylogenetic trees were constructed for each individual gene region. The concatenated sequence data set consisted of 94 isolates (out of 111, due to sequencing errors) from the current study (Table 3) and 197 isolates originating from GenBank (Table 2), with one outgroup taxon, Diaporthella corylina (CBS 121124). A comparison of maximum likelihood (ML) analysis results for each gene region is given in Table 4. In the ML analysis, the resulting tree of the combined data set of ITS, β-tubulin, CAL, and EF-1α genes had the best resolution of taxa (Figure 3). Therefore, in the present study, we used the combined sequence data to understand the taxonomic placements of the Diaporthe species isolated from grapevines in China. A Bayesian analysis resulted in 10,001 trees after 2,000,000 generations. The first 1,000 trees, representing the burn-in phase of the analyses, were discarded, while the remaining 9,001 trees were used for calculating posterior probabilities (PPs) in the majority-rule consensus tree. The dataset consisted of 1,494 characters with 727 constant characters and 1,006 parsimony-informative and 213 parsimony-uninformative characters. The maximum number of trees generated was 1,000, and the most parsimonious trees had a tree length of 9,862 (CI = 0.249, RI = 0.805, RC = 0.201, HI = 0.751).

Table 4

Data setITSβ-tubulinCALEF-1αITS+ β-tubulin+ CAL+ EF-1α
Constant characters22622622668
Parsimony-uninformative characters1072610748
Parsimony-informative characters189249189335
ML optimization likelihood value−51,581.507970−9741.212701−7853.669691−16943.655728−50,588.257001
Distinct alignment patterns2913042932931,330
Undetermined characters or gaps7.18%26.12%8.74%28.55%28.70%
ESTIMATED BASE FREQUENCIES
A0.2440430.2000390.2114900.2201120.221742
C0.2773390.3490710.3136940.3294200.313804
G0.2473570.2339340.253908,0.2505060.235189
T0.2312610.2169550.2209080.2209080.229264
SUBSTITUTION RATES
AC1.3002710.7917061.0412131.4579771.328496
AG2.9949903.7615504.2893303.7783373.630252
AT1.4016260.9620211.3071571.3394501.324920
CG0.8269190.6684751.2597721.1198720.954109
CT7.2666337.2666335.6629383.9769634.974568
GT1.0000001.0000001.0000001.0000001.000000
Proportion of invariable sites (I)0.2744430.3506560.2744430.2744430.269146
Gamma distribution shape parameter (α)0.4057662.2085720.4057660.4057660.869283

Comparison of ML analyses results for each gene region.

Figure 3

In the phylogenetic tree generated using the combined data set (Figure 3), 36 isolates from the present study clustered with Diaporthe eres in the D. eres complex. This group represents 37.5% of the total isolates, and these isolates were obtained from five provinces. Sixteen isolates (19.76% of the total isolates) clustered with Diaporthe sojae (D. sojae) species in the D. sojae complex. Two isolates from Heilongjiang province clustered together with Diaporthe gulyae (D. gulyae) (BRIP 54025). In addition, two isolates clustered with Diaporthe unshiuensis (D. unshiuensis) (ZJUD52) from Hubei province, and another two isolates that were also from Hubei province clustered with Diaporthe pescicola (D. pescicola) (MFLUCC 16-0105). The remaining isolates (35 in total) did not cluster with any known Diaporthe species. Thus, these were putatively identified as belonging to three novel species (Figure 3): D. hubeiensis, D. guangxiensis, and D. viniferae. Diaporthe hubeiensis (D. hubeiensis) was isolated from grapevines from Hubei province and represents 12.5% of the total isolates. This species is a sister taxon with Diaporthe alangi (D. alangi) (CFCC52556). The remaining two new taxa were isolated from grapevines from Guangxi Province. Diaporthe guangxiensis (D. guangxiensis) was represented by 11 isolates (13.54%), and it is closely associated with Diaporthe cercidis (D. cercidis) (CFCC5255). Diaporthe viniferae (D. viniferae) was represented by 8 isolates (10.41%), and its closest relative is Diaporthe pandanicola (D. pandanicola) (MFLU 18-0006).

Taxonomic Novelties

Diaporthe guangxiensis(D. guangxiensis) Dissanayake, X.H. Li & K.D. Hyde, sp. nov. (Figure 4).

Figure 4

Index Fungorum number—IF552578, Facesoffungi Number- FoF02725.

Etymology- In reference to the Guangxi Province, from where the fungus was first isolated.

Holotype—JZBH320094.

Description

Sexual morph: efforts were made to initiate sexual morphs, but various methods failed; Asexual morph: pycnidia on PDA 250-1550 μm (x = 1100 μm, n = 20) in diam., superficial, scattered on PDA, dark brown to black, globose, solitary, or clustered in groups of 3–5 pycnidia. Conidiophores aseptate, cylindrical, straight or sinuous, densely aggregated, terminal, slightly tapered toward the apex, 21–35 × 1.5–2.5 μm ( = 27 × 2 μm). Alpha conidia biguttulate, hyaline, fusiform or oval, both ends obtuse 5.3–7.8 × 1.5–3.2 μm ( = 6.8 × 2.5 μm n = 40). Beta conidia aseptate, hyaline, hamate, filiform, guttulate, tapering toward both ends 20–32 × 1–1.5 μm ( = 27 × 1.5 μm, n = 20).

Culture Characteristics

Colonies on PDA reach 70 mm diam. after 7 days at 25°C, producing abundant white aerial mycelia and reverse fuscous black.

Material Examined

CHINA, Guangxi Province, Pingguo County, on diseased trunk of V. vinifera, 3 June 2015, X.H. Li, (JZBH320094, holotype); ex-type living cultures JZB320094).

Notes: Morphological characters such as spores and colony characteristics of D. guangxiensis fit well within the species concept of Diaporthe. DNA sequence analyses of the ITS, CAL, TUB, and EF genes showed a strongly supported monophyletic lineage with 78% ML, 70% MP bootstrap values and 0.95 posterior probabilities (Figure 3). The current species has a particular neighbor relationship with D. cercidis (CFCC52566). Morphologically, D. guangxiensis has larger conidiophores (27 × 2 μm) and smaller conidia (6.8 × 2.5 μm) than D. cercidis (7–17 × 1.4–2.1 μm conidiophores; 8.6 × 3.3 μm conidia) (Yang et al., 2018). In the comparisons of five gene regions between Diaporthe guangxiensis and D. cercidis, 51.5% of 458 nucleotides across the ITS (+5.8S) had base pair differences. In addition, comparisons of the protein-coding genes showed that there were 17.3, 0.66, and 9.06% polymorphic nucleotide sites between the two species for the CAL, β-tubulin and EF-1α genes, respectively.

Diaporthe hubeiensis Dissanayake, X.H. Li & K.D. Hyde, sp. nov. (Figure 4).

Index Fungorum number—IF552579, Facesoffungi Number- FoF 02726.

Etymology- In reference to the Hubei province, from where the fungus was first isolated.

Holotype – JZBH320123.

Description

Sexual morph: efforts were made to initiate sexual morphs, but various methods failed; Asexual morph: pycnidia on PDA varying in size up to 510 μm in diam., subglobose, occurs on PDA and double-autoclaved toothpicks after 3–4 weeks, solitary or forms in groups of stroma with a blackened margin. Ostiolate, up to 100 μm black cylindrical necks. Conidiophores were reduced to conidiogenous cells. Alpha conidia hyaline, smooth, biguttulate, blunt at both ends, ellipsoidal to cylindrical, 5.6–7.1 × 1–3.1 μm ( = 6.1 × 1.8 μm n = 40). Beta conidia filiform, tapering toward both ends, scattered among the alpha conidia 17–27 × 1–1.5 μm ( = 24 × 1.5 μm n = 40).

Culture Characteristics

Colonies on PDA reach 90 mm after 10 days at 25°C (covers total surface), abundant tufted white aerial mycelia, buff, numerous black pycnidia 0.5 mm in diam. occur in the mycelium, typically in the direction of the edge of the colony; reverse buff with concentric lines.

Material Examined

CHINA Hubei Province, Wuhan, on diseased trunk of V. vinifera, 30 June 2015, X. H Li (JZBH320123, holotype); ex-type living cultures JZB320123.

Notes: In phylogenetic analysis, D. hubeiensis was placed in a well-supported clade together with D. alangi (CFCC52556), D. tectonae (MFLUCC 12- 0777) and D. tulliensis (BRIP62248b) with 100% ML, 100% MP bootstrap values and 0.99 posterior probabilities. Diaporthe hubeiensis developed sister clade with D. alangi (CFCC52556) with 99% ML, 83% MP bootstrap values and 0.99 posterior probabilities. Morphologically, Diaporthe hubeiensis has smaller conidiophores and smaller conidia (6.1 × 1.8 μm) than D. alangi (7 × 2 μm), and it has no beta conidia in D. alangi (Yang et al., 2018). Diaporthe hubeiensis differs from D. tectonae by developing wider but shorter conidia (6.1 × 1.8 μm vs 5.5 × 2.6 μm) (Doilom et al., 2017). Compared to D. tulliensis, D. hubeiensis has smaller conidia (6.1 × 1.8 μm vs 5.5–6 μm) (Yang et al., 2018). In the ITS sequence comparison between D. hubeiensis and D. alangi, 44.6% of the 461 nucleotides across the ITS (+5.8S) were different. Of the three protein-coding genes, the two species showed 4.26% and 1.16% and 5.3% polymorphic nucleotide site differences for CAL, β-tubulin and EF-1α genes, respectively.

Diaporthe viniferae Dissanayake, X.H. Li & K.D. Hyde, sp. nov.

Index Fungorum number—IF552002, Facesoffungi Number- FoF 05981.

Etymology- In reference to the host V. vinifera.

Holotype—JZBH320071.

Description

Sexual morph: efforts were made to initiate sexual morphs, but various methods failed; Asexual morph: Pycnidia on PDA 363–937 μm (x = 529 μm, n = 20) in diam., superficial, scattered, dark brown to black, globose, solitary in most. Conidiophores were not observed. Conidiogenous cells were not observed. Alpha conidia biguttulate, hyaline, fusiform or oval, both ends obtuse 5–8.3 × 1.3–2.5 μm ( = 6.4 × 2.1 μm). Beta conidia aseptate, hyaline, hamate, filiform, tapering toward both ends 23–35 × 1–1.5 μm ( = 28 × 1.3 μm n = 40).

Culture Characteristics

Colonies on PDA reach 70 mm diam. after 7 days at 25°C, producing abundant white aerial mycelia and reverse fuscous black.

Material Examined

CHINA, Guangxi Province, Pingguo County, on the diseased trunk of V. vinifera, 3 June 2015, X.H. Li, (JZBH320071 holotype); ex-type living cultures JZB320071).

Notes: In the phylogenetic analysis of D. viniferae, a strongly supported monophyletic lineage with strong 77% ML and 71% MP bootstrap values and 0.95 PP was developed (Figure 3). The current species has a particular close relationship with D. pandanicola (MFLUCC 18-0006). In the original description of D. pandanicola, morphological characteristics were not given (Tibpromma et al., 2018). Therefore, these two species were compared based on only DNA sequence data. ITS sequence comparison between D. viniferae and D. pandanicola revealed that 2.9% of the 478 nucleotide sites across the ITS (+5.8S) regions were different. Similarly, 1.7% of the β-tubulin gene fragment was different.

Genetic Diversity and Population Structure Analysis

Table 5 summarized the genetic diversity data of D. eres associated with grapevines which were estimated using DnaSP V.6. In the analysis, the combined data set of ITS, β-tubulin, HIS, APN, and CAL gene sequences showed 0.16226 segregation sites per sequence and a haplotype diversity of 0.955. A haplotype network was developed for the D. eres species isolated from China using Network v. 5.0 (Figure 5). The resulting network combining ITS, β-tubulin, HIS, EF-1α, and CAL gene sequences gave two main clusters according to geographic origin. In the network, isolates from Hubei province were clustered into two main clades. A single haplotype (H-11) was clustered within the main Jilin clade. Haplotype 7 (from Hubei) and h-13 (from Sichuan Province) were connected with one intermediate haplotype to the two main clusters.

Table 5

SpeciesGenenabpbTheta-wSchdhdepifTDg
D. eresITS2849112.76633100.8520.0201.05556
β-tubulin28481626100.8690.01362−0.35308
HIS152440.04088340.7760.00167−0.5791
CAL173990.0359015110.8450.013910.63457
APN166800.009061150.80.00445−0.33503
Combine2532470.0157660170.9580.0200.20416

Polymorphism and genetic diversity of Diaporthe eres strains associated with Chinese grapevines.

a

Sample size (n).

b

Total number of sites (bp).

c

Number of segregating sites (S).

d

Number of alleles (nA).

e

Haplotypic (allelic) diversity (hd).

f

Average nucleotide diversity (pi).

g

Tajima's D (TD), (R) Estimate of R (Rm) minimum recombination events.

Figure 5

To understand the relationship between Diaporthe isolates from Chinese vineyards and those from European vineyards, we calculated recombination parameters Z and ZnS. The combined data set consists of 135 sequences with 2203 sites. The estimate of R per gene was 6.6, and the minimum number of recombination events (Rm) was 15. Median-joining networks were constructed using both single-gene data files and a combined data set of ITS, β-tubulin, HIS, EF-1α, and CAL genes. The single-gene networks differed from each other, and the resulting patterns did not give a significant grouping. Therefore, in this study, only the combined network was considered (Figure 6). A total of 33 haplotypes were identified using DnaSP, and the haplotype data file was used to generate the haplotype network. In the resulting network, we found that Chinese haplotypes and Europe haplotypes were not shared and that there was no sharing of haplotypes among different provinces in China. However, the Chinese haplotypes were dispersed in the combined network, with the majority of isolates from Hubei located in two related clusters surrounded by European haplotypes. Similarly, the haplotypes from Sichuan and Jilin provinces were also dispersed in the network and close to both European and Chinese haplotypes.

Figure 6

Comparative Aggressiveness Among Diaporthe Species

Pathogenicity and aggressiveness among eight Diaporthe species isolated in our study were compared by inoculating them into the V. vinifera cultivar Summer Black. The inoculated shoots did not show significant lesion development within the first 2 weeks after inoculation. Brown necrotic lesions were detected both on the tissue surface and internally, advancing upwards, and downwards through the inoculation point. Twenty-one days after inoculation, D. gulyae developed the largest lesions (1.23 cm), followed by D. eres (0.94 cm). The remaining species, D. unshiuensis, D. viniferae, D. guangxiensis, D. pescicola, and D. sojae, exhibited similar levels of aggressiveness on grape shoots (Figure 7). Diaporthe hubeiensis was the least aggressive (0.5 cm) among the eight species.

Figure 7

Discussion

Grapevine trunk disease has become one of the most devastating grapevine diseases in recent decades. According to data collected worldwide, ~1.5 billion US dollars per year is spent to replace dead grapevines due to these trunk diseases (Hofstetter et al., 2012; Fontaine et al., 2016). This is a great concern among grape-producing countries, as the disease infects perennial parts of the vine and reduces the productive lifespan of vines by several years (Gramaje and Armengol, 2011). The disease ultimately affects the sustainability of the wine industry and table grape production (Fontaine et al., 2016). As the world's top grape-producing country, China has strived to improve the quality and quantity of grapes. Though they are the most important grapevine trunk diseases worldwide, there is no evidence of either the esca complex or Eutypa dieback in China (Fontaine et al., 2016). However, the third most common grapevine trunk disease, caused by the species in Botryosphaeriaceae (Yan et al., 2013, 2018), has been identified as the leading grapevine trunk pathogen complex in China. Unfortunately, over the last few years, diseases caused by Diaporthe species (Dissanayake et al., 2015a, 2017) have become the emerging trunk diseases in China. Understanding the diversity of the causative species and the genetic variation within pathogen populations could help in developing sustainable disease management strategies. In addition, understanding the relationships between European and Chinese isolates can help track disease spread, as both regions share similar disease severity and Diaporthe species that differ from those in North America (Fontaine et al., 2016; Úrbez Torres and O'Gorman, 2019). To achieve these objectives, disease surveys were conducted in six provinces. We isolated and identified 111 Diaporthe strains and showed that they belong to eight species.

In 1958, D. ampelina (= Phomopsis viticola) was identified infecting green shoots of grapevines (Pscheidt and Pearson, 1989). The disease was named “Phomopsis cane and trunk disease.” According to the USDA Fungal—host interaction database, there are 166 records of Diaporthe species associated with grapevines worldwide (https://nt.ars-grin.gov/fungaldatabases/fungushost/fungushost.cfm) (Farr and Rossman, 2019). These records are related to the following 27 Diaporthe species: Diaporthe ambigua (D. ambigua) (Dissanayake et al., 2017), D. ampelina (Úrbez-Torres et al., 2013), Diaporthe amygdali (D. amygdali) (Gomes et al., 2013; Guarnaccia et al., 2018), Diaporthe australafricana (D. australafricana) (Gomes et al., 2013), Diaporthe baccae (D. baccae), D. bohemiae, Diaporthe celeris (D. celeris) (Guarnaccia et al., 2018), Diaporthe chamaeropis (D. chamaeropis) (Lawrence et al., 2015), Diaporthe. Cynaroidis (Lesuthu et al., 2019) Diaporthe cytosporella (D. cytosporella), Diaporthe eres (D. eres), D. foeniculina, Diaporthe helianthi (D. helianthi) (Dissanayake et al., 2017; Guarnaccia et al., 2018; Farr and Rossman, 2019), Diaporthe hispaniae (D. hispaniae), D. hongkongensis (Dissanayake et al., 2017), Diaporthe hungariae (D. hungariae) (Guarnaccia et al., 2018), D. kyushuensis (Kajitani and Kanematsu, 2000), D. nebulae (Lesuthu et al., 2019) Diaporthe neotheicola (D. neotheicola) (Úrbez-Torres et al., 2013), Diaporthe nobilis (D. nobilis) (Dissanayake et al., 2017), D. novem (Lawrence et al., 2015), D. perjuncta (Mostert et al., 2001), Diaporthe perniciosa (D. perniciosa) (Stoykow and Denchev, 2006), D. phaseolorum (Dissanayake et al., 2017), Diaporthe rudis (D. rudis) (Guarnaccia et al., 2018), Diaporthe serafiniae (D. serafiniae) (Lesuthu et al., 2019), and D. sojae (Dissanayake et al., 2017). Among these species D. ampelina is the mostly reported species with 42 records in 12 countries. The present study introduces the three novel taxa D. guangxiensis, D. hubeiensis, and D. viniferae and three new host records: D. gulyae, D. pescicola, and D. unshiuensis.

Diaporthe eres was identified as the most prominent and widespread species associated with grapevine dieback in China (37.5% of total isolates). Other than on grapevines, D. eres has been reported on Aralia elata (A. elata) (Wu et al., 2012), Camellia species (Gao et al., 2016), Citrus species (Huang et al., 2015), peach (Dissanayake et al., 2017), and pear (Bai et al., 2015) plants in China, causing diebacks. Diaporthe eres has been reported in many countries, such as the USA (Úrbez-Torres et al., 2013; Lawrence et al., 2015), Croatia (Kaliterna et al., 2012), Greece (Thomidis and Michailides, 2009), Italy (Cinelli et al., 2016), Latvia (Lombard et al., 2014), Poland (Kowalski et al., 2016), Russia, Serbia (Petrovic et al., 2015), and South Africa (Van Niekerk et al., 2005; Lesuthu et al., 2019) causing diseases on grapevines. These reports reveal that D. eres has a diverse host range and a broad geographical distribution. The second most abundant taxon, D. sojae, has a wide range of hosts as well, including Camptotheca acuminata (C. acuminata) (Chang et al., 2005), Glycine max, Cucumis melo (Lehman, 1923; Santos et al., 2011), Capsicum annuum (C. annuum) (Pennycook, 1989), Stokesia laevis (S. laevis) (Sogonov et al., 2008), and Helianthus annuus (H. annuus) (Thompson et al., 2011). These two Diaporthe species were previously identified and characterized from grapevines in China by Dissanayake et al. (2015a).

The present study recorded three Diaporthe species, D. gulyae, D. pescicola, and D. unshiuensis, associated with Vitis dieback for the first time. Diaporthe gulyae was previously reported on H. annuus in Australia (Thompson et al., 2011), Canada, and the United States (Mathew et al., 2015a,b) and on Carthamus lanatus (C. lanatus) in Italy (Andolfi et al., 2015). Diaporthe pescicola was previously described in association with peach shoot dieback in China (Dissanayake et al., 2017). Diaporthe unshiuensis was first described in China in 2015 as an endophyte of a Citrus sp. (Huang et al., 2015).

The identification and characterization of novel taxa and new host records is an indication of the high potential of Diaporthe to evolve rapidly. Host switching is often related to fungal adaptive ability (Bleuven and Landry, 2016). The changing environments and human interference present both challenges and opportunities for fungi, with some capable of switching from endophytic or saprobic lifestyles to pathogenic styles or becoming more aggressive and colonizing new hosts (Manawasinghe et al., 2018). The novel taxa and the new records reported here for grapevine trunk diseases in China might be due to these factors. During the past decade, northern China has become significantly warmer (Piao et al., 2010). The increased temperature could attract new pests and disease agents to the region. On the other hand, human-mediated factors can also influence the development of a new disease (McDonals, 2004). For example, in commercial grape vineyards, significant amounts of chemicals are applied annually in the form of pesticides and fungicides (Úrbez-Torres, 2011). Such applications could lead to the development of resistant strains of the target organism and non-target micro-fungi (Manawasinghe et al., 2018). Over time, strains and species that are more resistant and/or more aggressive could emerge. The recent identification of new species and new host records of Diaporthe in China and in Europe are consistent with the hypothesis. Studying the genetic diversity of pathogens provides clues to how host switches might have occurred and the genetic basis for new pathogen emergence.

The knowledge of the genetic diversity of a particular phytopathogen can be used to develop sustainable management strategies such as resistance breeding and fungicide screening. In this study, D. eres was analyzed, as it had a relatively large number of isolates from which to obtain reasonable estimates of various intraspecific diversity indices. In this study, multi-locus sequences were used as the marker of choice. The use of sequence data as genetic markers facilitated the analysis of genetic variations among isolates within a population. We selected ITS, β-tubulin, HIS, EF-1α, and CAL gene regions, as they were extensively used in phylogenetic analysis of the genus Diaporthe. In addition, ACT and Apn2 genes were selected since those regions provide a large number of polymorphic sites for the Diaporthe eres species complex (Udayanga et al., 2014b). Genetic polymorphisms are required for both phylogenetic and population genetic studies (Xu, 2006). Using these gene regions, we calculated haplotype richness (hR), the total number of haplotypes, Watterson's theta (Θw), and pairwise nucleotide diversity (JI) for Diaporthe eres obtained from Chinese vineyards.

The combined effect of the mutation, recombination, marker ascertainment, and demography of a particular species can be revealed by analyzing and comparing gene genealogies and haplotype diversities within and between genes (Stumpf, 2004; Xu, 2006). The calculated haplotype diversities of Diaporthe eres were higher than 0.5 for Apn2, CAL, HIS, β-tubulin and the combined data, reflecting high genetic diversity. Tajima's D indicates how much population variation can be sustained over time (Tajima, 1989). In the present study, positive D values were observed for coding gene regions (Apn2, CAL, and HIS). This might be due to selective pressure causing a recent population contraction. The selection pressure could have come from the continuous application of fungicides, leading to the loss of certain genotypes. In contrast, Tajima's D for the combined sequences was negative (−0.20416), which indicates a possible recent population expansion of certain multi-locus genotypes (Tajima, 1989). In Hubei, several multi-locus genotypes were over-represented, consistent with this hypothesis.

The Hudson and Kaplan (1985) index for the recombination between Chinese and European isolates was calculated for this study. In our analysis, we calculated the number of recombination events in the history of a sample of sequences (R) and the number of recombination events that can be parsimoniously inferred from a sample of sequences (Rm) (Hudson, 1983; Kelly, 1997). When the rate of recombination equals zero, R gives zero (Hudson, 1983; Hudson and Kaplan, 1985). Since the R is given a value based on the history of the sample, Rm denotes the minimum number of recombination events implied by the data using the four-gamete test. A positive ZZ value, which reflects intragenic recombination, has played an important role in nucleotide variation and a high number of recombination events (Hudson, 1983). Therefore, we can conclude that recent recombination events might have occurred between the Chinese and European isolates. Haplotype networks provide a better understanding of the coexistence of ancestral and derived haplotypes by providing an account for recombination (Huson and Bryant, 2006). Therefore, haplotype networks are intensively used in intraspecific analyses. We used a median-joining network in which the number of mutations separate haplotypes (Castelloe and Templeton, 1994). In each network, the ancestral haplotype was predicted based on rooting probability (Posada and Crandall, 2001). The analyses suggested that the most recent ancestry of the Chinese haplotypes was shared with the Spanish and Hungarian haplotypes. In addition, haplotypes from the UK and Czech Republic shared ancestry with Chinese haplotypes. Overall, the Diaporthe population in China is genetically diverse and might have an admixture population. The current population is likely derived from a combination of endemic D. eres strains and introduced strains from other regions.

Conclusion

Present study provides an account of Diaporthe species associated with Chinese vineyards by their phylogenetic placements. Collectively, in the present study, 111 Diaporthe strains were isolated and characterized into eight species using both morphological and molecular phylogenetic approaches. To identify those taxa, four gene regions were examined. The combination of ITS, CAL, β-tubulin, and EF-1α genes gave the best species delimitation in the genus Diaporthe. The present study introduced three novel taxa and three host records of Diaporthe associated with Chinese grapevines. The most abundant Diaporthe species was D. eres, which was moderately aggressive. D. gulyae was the most aggressive among the eight species on detached green shoots. The Chinese D. eres population was high in nucleotide diversity and haplotype diversity. In haplotype network analysis, the Chinese population was dispersed in the network but showed a certain degree of clustering according to their geographical origins. This result suggests that there is likely geographic structuring of D. eres in China. However, more in-depth analysis is required using more isolates from different provinces. Haplotype networks including Chinese and European isolates suggest a close relationship between the two populations. This is confirmed by the recombination among isolates from these two regions. Our results suggest that the D. eres population in China might be a result of an admixture. The results presented here provide opportunities for several fields, including grapevine breeding for disease-resistant cultivars, screening for new fungicides, and developing appropriate quarantine and management strategies to prevent and control grapevine dieback diseases.

Statements

Data availability statement

The sequence data generated in this study is deposited in NCBI GenBank (https://www.ncbi.nlm.nih.gov/genbank) and the respective accession numbers are given in Table 2. The Alignment generated in the present study available in TreeBASE (https://treebase.org/treebase-web/home.html) under the 24324.

Author contributions

JY and XL conceived the research. JY, IM, AD, XL, and WZ planned the basic research. ML, YZ, and WSZ provided materials. IM and AD conducted the experiments and prepared manuscript. IM, AD, DW, and JX analyzed data. KH, SB, and JY revised the manuscript. All authors read and approved the final manuscript.

Funding

This project was funded by Beijing Talent Programme for JY, CARS-29 and D171100001617002.

Acknowledgments

We would like to thank Milan Samarakoon for his guidance in developing phylogenetic trees. We would like to thank the students and non-academic staff of Beijing Key Laboratory of Environment Friendly Management on Fruit Diseases and Pests in North China, for their help with pathogenicity assays. DW would like to thank CAS President's International Fellowship Initiative (PIFI) for funding his postdoctoral research (No. 2019PC0008) as well as the National Science Foundation of China and the Chinese Academy of Sciences for his financial support under the following Grants: 41761144055, 41771063, and Y4ZK111B01.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1

    AlbertsB.JohnsonA.LewisJ.RaffM.RobertsK.WalterP. (2002). Introduction to Pathogens, in Molecular Biology of the Cell, 4th Edn (New York, NY: Garland Science). Available online at: https://www.ncbi.nlm.nih.gov/books/NBK26917

  • 2

    AndolfiA.BoariA.EvidenteM.CimminoA.VurroM.AshG.et al. (2015). Gulypyrones A and B and phomentrioloxins B and C produced by Diaporthe gulyae, a potential mycoherbicide for saffron thistle (Carthamus lanatus). J. Nat. Prod. 78, 623629. 10.1021/np500570h

  • 3

    BaiQ.ZhaiL.ChenX.HongN.XuW.WangG. (2015). Biological and molecular characterization of five Phomopsis species associated with pear shoot canker in China. Plant Dis. 99, 17041712. 10.1094/PDIS-03-15-0259-RE

  • 4

    BandeltH. J.ForsterP.RöhlA. (1999). Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16, 3748. 10.1093/oxfordjournals.molbev.a026036

  • 5

    BaumgartnerK.FujiyoshiP. T.TravadonR.CastleburyL. A.WilcoxW. F.RolshausenP. E. (2013). Characterization of species of Diaporthe from wood cankers of grape in eastern North American vineyards. Plant Dis. 97, 912920. 10.1094/PDIS-04-12-0357-RE

  • 6

    BleuvenC.LandryC. R. (2016). Molecular and cellular bases of adaptation to a changing environment in microorganisms. Proc. R. Soc.283:20161458. 10.1098/rspb.2016.1458

  • 7

    CarboneI.KohnL. M. (1999). A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia91, 553556. 10.1080/00275514.1999.12061051

  • 8

    CastelloeJ.TempletonA. R. (1994) Root probabilities for intraspecific gene trees under neutral coalescent theory. Mol. Phylogenet. Evol. 3, 102113. 10.1006/mpev.1994.1013

  • 9

    ChangC.XiP.XiangM.JiangZ.ChiP. (2005). New species of Phomopsis on woody plants in hunan province. Mycosystema2, 145154. Available online at: http://www.oalib.com/paper/1631068

  • 10

    CinelliT.MondelloV.MarchiG.BurruanoS.AlvesA.MugnaiL. (2016). First report of Diaporthe eres associated with cane blight of grapevine (Vitis vinifera) in Italy. Plant Dis. 100:532. 10.1094/PDIS-08-15-0872-PDN

  • 11

    CrousP. W.GroenewaldJ. Z.RisedeJ. M.SimoneauP.Hywel-JonesN. L. (2004). Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Stud. Mycol. 50, 415430. Available online at: http://edepot.wur.nl/31307

  • 12

    DaykinM. E.MilhollandR. D. (1984). Histopathology of ripe rot caused by Colletotrichum gloeosporioides on muscadine grape. J. Phytopathol. 74, 13391341. 10.1094/Phyto-74-1339

  • 13

    DissanayakeA. J.LiuM.ZhangW.ChenZ.UdayangaD.ChukeatiroteE.et al. (2015a). Morphological and molecular characterization of Diaporthe species associated with grapevine trunk disease in China. Fungal Biol. 119, 283294. 10.1016/j.funbio.2014.11.003

  • 14

    DissanayakeA. J.ZhangW.LiuM.HydeK. D.ZhaoW. S.LiX. H.et al. (2017). Diaporthe species associated with peach tree dieback in Hubei, China. Mycosphere8, 512528. 10.5943/mycosphere/8/5/2

  • 15

    DissanayakeA. J.ZhangW.MeiL.ChukeatiroteE.YanJ. Y.LiX.et al. (2015b). Lasiodiplodia pseudotheobromae causes pedicel and peduncle discolouration of grapes in China. Australas. Plant. Dis. 10:21. 10.1007/s13314-015-0170-5

  • 16

    DoilomM.DissanayakeA. J.WanasingheD. N.BoonmeeS.LiuJ. K.BhatD. J.et al. (2017). Microfungi on Tectona grandis (teak) in Northern Thailand. Fungal Divers.82, 107182. 10.1007/s13225-016-0368-7

  • 17

    FarrD. F.RossmanA. Y. (2019). Fungal Databases - Fungus-Host Distributions, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Available online at: http://nt.ars-grin.gov/fungaldatabases (accessed March 11, 2019).

  • 18

    FontaineF.GramajeD.ArmengolJ.SmartR.NagyZ. A.BorgoM.et al. (2016). Grapevine Trunk Diseases A Review, OIV Publications, 1st Edn. Paris.

  • 19

    GadouryD. M.Cadle-DavidsonL.WilcoxW. F.DryI. B.SeemR. C.MilgroomM. G. (2012). Grapevine powdery mildew Erysiphe necator: a fascinating system for the study of the biology, ecology and epidemiology of an obligate biotroph. Mol. Plant. Pathol. 13, 116. 10.1111/j.1364-3703.2011.00728.x

  • 20

    GaoY.LiuF.DuanW.CrousP. W.CaiL. (2017). Diaporthe is paraphyletic. Ima Fungus8, 153187. 10.5598/imafungus.2017.08.01.11

  • 21

    GaoY. H.LiuF.CaiL. (2016). Unravelling Diaporthe species associated with Camellia. Syst. Biodivers. 14, 102117. 10.1080/14772000.2015.1101027

  • 22

    GlassN. L.DonaldsonG. C. (1995). Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microb. 61, 13231330. Available online at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC167388/

  • 23

    GomesR. R.GlienkeC.VideiraS. I. R.LombardL.GroenewaldJ. Z.CrousP. W. (2013). Diaporthe: a genus of endophytic, saprobic and plant pathogenic fungi. Persoonia31, 141. 10.3767/003158513X666844

  • 24

    GramajeD.ArmengolJ. (2011). Fungal trunk pathogens in the grapevine propagation process: potential inoculum sources, detection, identification, and management strategies. Plant Dis. 95, 10401055. 10.1094/PDIS-01-11-0025

  • 25

    GreerL. A.HarperJ. D.SavocchiaS.SamuelianS. K.SteelC. C. (2011). Ripe rot of south-eastern Australian wine grapes is caused by two species of Colletotrichum: C. acutatum and C gloeosporioides with differences in infection and fungicide sensitivity. Aust. J. Grape. Wine. Res. 17, 123128. 10.1111/j.1755-0238.2011.00143.x

  • 26

    GuarnacciaV.CrousP. W. (2017) Emerging citrus diseases in Europe caused by Diaporthe spp. IMA Fungus8, 317– 334. 10.5598/imafungus.2017.08.02.07

  • 27

    GuarnacciaV.CrousP. W. (2018). Species of Diaporthe on Camellia and Citrus in the Azores Islands. Phytopathol. Mediter57, 307319. 10.14601/Phytopathol_Medi-terr-23254

  • 28

    GuarnacciaV.GroenewaldJ. Z.WoodhallJ.ArmengolJ.CinelliT.EichmeierA. (2018). Diaporthe diversity and pathogenicity revealed from a broad survey of grapevine diseases in Europe. Persoonia40, 135153. 10.3767/persoonia.2018.40.06

  • 29

    GuarnacciaV.VitaleA.CirvilleriG.AielloD.SuscaA.EpifaniF.et al. (2016). Characterisation and pathogenicity of fungal species associated with branch cankers and stem-end rot of avocado in Italy. Eur. J. Plant Pathol.146, 963976. 10.1007/s10658-016-0973-z

  • 30

    HallT. (2006). Bioedit. Department of Microbiology, North Carolina State University Available online at: http://www.mbio.ncsu.edu/BioEdit/page2.html

  • 31

    HofstetterV.BuyckB.CrollD.ViretO.CoulouxA.GindroK. (2012). What if esca disease of grapevine were not a fungal disease. Fungal Divers4, 5167. 10.1007/s13225-012-0171-z

  • 32

    HongS. K.KimW. G.YunH. K.ChoiK. J. (2008). Morphological variations, genetic diversity and pathogenicity of Colletotrichum species causing grape ripe rot in Korea. J. Plant Pathol. 24, 269278. 10.5423/PPJ.2008.24.3.269

  • 33

    HuangF.UdayangaD.WangX.HouX.MeiX.FuY.et al. (2015). Endophytic Diaporthe associated with Citrus: a phylogenetic reassessment with seven new species from China. Fungal. Biol. 119, 331347. 10.1016/j.funbio.2015.02.006

  • 34

    HudsonR. R. (1983). Properties of a neutral allele model with intragenic recombination. Theor. Popul. Biol. 23, 183201. 10.1016/0040-5809(83)90013-8

  • 35

    HudsonR. R.KaplanN. L. (1985). Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics111, 147164.

  • 36

    HusonD. H.BryantD. (2006). Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 23, 254267. 10.1093/molbev/msj030

  • 37

    HydeK. D.HongsananS.JeewonR.BhatD. J.McKenzieE. H. C.JonesE. B. G.et al. (2016). Fungal diversity notes 367-491: taxonomic and phylogenetic contributions to fungal taxa. Fungal. Divers. 80, 1270. 10.1007/s13225-016-0373-x

  • 38

    HydeK. D.NilssonR. H.AliasS. A.AriyawansaH. A.BlairJ. E.CaiL.et al. (2014). One stop shop: backbone trees for important phytopathogenic genera: I. Fungal. Divers.67, 21125. 10.1007/s13225-014-0298-1

  • 39

    JayasiriS. C.HydeK. D.AriyawansaH. A.BhatJ.BuyckB.CaiL.et al. (2015). The faces of fungi database: fungal names linked with morphology, molecular and human attributes. Fungal. Divers.74, 318. 10.1007/s13225-015-0351-8

  • 40

    JayawardenaR. S.ZhangW.LiuM.MaharachchikumburaS. S.ZhouY.HuangJ.et al. (2015). Identification and characterization of Pestalotiopsis-like fungi related to grapevine diseases in China. Fungal. Biol. 119, 348361. 10.1016/j.funbio.2014.11.001

  • 41

    JeewonR.HydeK. D. (2016) Establishing species boundaries new taxa among fungi: recommendations to resolve taxonomic ambiguities. Mycosphere7, 16691677. 10.5943/mycosphere/7/11/4

  • 42

    KajitaniY.KanematsuS. (2000). Diaporthe kyushuensis, sp. nov. the teleomorph of the causal fungus of grapevine swelling arm in Japan, and its anamorph Phomopsis vitimegaspora. Mycoscience. 41, 111114. 10.1007/BF02464318

  • 43

    KaliternaJ.MilicevićT.CvjetkovićB. (2012). Grapevine trunk diseases associated with fungi from the Diaporthaceae family in Croatian vineyards. Arch. Indust. Hygiene Toxicol. 63, 471479. 10.2478/10004-1254-63-2012-2226

  • 44

    KatohK.TohH. (2010). Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinform. 9, 286298. 10.1093/bib/bbn013

  • 45

    KellyJ. K. (1997). A test of neutrality based on interlocus associations. Genetics146, 11971206.

  • 46

    KishinoH.HasegawaM. (1989). Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data. J. Mol. Evol.29, 170179. 10.1007/BF02100115

  • 47

    KowalskiT.KrajW.BednarzB. (2016). Fungi on stems and twigs in initial and advanced stages of dieback of European ash Fraxinus excelsior in Poland. Eur. J. For. Res. 135, 565579. 10.1007/s10342-016-0955-x

  • 48

    KuoK. C.LeuL. S. (1998) Phomopsis vitimegaspora: a pathogenic Phomopsis from vines. Mycotaxon66, 497499.

  • 49

    LawrenceD. P.RenaudT.KendraB. (2015). Diversity of Diaporthe species associated with wood cankers of fruit and nut crops in northern California. Mycologia107, 926940. 10.3852/14-353

  • 50

    LehmanS. G. (1923). Pod and stem blight of soybean. Ann. Missouri Botan. Gardens10, 111178. 10.2307/2394035

  • 51

    LesuthuP.MostertL.SpiesC. F.MoyoP.RegnierT.HalleenF. (2019) Diaporthe nebulae sp. nov. and first report of D. cynaroidis, D. novem, and D. serafiniae on Grapevines in South Africa. Plant Dis.103, 808817. 10.1094/PDIS-03-18-0433-RE

  • 52

    LibradoP.RozasJ. (2009). DnaSPv5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics25, 14511452. 10.1093/bioinformatics/btp187

  • 53

    LindahlJ. F.GraceD. (2015). The consequences of human actions on risks for infectious diseases: a review. Infect. Ecol. and Epidemiol. 5:30048. 10.3402/iee.v5.30048

  • 54

    LiuJ. K.HydeK. D.JonesE. B. G.AriyawansaH. A.BhatD. J.BoonmeeS.et al. (2015). Fungal diversity notes 1–110: taxonomic and phylogenetic contributions to fungal species. Fungal. Divers.72, 1197. 10.1007/s13225-015-0324-y

  • 55

    LombardL.Van LeeuwenG. C.GuarnacciaV.PolizziG.Van RijswickP. C.RosendahlK. C.et al. (2014). Diaporthe species associated with Vaccinium, with specific reference to Europe. Phytopathol. Mediter.53, 287299. 10.14601/Phytopathol_Mediterr-14034

  • 56

    ManawasingheI. S.ZhangW.LiX.ZhaoW.ChethanaK. T.XuJ.et al. (2018). Novel microsatellite markers reveal multiple origins of Botryosphaeria dothidea causing the Chinese grapevine trunk disease. Fungal. Ecol.33, 134142. 10.1016/j.funeco.2018.02.004

  • 57

    Marin-FelixY.Hernández-RestrepoM.WingfieldM. J.AkulovA.CarnegieA. J.CheewangkoonR.et al. (2019) Genera of phytopathogenic fungi: GOPHY 2. Stud. Mycol. 92, 47133. 10.1016/j.simyco.2018.04.002

  • 58

    MathewF. M.AlananbehK. M.JordahlJ. G. (2015b). Phomopsis stem canker: a re-emerging threat to sunflower (Helianthus annuus) in the United States. Phytopathology105, 990997. 10.1094/PHYTO-11-14-0336-FI

  • 59

    MathewF. M.RashidK. Y.GulyaT. J. (2015a). First report of Phomopsis stem canker of sunflower (Helianthus annuus) caused by Diaporthe gulyae in Canada. Plant. Dis. 99, 160160. 10.1094/PDIS-08-14-0858-PDN

  • 60

    McDonalsB. M. (2004). Population Genetics of Plant Pathogens. The Plant Health Instructor. Available online at: https://doi.org/10.1094/PHI-A-2004-0524-01 (assessed Novermber 30, 2018).

  • 61

    MillerM. A.PfeifferW.SchwartzT. (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees, in Proceedings of the Gateway Computing Environments Workshop (GCE) 14 Nov 2010. Institute of Electrical and Electronics Engineers, New Orleans, LA,1-8. 10.1109/GCE.2010.5676129

  • 62

    MondalS. N.VincentA.ReisR. F.TimmerL. W. (2007). Saprophytic colonization of citrus twigs by Diaporthe citri and factors affecting pycnidial production and conidial survival. Plant Dis.91, 387392. 10.1094/PDIS-91-4-0387

  • 63

    MondelloV.SongyA.BattistonE.PintoC.CoppinC.Trotel-AzizP.et al. (2018). Grapevine trunk diseases: a review of fifteen years of trials for their control with chemicals and biocontrol agents. Plant. Dis. 102, 11891217. 10.1094/PDIS-08-17-1181-FE

  • 64

    MostertL.CrousP. W.KangJ. C.PhillipsA. J. (2001). Species of Phomopsis and a Libertella sp. occurring on grapevines with specific reference to South Africa: morphological, cultural, molecular and pathological characterization. Mycologia93, 146167. 10.1080/00275514.2001.12061286

  • 65

    Muntañola-CvetkovićM.MihaljčevićM.PetrovM. (1981). On the identity of the causative agent of a serious Phomopsis-Diaporthe disease in sunflower plants. Nova Hedwigia34, 417435.

  • 66

    NylanderJ. A. A. (2004). MrModeltest 2.0. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.

  • 67

    OIV (2016). (International Organization of vine and wine Intergovernmental Organization) World congress of vine and Wine. Statistical report on world vitiviniculture Bento Gonçalves Brazil. 28th October 2016.

  • 68

    PearsonR. C.GoheenC. (1994). Phomopsis cane and leaf spot, in Compendium of Grape Diseases, eds HewittW. B.PearsonR. C. (St Paul, MI: APS Press, 1718.

  • 69

    PennycookS. R. (1989). Plant Diseases Recorded in New Zealand, Vol. 3, Plant Disease DivisionAuckland: DSIR.

  • 70

    PetrovicK.VidicM.RiccioniL. (2015). First report of Diaporthe eres species complex causing seed decay of soybean in Serbia. Plant. Dis.99, 11861186. 10.1094/PDIS-01-15-0056-PDN

  • 71

    PiaoS.CiaisP.HuangY.ShenZ.PengS.LiJ.et al. (2010). The impacts of climate change on water resources and agriculture in China. Nature467, 4351. 10.1038/nature09364

  • 72

    PineT. S. (1958) Etiology of the dead-arm. Phytopathology48, 192197.

  • 73

    PineT. S. (1959) Development of the grape dead arm disease. Phytopathology49, 738743.

  • 74

    PosadaD.CrandallK. A. (2001). Intraspecific gene genealogies: trees grafting into networks. TREE16, 3745. 10.1016/S0169-5347(00)02026-7

  • 75

    PscheidtJ. W.PearsonR. C. (1989). Time of infection and control of Phomopsis fruit rot of Grape. Plant. Dis. 73, 82983310.1094/PD-73-0829

  • 76

    RawnsleyB.WicksT. J.StummerB. E.ScottE. S. (2006). The role of Diaporthe perjuncta, in delayed budburst and death of grapevine buds. Australas. Plant. Pathol.35, 265273.

  • 77

    RaynerR. W. (1970). A Mycological Colour Chart. Commonwealth Mycological Institute (Great Britain), & British Mycological Society.

  • 78

    RonquistF.HuelsenbeckJ. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed modelsBioinformatics19, 15721574. 10.1093/bioinformatics/btg180

  • 79

    RossmanA.UdayangaD.CastleburyL. A.HydeK. D. (2014). (2304) Proposal to conserve the name Diaporthe eres against twenty-one competing names (Ascomycota: Diaporthales: Diaporthaceae). Taxon63, 934935. 10.12705/634.23

  • 80

    SantosJ. M.VrandečićK.CosićJ.DuvnjakT.PhillipsA. J. (2011). Resolving the Diaporthe species occurring on soybean in Croatia. Persoonia27, 919. 10.3767/003158511X603719

  • 81

    SenanayakeI. C.CrousP. W.GroenewaldJ. Z.MaharachchikumburaS. S.JeewonR.PhillipsA. J. L.et al. (2017). Families of diaporthales based on morphological and phylogenetic evidence. Stud. Mycol. 86, 217296. 10.1016/j.simyco.2017.07.003

  • 82

    SilvestroD.MichalakI. (2010). RaxmlGUI: a Graphical Front-End for RAxML. Available online at: http://sourceforgenet/projects/raxmlgui/ (accessed February 25, 2019).

  • 83

    SogonovM. V.CastleburyL. A.RossmanA. Y.MejíaL. C.WhiteJ. F. (2008). Leaf-inhabiting genera of the gnomoniaceae, diaporthales. Stud. Mycol.62, 179. 10.3114/sim.2008.62.01

  • 84

    StamatakisA. (2014) RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics30, 13121313. 10.1093/bioinformatics/btu033.

  • 85

    StamatakisA.HooverP.RougemontJ. (2008). A rapid bootstrap algorithm for the RAxML web servers. Syst. Biol.57,758771. 10.1080/10635150802429642

  • 86

    StoykowD. Y.DenchevC. M. (2006). Current knowledge of Diaporthales (Ascomycota) in Bulgaria. Mycol. Balcan. 3, 179185. 10.5281/zenodo.2547618

  • 87

    StumpfM. P. (2004). Haplotype diversity and SNP frequency dependence in the description of genetic variation. Eur. J. Hum. Genet. 12, 469477. 10.1038/sj.ejhg.5201179

  • 88

    SwoffordD. L. (2003). PAUP: Phylogenetic Analysis Using Parsimony and Other Methods, Version 4 Sinauer Associates, Sunderland, Massachusetts.

  • 89

    TajimaF. (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics123, 585595.

  • 90

    ThomidisT.MichailidesT. J. (2009). Studies on Diaporthe eres as a new pathogen of peach trees in Greece. Plant. Dis.93, 12931297. 10.1094/PDIS-93-12-1293

  • 91

    ThompsonS. M.TanY. P.YoungA. J.NeateS. M.AitkenE. A. B.ShivasR. G. (2011). Stem cankers on sunflower Helianthus annuus in Australia reveal a complex of pathogenic Diaporthe (Phomopsis) species. Persoonia27, 8089. 10.3767/003158511X617110

  • 92

    TibprommaS.HydeK. D.BhatJ. D.MortimerP. E.XuJ.PromputthaI.et al. (2018). Identification of endophytic fungi from leaves of Pandanaceae based on their morphotypes and DNA sequence data from southern Thailand. MycoKeys33, 2567. 10.3897/mycokeys.33.23670

  • 93

    UdayangaD.CastleburyL. A.RossmanA. Y.ChukeatiroteE.HydeK. D. (2014b). Insights into the genus Diaporthe: phylogenetic species delimitation in the D. eres species complex. Fungal Div.67, 203229. 10.1007/s13225-014-0297-2

  • 94

    UdayangaD.CastleburyL. A.RossmanA. Y.ChukeatiroteE.HydeK. D. (2015). The Diaporthe sojae species complex: phylogenetic re-assessment of pathogens associated with soybean, cucurbits and other field crops. Fungal. Biol.119, 383407. 10.1016/j.funbio.2014.10.009

  • 95

    UdayangaD.CastleburyL. A.RossmanA. Y.HydeK. D. (2014a). Species limits in Diaporthe: molecular re-assessment of D citri, D cytosporella, D foeniculina and D rudis. Persoonia32, 83101. 10.3767/003158514X679984

  • 96

    UdayangaD.LiuX.McKenzieE. H.ChukeatiroteE.BahkaliA. H.HydeK. D. (2011). The genus Phomopsis: biology, applications, species concepts and names of common pathogens. Fungal. Divers.50, 189225. 10.1007/s13225-011-0126-9

  • 97

    UdayangaD.LiuX. X.CrousP. W.McKenzieE. H. C.ChukeatiroteE.HydeK. D. (2012b). Multilocus phylogeny of Diaporthe reveals three new cryptic species from Thailand. Cryptogam. Mycol. 33, 295309. 10.7872/crym.v33.iss3.2012.295

  • 98

    UdayangaD.LiuX. Z.CrousP. W.McKenzieE. H. C.ChukeatiroteE.HydeK. D. (2012a). A multi-locus phylogenetic evaluation of Diaporthe (Phomopsis). Fungal. Divers. 56,157171. 10.1007/s13225-012-0190-9

  • 99

    Úrbez TorresJ. R.O'GormanD. T. (2019). Grapevine Trunk Diseases in British Columbia: From Identification to Control. Summerland Research and Development Centre, Agriculture and Agri-Food Canada.

  • 100

    Úrbez-TorresJ. R. (2011). The status of Botryosphaeriaceae species infecting grapevines. Phytopathol. Mediterr. 50, 545. 10.14601/Phytopathol_Mediterr-9316

  • 101

    Úrbez-TorresJ. R.PedutoF.SmithR. J.GublerW. D. (2013) Phomopsis Dieback: a grapevine trunk disease caused by Phomopsis viticola in California. Plant. Dis.97, 15711579. 10.1094/PDIS-11-12-1072-RE

  • 102

    Van NiekerkJ. M.GroenewaldJ. Z.FarrD. F.FourieP. H.HalleerF.CrousP. W. (2005). Re-assessment of Phomopsis species on grapevines. Austr. Plant. Pathol.34, 2739. 10.1071/AP04072

  • 103

    WhiteC.HalleenF.FischerM.MostertL. (2011). Characterisation of the fungi associated with esca diseased grapevines in South Africa. Phytopathol. Mediterr. 50, 204223.

  • 104

    WhiteT. J.BrunsT.LeeS. J. W. T.TaylorJ. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols18, 315322. 10.1016/B978-0-12-372180-8.50042-1

  • 105

    WilcoxW. A.EllisM. A.RamsleyB.RossamanA.PscheidtJ. (2015). Phomopsis cane and leaf spot, in Compendium of Grape Diseases, Disorders, and Pests, 2nd Edn, eds WilcoxW. F.GublerW. D.UyemotoJ. K. (S. Paul, MN: APS Press), 4651. 10.1094/9780890544815

  • 106

    WuH.YangH.YouX.LiY. (2012). Isolation and characterization of saponin-producing fungal endophytes from Aralia elata in Northeast China. Int. J. Mol. Sci. 13, 1625516266. 10.3390/ijms131216255

  • 107

    XuJ. (2006). Fundamentals of fungal molecular population genetic analyses. Curr. Issues. Mol. Boil.8, 7590. 10.21775/cimb.008.075

  • 108

    YanJ. Y.JayawardenaM. M. R. S.GoonasekaraI. D.WangY.ZhangW.LiuM.et al. (2015). Diverse species of Colletotrichum associated with grapevine anthracnose in China. Fungal. Divers.71, 233246. 10.1007/s13225-014-0310-9

  • 109

    YanJ. Y.XieY.ZhangW.WangY.LiuJ. K.HydeK. D.et al. (2013). Species of Botryosphaeriaceae involved in grapevine dieback in China. Fungal. Divers.61, 221236. 10.1007/s13225-013-0251-8

  • 110

    YanJ. Y.ZhaoW. S.ChenZ.XingQ. K.ZhangW.ChethanaK. W. T.et al. (2018). Comparative genome and transcriptome analyses reveal adaptations to opportunistic infections in woody plant degrading pathogens of Botryosphaeriaceae. DNA Res. 25, 87102. 10.1093/dnares/dsx040

  • 111

    YangQ.FanX. L.GuarnacciaV.TianC. M. (2018). High diversity of Diaporthe species associated with twelve new species described. MycoKeys39, 97149. 10.3897/mycokeys.39.26914

  • 112

    ZhangW.ManawasingheI. S.ZhaoW.XuJ.BrooksS.ZhaoX.et al. (2017). Multiple gene genealogy reveals high genetic diversity and evidence for multiple origins of Chinese Plasmopara viticola population. Sci. Rep.7:17304. 10.1038/s41598-017-17569-7

Summary

Keywords

novel species, new host record, network analysis, phylogeography, phomopsis

Citation

Manawasinghe IS, Dissanayake AJ, Li X, Liu M, Wanasinghe DN, Xu J, Zhao W, Zhang W, Zhou Y, Hyde KD, Brooks S and Yan J (2019) High Genetic Diversity and Species Complexity of Diaporthe Associated With Grapevine Dieback in China. Front. Microbiol. 10:1936. doi: 10.3389/fmicb.2019.01936

Received

21 May 2019

Accepted

06 August 2019

Published

02 September 2019

Volume

10 - 2019

Edited by

Giorgio Gambino, Institute for Sustainable Plant Protection (CNR), Italy

Reviewed by

Vladimiro Guarnaccia, University of Turin, Italy; Francois Halleen, Agricultural Research Council of South Africa (ARC-SA), South Africa

Updates

Copyright

*Correspondence: Jiye Yan

This article was submitted to Plant Microbe Interactions, a section of the journal Frontiers in Microbiology

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics