ORIGINAL RESEARCH article

Front. Microbiol., 31 October 2022

Sec. Infectious Agents and Disease

Volume 13 - 2022 | https://doi.org/10.3389/fmicb.2022.1046640

Biochemical and functional characterization of Brucella abortus cyclophilins: So similar, yet so different

  • 1. Instituto de Investigaciones Biotecnológicas, Universidad Nacional de San Martín (UNSAM)-Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Buenos Aires, Argentina

  • 2. Escuela de Bio y Nanotecnologías (EByN), Universidad Nacional de San Martín, Buenos Aires, Argentina

Article metrics

View details

3

Citations

2,6k

Views

825

Downloads

Abstract

Brucella spp. are the etiological agent of animal and human brucellosis. We have reported previously that cyclophilins of Brucella (CypA and CypB) are upregulated within the intraphagosomal replicative niche and required for stress adaptation and host intracellular survival and virulence. Here, we characterize B. abortus cyclophilins, CypA, and CypB from a biochemical standpoint by studying their PPIase activity, chaperone activity, and oligomer formation. Even though CypA and CypB are very similar in sequence and share identical chaperone and PPIase activities, we were able to identify outstanding differential features between them. A series of differential peptide loops were predicted when comparing CypA and CypB, differences that might explain why specific antibodies (anti-CypA or anti-CypB) were able to discriminate between both cyclophilins without cross-reactivity. In addition, we identified the presence of critical amino acids in CypB, such as the Trp134 which is responsible for the cyclosporin A inhibition, and the Cys128 that leads to CypB homodimer formation by establishing a disulfide bond. Here, we demonstrated that CypB dimer formation was fully required for stress adaptation, survival within HeLa cells, and mouse infection in B. abortus. The presence of Trp134 and the Cys128 in CypB, which are not present in CypA, suggested that two different kinds of cyclophilins have evolved in Brucella, one with eukaryotic features (CypB), another (CypA) with similar features to Gram-negative cyclophilins.

Introduction

Cyclophilins are enzymes that belong to the superfamily of peptidyl-prolyl cis/trans isomerases (PPIases: EC 5.2.1.8). These enzymes act as biological catalysts speeding up the rate-limiting cis/trans or trans/cis conformational changes at Xaa-Pro bonds during protein folding in both eukaryotes and prokaryotes. The spontaneous isomerization of the peptidyl proline bonds is a slow reaction and consequently requires the assistance of PPIases that accelerates this step during protein folding. In addition to the cyclophilins, the superfamily of PPIases, also includes the FK506-binding proteins (FKBPs) and the parvulins, a classification that is based on their structure and specific inhibitor compound. Thus, while cyclophilins are inhibited by the immunosuppressive cyclosporin A (CsA), the FKBPs and parvulins are inhibited by the compounds FK506, and rapamycin, respectively (Galat, 2003; Fanghanel and Fischer, 2004).

Cyclophilins are either small single-domain proteins or large multi-domain ones (Pemberton, 2006; Krucken et al., 2009). In the case of the multi-domain cyclophilins, it has been described that additionally to the cyclophilin domain there are also protein domains that act as chaperones or promote the oligomerization state of the protein. Interestingly, even though single-domain cyclophilins are devoid of a canonical chaperone protein domain they can still present certain chaperone activity, which in some cases it has been shown to be independent of the PPIase catalytic activity (Dimou et al., 2011; Zhang et al., 2013; Pandey et al., 2016). Moreover, it has been described that some of the single-domain cyclophilins are still able to oligomerize (Zhang et al., 2011; Jakob et al., 2016).

Of relevance, the over-expression of many cyclophilin-encoding genes is triggered in response to a variety of stressors, suggesting a possible function of cyclophilins (Cyps) in stress adaptation. In agreement with this, microbial Cyps have been described to improve microbial survival under stress conditions and to be upregulated upon host-cell internalization, suggesting a possible function of these proteins in microbial-host interaction (Dimou et al., 2017). Interestingly, the critical role of PPIases in stress tolerance and pathogenesis of bacteria has been demonstrated in Yersinia pseudotuberculosis (Obi et al., 2011), Streptococcus pneumoniae (Hermans et al., 2006), Enterococcus faecalis (Reffuveille et al., 2012), Streptococcus gordoni (Cho et al., 2013), Mycobacterium tuberculosis (Pandey et al., 2017), Staphylococcus aureus (Wiemels et al., 2017; Keogh et al., 2018), Legionella pneumophila (Rasch et al., 2019), Burkholderia pseudomallei (Bzdyl et al., 2019), and Salmonella Typhimurium (Kumawat et al., 2020).

Brucellosis is a worldwide zoonotic disease caused by the intracellular bacterial pathogen, Brucella spp. Brucella spp. are Gram-negative bacteria that belongs to the α-2 group of Proteobacteria, a bacterial group characterized for living in close association with eukaryotic hosts such as plants or mammals (Corbel, 1997). Brucella infection causes abortion and sterility in animals, and undulating fever and debilitating disorders in humans, resulting in a serious public health problem and economic losses (de Figueiredo et al., 2015). Brucella virulence relies on its ability to adapt to an intracellular lifestyle within the host cells. To gain insight into the molecular mechanisms involved in intracellular adaptation and virulence of Brucella, we performed a comparative proteome analysis of Brucella grown in culture media or recovered from Brucella infected macrophages using two complementary technologies: 2D gel (Roset et al., 2013) and iTraq isobaric tag (Roset et al., 2017). We demonstrated through 2D gel analysis, that, upon intracellular localization, B. abortus over-expresses two PPIases (BAB1_1117 and BAB1_1118), belonging to the cyclophilin family (COG0652), referred to as CypB and CypA, respectively. Analysis of their function by mutagenesis and subsequent characterization showed that they are involved in stress adaptation, intracellular survival, and Brucella virulence (Roset et al., 2013). In this report, we characterized CypA and CypB from a biochemical and functional standpoint exploring the role of the cyclophilins in Brucella-host cell interaction.

Materials and methods

Bacterial strains and growth conditions

Bacterial strains and plasmids used are shown in Table 1. Escherichia coli strains were grown in Luria-Bertani (LB) media at 37°C on a rotatory shaker (250 rpm) or in LB agar for 16–24 h. Brucella abortus strains were grown in tryptic soy agar (TSA) or tryptic soy broth (TSB) media at 37°C on a rotatory shaker (250 rpm) for 16–24 h. When necessary, media were supplemented with the following antibiotics: kanamycin (km), 50 μg/ml, ampicillin 100 μg/ml, or nalidixic acid 5 μg/ml. Experiments involving live Brucella were performed in a Biosafety level 3 (BSL3) facility at the University of San Martín, Buenos Aires, Argentina.

Table 1

Strain or plasmidGenotype or phenotypeReference or source
Strains
Escherichia coli
BL21 DE3F- ompT hsdSB (rBmB-) gal dcm (DE3)Stratagen
TOP10F-mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15-Δ lacX74 recA1 araD139Δ(araleu)7697 galU galK rpsL (StrR) endA1 nupGInvitrogen
DH5α F’IQF´ Φ80dlacZΔM15 Δ(lacZYA-argF) U169 deoR recA1 endA1 hsdR17(rK+ mK+) phoA+ supE44 λthi-1 gyrA96 relA1/F´ proAB+ lacIqZΔM15 zzf::Tn5 (Kmr)Invitrogen
S17.1 (λ pir)λ lysogenic S17-1 derivative producing π protein for replication of plasmids carrying oriR6K, NalSHerrero et al. (1990)
Brucella abortus
Wild type 2,308Wild, smooth, virulent strain, NalrLaboratory stock
2,308 (pfcypB)B. abortus 2,308 with plasmid pfcypB, AmprThis study
2,308 (pfcypBR59A/F64A)B. abortus 2,308 with plasmid pfcypBR59A/F64A, AmprThis study
ΔcypAB mutantB. abortus 2,308 double mutant by deletion of the cypA and cypB genesRoset et al. (2013)
ΔcypAB(pcypAf)B. abortus ΔcypAB mutant with plasmid pcypAf, AmprThis study
ΔcypAB(pfcypB)B. abortus ΔcypAB mutant with plasmid pfcypB, AmprThis study
ΔcypAB(pfcypBR59A/F64A)B. abortus ΔcypAB mutant with plasmid pfcypBR59A/F64A, AmprThis study
ΔcypAB(pfcypBC128M)B. abortus ΔcypAB mutant with plasmid pfcypBC128M, AmprThis study
Plasmids
pET-28a(+)Bacterial cloning vector with T7lac promoter that carries in the N-terminal a His-Tag / thrombin / T7-Tag configuration, an optional His-Tag sequence in the C-terminal and kanamycin resistance gene.EMD Biosciences
pET-28-cypA510 pb BamHI/XhoI fragment containing the B. abortus 2,308 cypA gene starting at position 82 bp, cloned into pET-28a(+), Kmr.This study
pET-28-cypB492 pb BamHI/XhoI fragment containing the B. abortus 2,308 cypB gene starting at position 37 bp, cloned into pET-28a(+), Kmr.This study
pET-28-cypBR59A/F64A492 pb BamHI/XhoI fragment containing the B. abortus 2,308 cypBR55A/F60A mutant gene starting at position 37 bp, cloned into pET-28a(+), Kmr.This study
pET-28-cypBW134F492 pb BamHI/XhoI fragment containing the B. abortus 2,308 cypBW134F mutant gene starting at position 37 bp, cloned into pET-28a(+), KmrThis study
pET-28-cypBC128M492 pb BamHI/XhoI fragment containing the B. abortus 2,308 cypBC128M mutant gene starting at position 37 bp, cloned into pET-28a(+), Kmr.This study
pET-28-cypB(L2cypA)534 bp NheI/XhoI fragment containing the B. abortus 2,308 cypB gene starting at position 37 bp, where loop-2 from cypB (289–294 bp) was replaced by loop-2 of cypA (310–336 bp), cloned into pET-28a(+), Kmr.This study
pET-28-cypB(L3cypA)525 bp NheI/XhoI fragment containing the B. abortus 2,308 cypB gene starting at position 37 bp, where loop-3 from cypB (478–489 bp) was replaced by loop-3 of cypA (523–546 bp), cloned into pET-28a(+), Kmr.This study
pET-28-cypB(L2-L3cypA)534 bp NheI/XhoI fragment containing the B. abortus 2,308 cypB gene starting at position 37 bp, where loop-2 (289–294 bp) and loop-3 from cypB (478–489 bp) were replaced by loop-2 (310–336 bp) and loop-3 (523–546 bp) of cypA respectively, cloned into pET-28a(+), Kmr.This study
pET-28-cypA(L1cypB)552 bp NheI/XhoI fragment containing the B. abortus 2,308 cypA gene starting at position 82 bp, where loop-1 from cypA (268–297 bp) was replaced by loop-1 of cypB (223–276 bp), cloned into pET-28a(+), Kmr.This study
pcypBR55A/F60AB. abortus cypBK55A/F60A gene cloned into pDK51, AmprRoset et al. (2013)
pET-21-eGFPDerived from pET21b, expresses eGFP fusion protein, Kmr.Fina Martin et al. (2019)
pDCyaACloning vector for C-terminus fusion to CyaA under bcsp31 gene promoter, AmprMarchesini et al. (2011)
pcypAf657-bp BamHI/SacII synthetic fragment containing full-length B. abortus cypA gene and 3flag, cloned into pDCyaA, AmprThis study
pfcypB0.6-kb BamHI/SacII synthetic fragment containing 3flag and the B. abortus 2,308 full-length cypB gene, cloned into pDCyaA, AmprThis study
pfcypBR59A/F64A0.6-kb BamHI/SacII synthetic fragment containing 3flag and the B. abortus 2,308 full-length cypB gene where Arg59 and Phe64 were replaced by Ala, cloned into pDCyaA, AmprThis study
pfcypBC128M0.6-kb BamHI/SacII synthetic fragment containing 3flag and the B. abortus 2,308 full-length cypB gene where Cys128 was replaced by Met, cloned into pDCyaA, AmprThis study

Bacterial strains and plasmids used in this study.

Ampr, ampicillin resistance; Nalr, nalidixic acid resistance; Kmr, kanamycin resistance.

Cloning

cypB and cypBR59A/F64A genes were amplified from Brucella genomic DNA or pcypBR55A/F60A plasmid, respectively, by PCR using the oligonucleotides (pFWCypBBamHI CGGGATCCGACCCAGAAAATACGCTCG and pRVCypBXhoI CCCTCGAGTCAGTCGGCGGCGATACG). Amplicons were digested with BamHI and XhoI restriction enzymes and cloned in pET-28a(+) vector from Novagen.

Synthetic genes, synthesized by Gene Universal Inc. (United States), cypA, cypBC128M, cypBW134F, cypB(L2cypA), cypB(L3cypA), cypB(L2-L3cypA), and cypA(L1cypB) were cloned in pET-28a (+). Genes cypA3flag, 3flagcypB, 3flagcypBR59A/F64A, and 3flagcypBC128M were cloned in pBlueScript II SK(+) and then digested with BamHI and SacII and subcloned in pDCyaA plasmid.

Electroporation of the E. coli strain was performed with the Pulser-BioRad electroporator according to the manufacturer’s protocol.

Brucella abortus complementation

Brucella abortus ΔcypAB mutant was genetically complemented by introducing p3flagcypA, p3flagcypB, p3flagcypBR59A/F64A, and p3flagcypBC128M plasmids by biparental mating using E. coli S17.1 as donor strain (Ditta et al., 1980). Brucella complemented strains were selected in ampicillin and nalidixic acid TSA plates, and the presence of different cyclophilins were confirmed by PCR and Western blot analysis (anti-CypA and anti-CypB antibodies).

Brucella abortus 2,308 was genetically transformed by introducing p3flagcypB or p3flagcypBR59A/F64A plasmids by biparental mating using E. coli S17.1 as donor strain (Ditta et al., 1980). Brucella transformed strains were selected in ampicillin and nalidixic acid TSA plates, and the presence of different cyclophilins were confirmed by PCR and Western blot analysis (anti-3FLAG antibody).

Purification of recombinant proteins

His-tagged recombinant proteins (CypA, CypB, CypBR59A/F64A, CypBC128M, CypBW134F CypA(L1CypB), CypB(L2CypA), CypB(L3CypA), CypB(L2-L3CypA), and GFP) were expressed in E. coli and purified using nickel affinity chromatography. Briefly, E. coli strains were grown at 37°C at 200 rpm and the expression was induced with 0.1 mM IPTG at A600 = 0.5. Two hours post-induction cells were harvested at 7000 X g and lysed by sonication. Recombinant proteins were purified from soluble fractions with the HisTrap™ HP column (GE Healthcare). Elution was performed with an imidazole gradient (20 to 500 mM). Fractions with recombinant proteins were dialyzed and quantified with NanoDrop One Microvolume UV–Vis Spectrophotometer (Thermo Fischer). Expression was confirmed by Western blotting. The predicted molecular weight of the recombinant proteins are: 21.5 kDa (CypA), 21.1 kDa (CypB), 21.0 kDa (CypBR59A/F64A), 20.2 kDa (CypBC128M), 20.1 kDa (CypBW134F), 21.0 kDa (CypA(L1CypB)), 20.9 kDa (CypB(L2CypA)), 20.5 kDa (CypB(L3CypA)), 21.3 kDa (CypB(L2-L3CypA)), and 46.6 kDa (GFP).

Protein analysis

Protein samples were suspended in cracking buffer (2% SDS, 10% Glycerol, 60 mM Tris-Cl pH 6.8, 0.01% Bromophenol Blue, and 100 mM DTT) and incubated for 5 min at 100°C. Protein electrophoresis was performed at 120 V on a 12% SDS-PAGE gel. Gels were stained in Coomassie-Blue solution (20% methanol, 10% acetic acid).

For Western Blot analysis, proteins were transferred to a nitrocellulose membrane (Immobilon – Merck Millipore Ltd) for 55 min at 15 V using a semi-dry electroblotting transfer unit (Bio-Rad, Hercules, CA, USA). Membranes were incubated for 1 h with blocking buffer (1% dry skim milk, 0.1% Tween in PBS) and then incubated for 1 h with primary antibody diluted in blocking buffer (1/500). After washing with PBS-0.1%Tween, membranes were incubated for 1 h with secondary antibody labeled with IRDye fluorophores (LI-COR, Lincoln, NE, United States) diluted in blocking buffer (1/20,000). Finally, the membranes were scanned using the Odyssey Imaging System (LI-COR).

Proteins were quantified with the UV–Vis NanoDrop One spectrometer (Thermo Scientific).

Antibodies generation

BALB/c mice were immunized intraperitoneally with a volume of 200 μl containing 10 μg of the different purified recombinant proteins (CypA or CypB) using aluminum hydroxide as an adjuvant. Boosters with 5 μg of protein were further performed at 2 and 4 weeks. One week after the last immunization, the mice were bled, and the serum was stored at −20°C for later use.

PPIase activity measurement

Determination of the PPIase activity of recombinant cyclophilins was performed as described (Mares et al., 2011). Briefly, a 5 μM acid denatured Green Fluorescent Protein (GFP) solution was prepared by diluting 10 μM GFP solution in denaturation buffer (150 mM NaCl, 50 mM Tris–HCl, pH 7.5) with an equal volume of 125 mM HCl solution. The mixture was incubated for 1 min at room temperature verifying the denaturation with fluorescence measurements. Then, the 2.5 μM denatured GFP solution was diluted 1:100 in refolding buffer (25 mM MgCl2, 100 mM KCl, 50 mM Tris–HCl, pH 7.5) in the absence or presence of cyclophilins in different concentrations. The reaction was carried out in a final volume of 200 μl at room temperature measuring the fluorescence for 20 min on the FilterMax F5 spectrometer at 485 nm excitation and 538 nm emission wavelengths.

PPIase inhibition assay was performed as it was described for activity measurement but with the addition of different concentrations of CsA (0, 5, 10, 15, and 20 μM) to the reaction mix in the presence of 2 μM of cyclophilin.

To estimate change percentage in GFP refolding assay, fluorescence value corresponding to 15-min reaction was compared. Signal corresponding to the basal control (spontaneous refolding of GFP) was considered as 0% of PPIase activity. PPIase activity of CypB (that was the highest activity in our assay) was selected as 100%.

Chaperone activity assay: residual activity of denatured NdeI

The optimal denaturation temperature for the restriction enzyme NdeI was determined. For this, 1 U of enzyme in NEB 3.1 buffer was heated at different temperatures in the range of interest for 20 min. Then, 150 ng of pET28a (+) plasmid were added and incubated for 1 h at 37°C to digest. Restriction digestion of pET28a (+) plasmid was analyzed by 1% agarose gel electrophoresis.

To analyze the chaperone activity of the recombinant proteins, the method already described was adapted (Pandey et al., 2016). Briefly, 1, 2.5, and 5 μg of CypA, CypB, CypBR59A/F64A, CypBC128M, or 5 μg of BSA (control) were mixed with 1 U of enzyme NdeI in NEB 3.1 buffer and heated at 53.8°C for 20 min (optimal denaturation temperature). The residual NdeI activity was measured by digesting 150 ng of pET28a (+) plasmid for 1 h at 37°C. The result of the digestion was analyzed by electrophoresis on 1% agarose gel, stained with ethidium bromide, and subsequent UV visualization.

Cell culture and infection assay

HeLa cells were maintained at 37°C in a 5% CO2 atmosphere in Dulbecco modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum and streptomycin (50 μg/ml)-penicillin (50 U/ml). 5 × 104 cells per well were seeded on 24-well plates and kept for 24 h in antibiotic-free DMEM. Infection with B. abortus was carried out with a multiplicity of infection (MOI) of 1,000: 1.

First, cells were incubated for 60 min with the bacteria. Then, to eliminate non-internalized bacteria, wells were washed five times with phosphate-buffered saline (PBS) and incubated with a fresh medium supplemented with 50 μg/ml gentamicin and 100 μg/ml streptomycin. Finally, infected cells at 4 h post-infection were washed with PBS five times and lysed with 500 μl 0.1% Triton X-100. Intracellular CFU was determined by plating serial dilutions in TSA with the corresponding antibiotics.

Sensitivity to deoxycholate assay (DOC)

Brucella abortus cultures were adjusted to a standardized optical density at λ = 600 nm (OD600) and suspended in 1 ml of PBS. Immediately, cultures were serially diluted in PBS and plated in TSA plates containing 1,000 μg/ml deoxycholate. Plates were incubated for 3 days at 37°C.

Mouse infection assay

Before inoculation, 0.1 ml of 10% sodium bicarbonate was administrated to groups of five female BALB/c mice. Oral infection was performed with a volume of 200 μl containing 109 CFU of Brucella. Mice were euthanized at 6 weeks after infection and bacteria were recovered from the spleens. Spleens were homogenized in 2 ml of PBS, and serial dilutions were plated on TSA.

ELISA assay

Enzyme-linked immunosorbent assay was performed as published (Uriza et al., 2020). Briefly, wells were coated with 125 ng of recombinant proteins in 50 μl of buffer (0.5 M carbonate–bicarbonate pH 9.6). Wells were washed four times (0.1% Tween 20 in PBS buffer). Then, 50 μl of primary antibodies α-CypA or α-CypB per well (1:500) were incubated for 1 h. After that, wells were washed again four times and incubated for 1 h with HRP-anti-mouse IgG (1, 1,000). Finally, wells were washed and incubated for 10 min with 50 μl of substrate solution containing 3, 3′,5,5’ Tetramethylbenzidine (Sigma) and 50 μl of stopping solution for 10 min. Absorbance was measured in the FilterMax F5 Microplate Reader at 450 nm.

Protein structure modeling

Protein structure modeling and comparison between CypA and CypB protein structures were conducted by SWISS-MODEL1 and UCSF Chimera 1.14 software, respectively (Meng et al., 2006).

Sequences alignment

Sequences alignment comparison of CypA and CypB was done with UCSF Chimera 1.14 (Meng et al., 2006).

Statistical analysis

GraphPad Prism 5 software was used to perform graphs and statistical analyses. One-way analysis of variance (ANOVA) with Bonferroni post-hoc test and Two-way ANOVA-Tukey’s multiple comparison test (within each row, compare columns) were used to analyze statistical significance.

Results

Brucella’s Cyps have in common a typical core domain of the cyclophilin fold but present different structural characteristics

A three-dimensional structural model of the cyclophilins CypA and CypB from B. abortus was built, showing that both Cyps have in common several secondary structural features. As shown in Figure 1A, the cyclophilin domain of both CypA and CypB share eight stranded antiparallel β-barrel with two α-helix covering the top and the bottom of the barrel, which is consistent with other structures from the cyclophilin family, such as the human PpiA and the E. coli EcCypB (Ke et al., 1991; Ke, 1992; Edwards et al., 1997). However, the 3D structure modeling of both cyclophilins was also able to reveal some differences in their structure over three peptide loops (Figures 1B,C). As shown in Figures 1B,C and Figure 2, catalytic active sites of both Cyps are completely conserved suggesting that both cyclophilins can potentially recognize similar protein substrates. Sequence alignment and 3D models also highlighted the presence of a critical tryptophan at position 134 of the CypB sequence (Trp134) which is absent in Brucella CypA and replaced by a phenylalanine in the equivalent position (Phe121). As shown in Figure 2, this critical tryptophan is also present within the active site of the human hCyp18 and absent in the E. coli EcCypB, where it is also replaced by phenylalanine. Of particular interest, it has been reported that this conserved tryptophan is critical for the interaction with the immunosuppressor compound cyclosporin A (CsA) in all the described eukaryotic Cyps (Bossard et al., 1991; Liu et al., 1991). Differently, in cyclophilins derived from gram negative-bacteria, this critical tryptophan is absent, a modification that correlates with the CsA-insensitivity observed for these Cyps (Liu and Walsh, 1990; Liu et al., 1991). Another feature, which is characteristic of eukaryotic cyclophilins (eCyps), is the presence of cysteines along their amino acid sequence (Liu et al., 1990) that in some cases have been reported to modulate the PPIase activity (Motohashi et al., 2003; Gourlay et al., 2007). Interestingly, Brucella CypB has a single cysteine in its sequence which is not conserved in Brucella CypA (Figure 1C).

Figure 1

Figure 2

Considering that differences between Brucella CypA and CypB might reflect diverse physiological functions we decided to characterize both Cyps from a biochemical and functional standpoint. With that in mind, genes encoding CypA or CypB were recombinantly expressed in E. coli BL21 (DE3) and further purified using Ni-NTA chromatography as described in Materials and Methods (Figure 3A). These recombinant proteins were used for the characterization of biochemical activities.

Figure 3

Brucella cyclophilins CypA and CypB exhibit PPIase activity, but only CypB is inhibited By cyclosporin A

The B. abortus cyclophilins CypA and CypB present a typical isomerase domain, containing residues involved in PPIase activity (Figures 1C, 2). To confirm if Brucella CypA and CypB are functional PPIases, their enzymatic determination was performed with purified recombinant cyclophilins, as described by Mares et al. (2011). To test cyclophilin enzymatic activity, refolding of acid-denatured GFP was adapted for PPIase determination since proline isomerization is the limiting step in the refolding process of GFP (Andrews et al., 2007). As shown in Figure 3B, the addition of CypA or CypB resulted in a highly significant improvement (p < 0.0001) in the refolding of the acid-denatured GFP confirming their true enzymatic activity. Interestingly, results from the GFP refolding assay showed that CypB presented a higher rate of reaction compared with CypA that presented an activity reduction of 25% (Figure 3B). To confirm PPIase activity, a double point mutation was performed in CypB to replace two amino acids reported to be critical for PPIase activity (R59A and F64A; Zydowsky et al., 1992). The resulting recombinant protein CypBR59A/F64A was expressed and purified (Figure 3A) and used in the GFP refolding assay. As shown in Figure 3B, CypBR59A/F64A displayed a 45% diminished PPIase activity compared with CypB.

As shown in Figures 1C, 2, a comparative analysis of the amino acid sequence between CypA and CypB revealed the presence of some features in CypB which are characteristic of eukaryotic cyclophilins like the presence of a critical tryptophan (Trp134), an amino acid predicted to be involved in the CsA interaction (Bossard et al., 1991; Liu et al., 1991). Thus, we explored the inhibition effect of CsA on the enzymatic activity of CypA and CypB of B. abortus. After the preincubation with increasing concentrations of CsA, the PPIase activity was highly significantly inhibited (p < 0.0001) in a dose-dependent manner in the case of CypB (more than 50% inhibition with 15 μM; Figure 4A), but not in CypA (Figure 4B). CsA inhibition of CypB was abolished in the case of CypBW134F mutant, where tryptophan, was replaced for phenylalanine (Figures 4C,D). Altogether, these results are in accordance with the in-silico prediction that CypB behaves in terms of CsA inhibition like a eukaryotic cyclophilin.

Figure 4

Brucella abortus cyclophilins CypA and CypB protect NdeI from thermal inactivation

It has been described that some cyclophilins, in addition to their PPIase activity, also have chaperone activity (Dimou et al., 2011; Zhang et al., 2013; Pandey et al., 2016). Therefore, we investigated whether CypA and CypB recombinant proteins of B. abortus were able to prevent the thermal denaturation of the restriction enzyme NdeI, an assay used to determine chaperone activity. The ability of NdeI to digest the pET-28a(+) plasmid in 1 h at 37°C after thermal denaturation (53.8°C for 20 min), was evaluated in the presence or absence of cyclophilins. As shown in Figure 5, pET-28a(+) plasmid (lane 1) when was incubated with native NdeI was fully digested (lane 2). In absence of cyclophilins or in presence of BSA as a control, NdeI enzyme activity was completely inactivated by the heat treatment and therefore was not able to cut and linearize the pET-28a(+) plasmid (Figure 5, lane 3–4). Interestingly, the addition of increasing concentrations of CypA or CypB during the heat treatment protected NdeI from thermal inactivation (Figure 5, lanes 5–10). These results demonstrated that both cyclophilins have chaperone-like activity. To determine if this chaperone-like activity was dependent on PPIase activity, the double point mutant CypBR59A/F64A was also analyzed. As shown in Figure 5, lanes 11–13, CypBR59A/F64A protects against thermal denaturation to the same extent as CypB, indicating that chaperone-like activity is independent of the PPIase activity.

Figure 5

Brucella abortus cyclophilins CypA and CypB present different immunodominant loops in their structure

To generate molecular tools for this research, recombinant proteins CypA and CypB were used as antigens to produce antibodies in mice. As shown in Figure 6A, when evaluating mouse sera, we found that antibodies raised against CypA were not able to recognize the recombinant CypB and vice versa. As shown in Figure 6B, the same was also observed in whole-cell lysates of B. abortus 2,308, B. abortuscypAB (pcypA), and B. abortuscypAB(pcypB). As expected, no signal was detected for the whole-cell lysate of B. abortuscypAB mutant either with α-CypA or α-CypB antibodies. These results are remarkable because, although CypA and CypB share a 63% of identity in the amino acid sequence, the immune system still was able to reveal structural differences existing between both cyclophilins. As shown in Figure 6C,D, these antigenic differences can be potentially mapped on three differential amino acid loops. Interestingly, analysis of CypA and CypB sequences by the BepiPred-2.0 algorithm predicted a series of differential linear epitopes that can be located within these differential loops (Figures 6C,D). To pinpoint which peptide loop is contributing to the antibody differential recognition, an experimental approach of swapping loops between CypA and CypB was performed (Figure 6E). Based on the 3D structure prediction, it was observed that formation of loop-1 was determined by the interloop (i-Loop) region (Figures 6D,E). Consequently, we swapped loop1 + i-Loop either of CypA or CypB. To analyze linear and conformational epitopes of CypA, CypB, and their derived chimeras, Western blot analysis, and ELISA tests were carried out (Figure 6E). Thus, the replacement of loop-1 of CypA by the loop-1 from CypB (see CypA(L1CypB) in Figure 6E) determined the lack of recognition of α-CypA antibody and the gain of recognition of α-CypB antibody indicating that loop-1 contained a major determinant of the differential immunogenicity of B. abortus Cyps. In addition, loop-2 of CypA was also important for the recognition of α-CypA antibody since CypB(L2CypA) and CypB(L2-L3CypA) were recognized by α-CypA antibodies. Analysis of CypB(L3CypA) immunogenicity suggested that loop-3 of both Cyps is devoid of immunodominant epitopes. Altogether these immunological results confirmed structural differences predicted by the in-silico analysis between CypA and CypB.

Figure 6

CypB forms homodimers that are sensitive to reduction

Since it was reported that PPIases can form homo-oligomers (Budiman et al., 2009; Zhang et al., 2011; Jakob et al., 2016; Polley et al., 2016) we studied the possibility that CypA and CypB were able to oligomerize. As shown in Figure 7A, when we subjected CypA or CypB to SDS-PAGE and Western blot analysis, a single protein band corresponding to the recombinant CypA or CypB was detected as expected for the monomeric form of these cyclophilins. However, when samples were treated in a non-reducing condition (without DTT in the loading sample) in addition to the monomeric band of CypB or CypBR59A/F64A, a larger band compatible with the formation of a homodimer of CypB or CypBR59AF64A was observed (Figure 7A). Interestingly, CypA either in the presence or absence of DTT was observed like a single band, as expected for a monomeric CypA (Figure 7A). These results indicate that CypB but not CypA was able to interact to form homodimers in solution, a process that was independent of the PPIase activity.

Figure 7

As shown above, a comparison between both cyclophilin sequences showed that CypB has a unique cysteine residue which is absent in the CypA sequence (Figure 1C). To study the potential role of this conserved cysteine residue in dimer formation, a point mutant CypBC128M was constructed, where the Cys128 was replaced by methionine (Figure 7B). The resulting recombinant protein CypBC128M was expressed and purified and its ability to form homodimers was evaluated. As shown in Figure 7B, CypBC128M was not able to form homodimers in non-reducing conditions indicating that cysteine was responsible for CypB dimerization. In addition, it was interesting to investigate if Cys128 was also important for PPIase or chaperone activities of CypB. As shown in Figure 7C, the PPIase activity of CypBC128M was not different from CypB. In addition, results shown in Figure 7D indicated that CypBC128M was also able to protect NdeI from thermal denaturation as efficiently as CypB. Altogether these results showed that the loss of the ability to form homodimers does not affect the in vitro activities of CypB analyzed in this study.

Homodimeric CypB is important for stress survival and virulence of Brucella abortus

Although the loss of CypB ability to form homodimers showed no effect on the in vitro PPIase or chaperone activities, we explored if CypB oligomerization can affect in vivo functions of CypB in B. abortus related to stress and intracellular host-cell adaptation. For that, the plasmid pfcypBC128M was introduced into B. abortuscypAB mutant strain and the stress adaptation, intracellular survival, and virulence in mice were examined (Figure 8). The expression of CypBC128M protein in B. abortus was confirmed by Western blot analysis (Figure 8A). As described previously in Roset et al. (2013)cypAB deletion generates a phenotype in B. abortus characterized by an increased sensitivity to a set of different stressors such as deoxycholate acid (DOC). As shown in Figure 8B, the plasmid pfcypBC128M was unable to complement the DOC sensitivity of B. abortus ΔcypAB mutant. These results indicated that CypB homodimer formation is necessary for Brucella stress adaptation.

Figure 8

To examine if the homodimeric formation of CypB is required for B. abortus intracellular survival, Hela cells were infected with B. abortus 2,308 wild-type strain, B. abortus ΔcypAB mutant, B. abortus ΔcypAB(pfcypB), B. abortus ΔcypAB(pfcypBR59A/F64A) and, B. abortus ΔcypAB(pfcypBC128M) (Figure 8C). Results showed that at 4 h post-infection B. abortus ΔcypAB(pfcypBC128M) showed a 10-fold reduction in intracellular survival, like what was observed in B. abortus ΔcypAB mutant suggesting that the dimeric form of CypB was also necessary for intracellular survival in Hela cells. Since B. abortus ΔcypAB(pfcypBC128M) was affected in intracellular adaptation it was interesting to investigate if this mutant was also affected in the mouse infection model. As shown in Figure 8D, orally infected mice had a reduced number (more than hundred-fold decrease) of B. abortus ΔcypAB(pfcypBC128M) in spleen at 6 weeks post-infection compared with those infected with B. abortus ΔcypAB(pfcypB) and like B. abortus ΔcypAB mutant. These results also showed that the dimeric form of Brucella CypB was fully required to establish a persistent infection in mice. All these results showed that homodimer formation was necessary for the in vivo functions of CypB.

PPIase activity of CypB is required for full virulence of Brucella abortus in the mouse model

As we described previously (Roset et al., 2013), the plasmid pcypBR59A/F64A partially rescued the B. abortus ΔcypAB mutant for DOC sensitivity (Figure 8B). Intermediate results observed in complementation assays with pcypBR59A/F64A can be explained by the existence of certain residual PPIase activity in the cyclophilin mutant CypBR59A/F64A (Figure 3B). This CypBR59A/F64A residual activity was sufficient to complement intracellular survival of the B. abortus ΔcypAB mutant to the wild-type level (Figure 8C; Roset et al., 2013). To understand if the residual cyclophilin activity present in the mutant protein CypBR59A/F64A was also sufficient to complement the B. abortus ΔcypAB mutant in the mouse model, an infection experiment was performed. As shown in Figure 8D, after 6 weeks post-infection B. abortus ΔcypAB(pfcypBR59A/F64A) was 66-fold less efficient in spleen colonization in BALB/c mice than B. abortus ΔcypAB(pfcypB) and similar to B. abortus ΔcypAB mutant. It is possible to speculate that the discrepancies observed can be explained by the different requirements of CypB activity dependent on the chosen experimental model. Thus, mouse oral infection is predicted to be the most demanding assay since B. abortus ΔcypAB mutant had to face a variety of sequential stressors when progressing in the intestinal tract (pH, bile salts, proteases, etc). Consequently, the mouse experiment highlighted the critical importance of CypB PPIase activity in Brucella intracellular survival and virulence.

The cypBR59A/F64A gene functions as a dominant-negative mutant

To explore if the loss-of-function mutation of CypB (cypBR59A/F64A) can exert a dominant-negative effect on B. abortus 2,308 wild-type strain, the plasmid pfcypBR59AF64A was introduced into this strain by biparental mating and ectopic expression of CypBR59A/F64A was confirmed by Western blot analysis (Figure 9A). As shown in Figure 9, the expression of CypBR59A/F64A impaired the ability of Brucella to survive in DOC sensitivity assay (Figure 9B) and reduced 70-fold the ability to survive within HeLa cells (Figure 9C). Considering that CypBR59A/F64A still can interact with CypB wild type to form dimers, these results might suggest that CypB requires dimer formation for full activity, having both monomers a fully intact active site.

Figure 9

Discussion

Cyclophilins are a family of highly conserved enzymes that catalyze the process of cis-trans isomerization of the Xaa-proline bonds, which is the rate-limiting step in protein folding. This activity is critical for many biological processes including bacterial virulence (Dimou et al., 2017). We have previously reported that B. abortus has two cyclophilins, named cyclophilin A (CypA) and cyclophilin B (CypB) that are upregulated within the intraphagosomal replicative niche during B. abortus infection (Roset et al., 2013). In addition, we have also demonstrated that both cyclophilins play an important role in stress adaptation, intracellular survival, and virulence. Interestingly, defective phenotypes for stress and intracellular survival can be complemented either with CypA or CypB alone, suggesting that both Cyps show certain redundancy in their functions (Roset et al., 2013). In this report, we have also identified a group of differential features by comparing CypA with CypB. For instance, although both B. abortus cyclophilins share a conserved secondary structure, we have identified structural differences over three immunodominant loops identified by an in-silico approach and by different immunoassays. Cyclophilins are enzymes that can interact with different protein targets to help them in their folding process allowing them to acquire their functional protein structure. It would be interesting to hypothesize if differences observed in structure and antigenicity of CypA and CypB might also be reflecting differences in their preferred protein targets that can reveal novel functions for these cyclophilins.

We demonstrated here that unlike CypA, CypB presents a Trp134 which is involved in CsA inhibition, like in all characterized Cyps from eukaryotic origin (Bossard et al., 1991; Liu et al., 1991). On the other hand, CypA shares homology with Cyps of Gram-negative bacteria, presenting a replacement of the Trp134 by a Phe residue, a modification that correlates with CsA insensitivity observed for this kind of Cyps (Liu and Walsh, 1990; Liu et al., 1991). Interestingly, the replacement of Trp134 in CypB (CypBW134F) does not modify the PPIase activity either in the presence or absence of CsA indicating that Trp134 is not required for peptidyl-prolyl cis-trans isomerization. As mentioned above, another characteristic feature that has been described in eukaryotic cyclophilins is the presence of cysteines in their sequences (Liu et al., 1990; Motohashi et al., 2003; Gourlay et al., 2007). Brucella CypB has a single cysteine residue in its sequence (Cys128) which is absent in CypA. As shown here, Brucella CypB has the capacity to self-associate to form homodimers. This interaction was reversed by the addition of the reducing agent DTT indicating that Cys128 is the amino acid responsible for dimer formation. Thus, CypBC128M mutant was unable to form homodimers showing the same behavior as CypA which is only present in a monomeric state.

It has been reported that PPIases can form homo-oligomers (Zhang et al., 2011; Jakob et al., 2016; Polley et al., 2016) although, in the family of cyclophilins, only a few cases have been reported: the human hCypA (Zhang et al., 2011) and the Trichomonas vaginalis cyclophilin 1 (Martin et al., 2018). In addition, in the case of dimeric PPIases, no homodimer formation has been reported dependent on disulfide bonds. Hence, Brucella CypB is the first example of a dimeric PPIase stabilized by disulfide bridges.

Interestingly, it has been also reported that oligomerization of enzymes modulates their activities (Kropp et al., 2022). We showed here that CypB dimer formation was fully required to complement the defective phenotype of Brucella ΔcypAB mutant in stress survival, intracellular adaptation, and virulence in mice but not required for the in vitro PPIase activity. This apparent discrepancy can be explained because the in vitro PPIase substrate, the acid-denatured GFP, is not expected to be a physiological protein target. Similar results to those described here were reported for Legionella protein MIP, a PPIase belonging to the FKB family (Kohler et al., 2003).

As shown here, the defective phenotype of B. abortus ΔcypAB mutant cannot be complemented by CypBC128M indicating that the formation of homodimers is critical for PPIase activity of CypB.

To understand in more detail how Brucella cyclophilins participate in the process of stress adaptation and intracellular survival, a dominant-negative experiment was performed. As shown here, the over-expression of CypBR59A/F64A interfered with bacterial ability to survive to stressors and within the host cell resembling what is observed in the B. abortus ΔcypAB mutant. Interpretations of these results suggested that for the fully enzymatic activity of the dimeric CypB, both monomers must present functional active sites. As we mentioned before and it was shown previously (Roset et al., 2013), CypA and CypB are equivalent when complemented the B. abortus ΔcypAB mutant indicating a functional redundancy. Interestingly, in the dominant-negative experiment, the wild-type activity of CypA was also surprisingly inhibited, although CypA is not expected to form heterodimers with CypBR59A/F64A. An explanation for these results can be that homodimers formed by CypBR59A/F64A or heterodimers formed by CypB-CypBR59A/F64A were able to trap also the protein targets of CypA preventing their folding.

It has been reported that there is a general link between cyclophilins and cellular stress response (Dimou et al., 2017). We have described that Brucella’s Cyps participate in survival to diverse types of stresses which is dependent on the PPIase activity (Roset et al., 2013). Proteins involved in oxidative stress such as OxyR and Hsp33 are regulated by redox activity and activated by the formation of intramolecular disulfide bridges (Zheng et al., 1998; Graumann et al., 2001). Moreover, evidence for redox regulation of PPIase activity of cyclophilins has been reported for hCypA from T lymphocytes (Ghezzi et al., 2006), Chloroplast CypA from Arabidopsis thaliana (Motohashi et al., 2003), and CypA from Schistosoma mansoni (Gourlay et al., 2007), suggesting that redox regulation involving cysteine residues must be a common mechanism of cyclophilin regulation. In all the mentioned cases, activity regulation is mediated by the formation of intramolecular disulfide bridges. It is conceivable that in the case of Brucella, upon exposure to an oxidative stress condition (for instance when the bacterium enters its host cell) the intermolecular formation of disulfide bridges between two monomers of CypB can be triggered to obtain fully functional PPIase activity. Thus, the dimerization of CypB might function as a regulatory switch to respond to oxidative stress in Brucella.

Bacterial pathogens that have co-evolved with their host have acquired mechanisms to modulate the host cell physiology for their own benefit. Thus, pathogenic bacteria can translocate virulence proteins (known as effector proteins) into the host cell, using specialized secretion systems to hijack different processes, such as the acquisition of nutrients, vesicle trafficking, and modulation of the immune system to allow adequate time for bacterial replication. To accomplish these functions, some effector proteins use “eukaryotic-like” protein domains to mimic the structure or the function of host proteins, promoting the manipulation of a particular host cell pathway (Ke et al., 2015). In the light of, i) Brucella Cyps are overexpressed during B. abortus intracellular life, ii) Brucella Cyps are required for stress adaptation, intracellular survival, and virulence in BALB/c mice, iii) Brucella CypA and CypB differ in immunodominant loops that may be reflecting differential functions as well, iv) Brucella CypB has structural and functional eukaryotic characteristics, it is possible to hypothesize that CypB might function as an effector protein. Further studies to understand if CypB can function as an effector bacterial protein are still in progress.

Conclusion

Remarkably, we have shown here that Brucella cyclophilins come in two different “flavors”: eukaryotic and prokaryotic. In addition, we reported here that Brucella cyclophilins CypA and CypB differ in various immunological and biochemical properties, despite their high degree of sequence similarity and conserved functional features. Also, we highlighted the importance of dimer formation and PPIase activity of CypB for a progressive infection in an animal model. These findings shed some light on the potential novel functions of Brucella Cyps, some of them could be due to the putative role of CypB as an effector bacterial protein.

Funding

This work was supported by grants from the Agencia Nacional de Promoción Científica y Tecnológica, Buenos Aires, Argentina (PICT-2018-0778, PICT-2016-0412) and CONICET (PUE-0086, PIP-11220200102517CO).

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.

Ethics statement

The animal study was reviewed and approved by The experimental procedure of this study (permit number CICUAE UNSAM 15/2018) was approved by the Committee on the Ethics of Animal Experiments of the Universidad Nacional de San Martín (UNSAM), under the recommendations for animal experimentation (Helsinki Declaration and its amendments, Amsterdam Protocol of welfare and animal protection and National Institutes of Health, USA NIH, guidelines: Guide for the Care and Use of Laboratory Animals).

Author contributions

MR and GB conceived and design the experiments. EM and MR performed experiments. EM, MR, and GB analyzed the data. MR and GB wrote the paper. All authors contributed to the article and approved the submitted version.

Acknowledgments

We would like to thank Dr. Rodrigo Sieira for his careful and critical reading of this manuscript. EM is doctoral fellow from CONICET. MR and GB are members of the Research Career of CONICET.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1

    AndrewsB. T.SchoenfishA. R.RoyM.WaldoG.JenningsP. A. (2007). The rough energy landscape of superfolder GFP is linked to the chromophore. J. Mol. Biol.373, 476490. doi: 10.1016/j.jmb.2007.07.071

  • 2

    BossardM. J.KoserP. L.BrandtM.BergsmaD. J.LevyM. A. (1991). A single Trp121 to Ala121 mutation in human cyclophilin alters cyclosporin a affinity and peptidyl-prolyl isomerase activity. Biochem. Biophys. Res. Commun.176, 11421148. doi: 10.1016/0006-291X(91)90404-U

  • 3

    BudimanC.BandoK.AngkawidjajaC.KogaY.TakanoK.KanayaS. (2009). Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase. Importance of a V-shaped dimeric structure for binding to protein substrate. FEBS J.276, 40914101. doi: 10.1111/j.1742-4658.2009.07116.x

  • 4

    BzdylN. M.ScottN. E.NorvilleI. H.ScottA. E.AtkinsT.PangS.et al. (2019). Peptidyl-prolyl isomerase ppiB is essential for proteome homeostasis and virulence in Burkholderia pseudomallei. Infect. Immun.87. doi: 10.1128/IAI.00528-19

  • 5

    ChoK.ArimotoT.IgarashiT.YamamotoM. (2013). Involvement of lipoprotein PpiA of Streptococcus gordonii in evasion of phagocytosis by macrophages. Mol. Oral Microbiol.28, 379391. doi: 10.1111/omi.12031

  • 6

    CorbelM. J. (1997). Brucellosis: an overview. Emerg. Infect. Dis.3, 213221. doi: 10.3201/eid0302.970219

  • 7

    De FigueiredoP.FichtT. A.Rice-FichtA.RossettiC. A.AdamsL. G. (2015). Pathogenesis and immunobiology of brucellosis: review of Brucella-host interactions. Am. J. Pathol.185, 15051517. doi: 10.1016/j.ajpath.2015.03.003

  • 8

    DimouM.VenierakiA.KatinakisP. (2017). Microbial cyclophilins: specialized functions in virulence and beyond. World J. Microbiol. Biotechnol.33:164. doi: 10.1007/s11274-017-2330-6

  • 9

    DimouM.VenierakiA.LiakopoulosG.KouriE. D.TampakakiA.KatinakisP. (2011). Gene expression and biochemical characterization of Azotobacter vinelandii cyclophilins and protein interaction studies of the cytoplasmic isoform with dnaK and lpxH. J. Mol. Microbiol. Biotechnol.20, 176190. doi: 10.1159/000329486

  • 10

    DittaG.StanfieldS.CorbinD.HelinskiD. R. (1980). Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of rhizobium meliloti. Proc. Natl. Acad. Sci. U. S. A.77, 73477351. doi: 10.1073/pnas.77.12.7347

  • 11

    EdwardsK. J.OllisD. L.DixonN. E. (1997). Crystal structure of cytoplasmic Escherichia coli peptidyl-prolyl isomerase: evidence for decreased mobility of loops upon complexation. J. Mol. Biol.271, 258265. doi: 10.1006/jmbi.1997.1151

  • 12

    FanghanelJ.FischerG. (2004). Insights into the catalytic mechanism of peptidyl prolyl cis/trans isomerases. Front. Biosci.9, 34533478. doi: 10.2741/1494

  • 13

    Fina MartinJ.PalominoM. M.CutineA. M.ModenuttiC. P.Fernandez Do PortoD. A.AllieviM. C.et al. (2019). Exploring lectin-like activity of the S-layer protein of Lactobacillus acidophilus ATCC 4356. Appl. Microbiol. Biotechnol.103, 48394857. doi: 10.1007/s00253-019-09795-y

  • 14

    GalatA. (2003). Peptidylprolyl cis/trans isomerases (immunophilins): biological diversity--targets--functions. Curr. Top. Med. Chem.3, 13151347. doi: 10.2174/1568026033451862

  • 15

    GhezziP.CasagrandeS.MassignanT.BassoM.BellacchioE.MollicaL.et al. (2006). Redox regulation of cyclophilin A by glutathionylation. Proteomics6, 817825. doi: 10.1002/pmic.200500177

  • 16

    GourlayL. J.AngelucciF.BaioccoP.BoumisG.BrunoriM.BellelliA.et al. (2007). The three-dimensional structure of two redox states of cyclophilin A from Schistosoma mansoni. Evidence for redox regulation of peptidyl-prolyl cis-trans isomerase activity. J. Biol. Chem.282, 2485124857. doi: 10.1074/jbc.M702714200

  • 17

    GraumannJ.LilieH.TangX.TuckerK. A.HoffmannJ. H.VijayalakshmiJ.et al. (2001). Activation of the redox-regulated molecular chaperone Hsp33--a two-step mechanism. Structure9, 377387. doi: 10.1016/S0969-2126(01)00599-8

  • 18

    HermansP. W.AdrianP. V.AlbertC.EstevaoS.HoogenboezemT.LuijendijkI. H.et al. (2006). The streptococcal lipoprotein rotamase a (SlrA) is a functional peptidyl-prolyl isomerase involved in pneumococcal colonization. J. Biol. Chem.281, 968976. doi: 10.1074/jbc.M510014200

  • 19

    HerreroM.De LorenzoV.TimmisK. N. (1990). Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J. Bacteriol.172, 65576567. doi: 10.1128/jb.172.11.6557-6567.1990

  • 20

    JakobR. P.SchmidpeterP. A.KochJ. R.SchmidF. X.MaierT. (2016). Structural and functional characterization of a novel family of Cyclophilins, the AquaCyps. PLoS One11:e0157070. doi: 10.1371/journal.pone.0157070

  • 21

    KeH. (1992). Similarities and differences between human cyclophilin A and other beta-barrel structures. Structural refinement at 1.63 A resolution. J. Mol. Biol.228, 539550. doi: 10.1016/0022-2836(92)90841-7

  • 22

    KeY.WangY.LiW.ChenZ. (2015). Type IV secretion system of Brucella spp. and its effectors. Front. Cell. Infect. Microbiol.5:72. doi: 10.3389/fcimb.2015.00072

  • 23

    KeH. M.ZydowskyL. D.LiuJ.WalshC. T. (1991). Crystal structure of recombinant human T-cell cyclophilin A at 2.5 a resolution. Proc. Natl. Acad. Sci. U. S. A.88, 94839487. doi: 10.1073/pnas.88.21.9483

  • 24

    KeoghR. A.ZapfR. L.WiemelsR. E.WittekindM. A.CarrollR. K. (2018). The intracellular Cyclophilin PpiB contributes to the virulence of Staphylococcus aureus independently of its peptidyl-prolyl cis/trans isomerase activity. Infect. Immun.86. doi: 10.1128/IAI.00379-18

  • 25

    KohlerR.FanghanelJ.KonigB.LunebergE.FroschM.RahfeldJ. U.et al. (2003). Biochemical and functional analyses of the Mip protein: influence of the N-terminal half and of peptidylprolyl isomerase activity on the virulence of legionella pneumophila. Infect. Immun.71, 43894397. doi: 10.1128/IAI.71.8.4389-4397.2003

  • 26

    KroppC.BruckmannA.BabingerP. (2022). Controlling enzymatic activity by modulating the Oligomerization state via chemical rescue and optical control. Chembiochem23:e202100490. doi: 10.1002/cbic.202100490

  • 27

    KruckenJ.GreifG.Von Samson-HimmelstjernaG. (2009). In silico analysis of the cyclophilin repertoire of apicomplexan parasites. Parasit. Vectors2:27. doi: 10.1186/1756-3305-2-27

  • 28

    KumawatM.SinghP. K.RananawareS. R.AhlawatS. (2020). Comparative evaluation of structure and characteristic of peptidyl-prolyl cis-trans isomerase proteins and their function in Salmonella Typhimurium stress responses and virulence. Folia Microbiol. (Praha)65, 161171. doi: 10.1007/s12223-019-00717-z

  • 29

    LiuJ.AlbersM. W.ChenC. M.SchreiberS. L.WalshC. T. (1990). Cloning, expression, and purification of human cyclophilin in Escherichia coli and assessment of the catalytic role of cysteines by site-directed mutagenesis. Proc. Natl. Acad. Sci. U. S. A.87, 23042308. doi: 10.1073/pnas.87.6.2304

  • 30

    LiuJ.ChenC. M.WalshC. T. (1991). Human and Escherichia coli cyclophilins: sensitivity to inhibition by the immunosuppressant cyclosporin A correlates with a specific tryptophan residue. Biochemistry30, 23062310. doi: 10.1021/bi00223a003

  • 31

    LiuJ.WalshC. T. (1990). Peptidyl-prolyl cis-trans-isomerase from Escherichia coli: a periplasmic homolog of cyclophilin that is not inhibited by cyclosporin A. Proc. Natl. Acad. Sci. U. S. A.87, 40284032. doi: 10.1073/pnas.87.11.4028

  • 32

    MarchesiniM. I.HerrmannC. K.SalcedoS. P.GorvelJ. P.ComerciD. J. (2011). In search of Brucella abortus type IV secretion substrates: screening and identification of four proteins translocated into host cells through VirB system. Cell. Microbiol.13, 12611274. doi: 10.1111/j.1462-5822.2011.01618.x

  • 33

    MaresR. E.Melendez-LopezS. G.RamosM. A. (2011). Acid-denatured green fluorescent protein (GFP) as model substrate to study the chaperone activity of protein disulfide isomerase. Int. J. Mol. Sci.12, 46254636. doi: 10.3390/ijms12074625

  • 34

    MartinT.LouY. C.ChouC. C.WeiS. Y.SadotraS.ChoC. C.et al. (2018). Structural basis of interaction between dimeric cyclophilin 1 and Myb1 transcription factor in trichomonas vaginalis. Sci. Rep.8:5410. doi: 10.1038/s41598-018-23821-5

  • 35

    MengE. C.PettersenE. F.CouchG. S.HuangC. C.FerrinT. E. (2006). Tools for integrated sequence-structure analysis with UCSF chimera. BMC Bioinformatics7:339. doi: 10.1186/1471-2105-7-339

  • 36

    MotohashiK.KoyamaF.NakanishiY.Ueoka-NakanishiH.HisaboriT. (2003). Chloroplast cyclophilin is a target protein of thioredoxin. Thiol modulation of the peptidyl-prolyl cis-trans isomerase activity. J. Biol. Chem.278, 3184831852. doi: 10.1074/jbc.M304258200

  • 37

    ObiI. R.NordfelthR.FrancisM. S. (2011). Varying dependency of periplasmic peptidylprolyl cis-trans isomerases in promoting Yersinia pseudotuberculosis stress tolerance and pathogenicity. Biochem. J.439, 321332. doi: 10.1042/BJ20110767

  • 38

    PandeyS.SharmaA.TripathiD.KumarA.KhubaibM.BhuwanM.et al. (2016). Mycobacterium tuberculosis peptidyl-prolyl isomerases also exhibit chaperone like activity in-vitro and in-vivo. PLoS One11:e0150288. doi: 10.1371/journal.pone.0150288

  • 39

    PandeyS.TripathiD.KhubaibM.KumarA.SheikhJ. A.SumanlathaG.et al. (2017). Mycobacterium tuberculosis peptidyl-prolyl isomerases are immunogenic, alter cytokine profile and aid in intracellular survival. Front. Cell. Infect. Microbiol.7:38. doi: 10.3389/fcimb.2017.00038

  • 40

    PembertonT. J. (2006). Identification and comparative analysis of sixteen fungal peptidyl-prolyl cis/trans isomerase repertoires. BMC Genomics7:244. doi: 10.1186/1471-2164-7-244

  • 41

    PolleyS.ChakravartyD.ChakrabartiG.SauS. (2016). Determining the roles of a conserved tyrosine residue in a Mip-like peptidyl-prolyl cis-trans isomerase. Int. J. Biol. Macromol.87, 273280. doi: 10.1016/j.ijbiomac.2016.02.070

  • 42

    RaschJ.UnalC. M.KlagesA.KarsliU.HeinsohnN.BrouwerR.et al. (2019). Peptidyl-prolyl-cis/trans-isomerases Mip and PpiB of legionella pneumophila contribute to surface translocation, growth at suboptimal temperature, and infection. Infect. Immun.87. doi: 10.1128/IAI.00939-17

  • 43

    ReffuveilleF.ConnilN.SanguinettiM.PosteraroB.ChevalierS.AuffrayY.et al. (2012). Involvement of peptidylprolyl cis/trans isomerases in Enterococcus faecalis virulence. Infect. Immun.80, 17281735. doi: 10.1128/IAI.06251-11

  • 44

    RosetM. S.AlefantisT. G.DelvecchioV. G.BrionesG. (2017). Iron-dependent reconfiguration of the proteome underlies the intracellular lifestyle of Brucella abortus. Sci. Rep.7:10637. doi: 10.1038/s41598-017-11283-0

  • 45

    RosetM. S.Garcia FernandezL.DelvecchioV. G.BrionesG. (2013). Intracellularly induced cyclophilins play an important role in stress adaptation and virulence of Brucella abortus. Infect. Immun.81, 521530. doi: 10.1128/IAI.01125-12

  • 46

    UrizaP. J.TrautmanC.PalominoM. M.Fina MartinJ.RuzalS. M.RosetM. S.et al. (2020). Development of an antigen delivery platform using Lactobacillus acidophilus decorated with heterologous proteins: a sheep in Wolf's clothing story. Front. Microbiol.11:509380. doi: 10.3389/fmicb.2020.509380

  • 47

    WiemelsR. E.CechS. M.MeyerN. M.BurkeC. A.WeissA.ParksA. R.et al. (2017). An intracellular peptidyl-prolyl cis/trans isomerase is required for folding and activity of the Staphylococcus aureus secreted virulence factor nuclease. J. Bacteriol.199. doi: 10.1128/JB.00453-16

  • 48

    ZhangX. C.WangW. D.WangJ. S.PanJ. C. (2013). PPIase independent chaperone-like function of recombinant human Cyclophilin A during arginine kinase refolding. FEBS Lett.587, 666672. doi: 10.1016/j.febslet.2013.01.028

  • 49

    ZhangX. C.WangW. D.WangJ. S.PanJ. C.ZouG. L. (2011). Evidences of monomer, dimer and trimer of recombinant human cyclophilin A. Protein Pept. Lett.18, 11881193. doi: 10.2174/092986611797642670

  • 50

    ZhengM.AslundF.StorzG. (1998). Activation of the OxyR transcription factor by reversible disulfide bond formation. Science279, 17181722. doi: 10.1126/science.279.5357.1718

  • 51

    ZydowskyL. D.EtzkornF. A.ChangH. Y.FergusonS. B.StolzL. A.HoS. I.et al. (1992). Active site mutants of human cyclophilin A separate peptidyl-prolyl isomerase activity from cyclosporin A binding and calcineurin inhibition. Protein Sci.1, 10921099. doi: 10.1002/pro.5560010903

Summary

Keywords

brucellosis, Brucella abortus, Cyclophilins, virulence, PPIase activity, dimeric CypB, Brucella-host interaction, stress adaptation

Citation

Muruaga EJ, Briones G and Roset MS (2022) Biochemical and functional characterization of Brucella abortus cyclophilins: So similar, yet so different. Front. Microbiol. 13:1046640. doi: 10.3389/fmicb.2022.1046640

Received

17 September 2022

Accepted

13 October 2022

Published

31 October 2022

Volume

13 - 2022

Edited by

Roy Martin Roop II, East Carolina University, United States

Reviewed by

Clayton Caswell, Virginia Tech, United States; Myron Christodoulides, University of Southampton, United Kingdom; Alessia Ruggiero, Institute of Biostructure and Bioimaging (CNR), Italy

Updates

Copyright

*Correspondence: Mara S. Roset, Gabriel Briones,

This article was submitted to Infectious Agents and Disease, a section of the Journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics