Abstract
Autophagy is a degradation system in the cell, involved in the turnover of cellular components, development, differentiation, immune responses, protection against pathogens, and cell death. Autophagy is induced by nutrient starvation, in which cytoplasmic components and organelles are digested via vacuoles/lysosomes. In this study, by using electron microscopy, we observed that hypovirus CHV1-EP713 infection of Cryphonectria parasitica, the causative agent of chestnut blight disease, caused proliferation of autophagic-like vesicles. This phenomenon could be mimicked by treating the wild-type strain of the fungus EP155 with the autophagy induction drug rapamycin. Some of the hypovirulence-associated traits, including reduced pigmentation and conidiation, were also observed in the rapamycin-treated EP155. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) revealed that genes involved in autophagy were up-regulated in expression. Deletion of cpatg8, a gene encoding a homolog of ATG8 in Saccharomyces cerevisiae, resulted in attenuation of virulence and reduction in sporulation, as well as accumulation of the double-stranded viral RNA. Furthermore, virus-encoded p29 protein was found to co-localize with CpATG8, implying that the viral protein may interfere with the function of CpATG8. Taken together, these findings show that cpatg8 can be regulated by the hypovirus and is required for virulence and development of the fungus and accumulation of viral dsRNA in chestnut blight fungus.
Introduction
Autophagy is a conserved cellular process of eukaryotic cells that degrades intracellular protein complexes and organelles in the vacuole or lysosome (Klionsky et al., 2016; Liu et al., 2016; Yin et al., 2016). Autophagy has diverse physiological functions in the regulation of energy and nutrient metabolism, organelle quality control, removing misfolded proteins (Yin et al., 2016), and the development of filamentous fungi (Khan et al., 2012; Voigt and Pöggeler, 2013b; Liu et al., 2016). Among many molecular elements, ATG8, a ubiquitin-like protein, is a key element of autophagy pathway (Klionsky et al., 2016). In Saccharomyces cerevisiae, it was reported that ATG8 is conjugated to the lipid phosphatidyl ethanolamine (PE) and required for autophagosome formation (Nakatogawa et al., 2007). ATG8 is localized to preautophagosomal structures (PAS), autophagosomes, and autophagic bodies (Suzuki et al., 2001). In filamentous fungi, autophagy has been shown to be involved in virulence, cellular growth, development, and environmental stress (Pollack et al., 2009; Bartoszewska and Kiel, 2011; Klionsky et al., 2016; Liu et al., 2016). In Fusarium graminearum, FgATG8 was found to function in the formation of aerial mycelium and formation of reproductive structures, nutritional use of storage lipid droplets, and infection (Josefsen et al., 2012).
Autophagy could be induced by various abiotic and biotic stresses including pathogen infection (Hayward and Dinesh-Kumar, 2011). In addition, the canonical function of autophagy may play a role in antivirus activities (Dagdas et al., 2016; Clavel et al., 2017; Hafrén et al., 2017; Haxim et al., 2017). However, different animal and plant viruses have developed diversified strategies to evade or hijack the autophagy pathway to promote their own infection or transmission (Dong and Levine, 2013; Chen et al., 2017). Although the role of autophagy in host–virus interactions in animals and plants has been studied to some extent, functions of autophagy in the fungus–virus interface remain to be understood.
Chestnut blight caused by Cryphonectria parasitica is a well-known forest disease. Infection with hypoviruses, a group of plus sense RNA viruses, attenuates virulence of this fungus (Dawe and Nuss, 2001). In addition to reducing hypovirulence, traits of phenotype can also be altered in hypovirus-infected C. parasitica strains, such as suppressed sporulation, decreased pigmentation, and altered gene expression patterns (Nuss, 2005; Eusebio-Cope et al., 2015). In this report, we observed that both hypovirus CHV1-EP713 infection and treatment with the autophagy-inducing drug rapamycin in the wild-type strain EP155 could cause proliferation of autophagic-like vesicles, and expression of autophagy-related genes was up-regulated following infection by hypovirus CHV1-EP713. Disruption of cpatg8, a gene encoding a homolog of ATG8 in S. cerevisiae, caused a profound reduction in fungal virulence, conidiation, and accumulation of the virus.
Materials and Methods
Fungal Strains and Growth Conditions
C. parasitica wild-type strain EP155 (ATCC38755), its isogenic strain EP155/CHV1-EP713 harboring hypovirus CHV1-EP713 by transfection, and strain DK80, a ku80-deletion mutant of EP155 and highly efficient in gene homologous replacement (Lan et al., 2008; Choi et al., 2012), as well as cpatg8 deletion strain Δcpatg8 were all maintained on potato dextrose agar (PDA) medium (Difco, Detroit, MI) at 24–26°C with a 12 h/12 h light/dark cycle (1,300–1,600 lx), as described previously (Chen et al., 2011). EP complete medium was employed for cultures used for DNA and dsRNA isolation at room temperature with shaking at 200 rpm for 3 days. The transformation of C. parasitica was done as described (Chen et al., 2011). Hygromycin (40 μg/ml) or G418 (25 μg/ml) was supplemented into the growth medium for selection of transformants.
Gene Manipulation
Gene cloning, PCR, and Southern analysis were performed according to Sambrook and Russell (2001). Primers used were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and listed in Table 1.
Table 1
| Primer name | Sequence 5′-3′ | Name of gene |
|---|---|---|
| Hyg-F | CTGAAATAAAGGGAGGAAGGG | hph |
| Hyg-R | AGGACACACATTCATCGTAGG | |
| cpatg8-all-F | CGTGGGGTGACTTTGAGAGTGA | cpatg8 |
| cpatg8-all-R | CTTGCCTACGAGGTCACTGGTCA | |
| cpatg8-LF | TACTTCTTCTGCCTGCCTTTGGG | cpatg8 |
| cpatg8-LR | ATATCATCTTCTGTCGACCTGCAGGCCGGTGGTCGGTGAAAGTAGGGT | |
| cpatg8-RF | TCTTTCTAGAGGATCCCCGGGTACCGATAGCGGGTGTTCGTTCTTCTGC | cpatg8 |
| cpatg8-RR | GTCTCATGTCGCCGGGTACATG | |
| Δcpatg8-com-F | CGAGAATTCCACTTGGGTACTGCTGGC | cpatg8 |
| Δcpatg8-com-R | TATGCGGCCGCGATTGACTCAAAGTCTC | |
| 18S-F | TCTCGAATCGCATGGCCT | 18S rRNA |
| 18S-R | TTACCCGTTGTAACCACGGC | |
| cpatg1-F | TCCACAACCTGTGCCATCCACTTCA | cpatg1 |
| cpatg1-R | TTGTCGACCACGACATAGTCACGCT | |
| cpatg3-F | GGCCTCGGTGCACCCTTGCA | cpatg3 |
| cpatg3-R | ATGAACTTGAGGAACACCAC | |
| cpatg4-F | CGCTCGACAAGAACGTGAGA | cpatg4 |
| cpatg4-R | GTATCAGTGTTGGATGGAATG | |
| cpatg7-F | GCGTCGACAACAGGGAATA | cpatg7 |
| cpatg7-R | AGAGACGAAGCGGTCCTCCTC | |
| cpatg8-F | ATCCAAGTTCAAGGATGAGC | cpatg8 |
| cpatg8-R | AGATGGCCTTGTCGGGGGAC | |
| cpatg18-F | CTCGTCACCGCGTGCGAATCG | cpatg18 |
| cpatg18-R | ACCGCTCTGTCTCCGATTTG | |
| cpatg33-F | ACAACAGTCCCGCAAGGACCGC | cpatg33 |
| cpatg33-R | TGCTTCTTGAGGAAGTCCTCG | |
| p29-F | ATAGCGGCCGCATGGCTCAATTAAGAAAACCC | p29 |
| p29-R | ATAGTTAACTTAGCCAATCCGGGCAAGGGGATC |
List of primers used.
Construction and Complementation of cpatg8 Null Mutants
cpatg8 null mutants were constructed by homologous recombination. Briefly, a fragment containing a hygromycin-resistant gene hph in place of the cpatg8 coding region that was flanked with cpatg8 sequences was generated by PCR. This fragment was introduced into DK80 spheroplasts via the PEG-mediated transformation protocol. Putative cpatg8 disruptants were screened by PCR, selected for nuclear homogeneity by single-spore isolation, and further verified by Southern blot analysis. Confirmed transformants were designated as Δcpatg8 strains. A 2.55 kb genomic fragment with EcoRI and NotI containing the complete cpatg8 transcript region (0.69 kb), promoter region (1.20 kb), and terminator region (0.66 kb) was amplified by PCR and then inserted into the transformation vector pCPXG418 to generate the construct pCPXG418-cpatg8. Complemented strains were constructed by transforming Δcpatg8 spheroplasts with pCPXG418-cpatg8 and the complemented transformants were validated by PCR and Southern blot.
Construction of GFP-Labeled CpATG8 and RFP-Labeled p29 Strains
GFP-CpATG8 fusion plasmid (pCPXG418-GFP-cpatg8) was constructed as described (Shi et al., 2014). CpATG8 encoding region sequence was amplified and cloned into the pCPXG418-GFP to construct pCPXG418-GFP-cpatg8. Likewise, the virus-encoded protein p29 encoding region sequence was amplified by PCR with primer pair p29-F/R (Table 1) and cloned into the pCPXHY2-RFP to generate the recombinant plasmids pCPXHY2-RFP-p29. Subsequently, these two recombinant plasmids were transformed into the protoplasts of the wild-type strain EP155, respectively. The expression of GFP and RFP was observed using an Olympus BX51 fluorescence microscope.
Electron Microscopy
For scanning electron microscopy, fungal samples (2 × 4 mm) were prepared after 5 days of cultivation on PDA. Samples were fixed in 2% (v/v) glutaraldehyde in 0.2 M phosphate buffer (pH 6.8) at 4°C for 4–6 h and then washed with the same buffer for 2 h. The samples were dehydrated in a graded acetone series (30, 50, 70, 80, 90, and 100%) with each grade kept for 30 min and three times in 100% acetone. Finally, the fully dehydrated samples were dried in a Critical Point Dryer (HCP-2, Hitachi), mounted on stubs, and then coated with gold about 200 nm in thickness in a Sputter Coater (S-3400N, Hitachi). The coated specimens were observed with a SEM HV (S-3400N, Hitachi) at 10 kV.
For transmission electron microscopy, hyphae cultivated on PDA medium for 7 days were scraped with a clean scalpel and washed three times with sterilized distilled water, fixed with 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) at 4°C overnight, rinsed three times with phosphate buffer (50 mM, pH6.8), and post-fixed overnight in 1% osmium tetroxide in 0.1 M cacodylate buffer (pH 7.0) at 4°C for 2 h. After rinsing with phosphate buffer, the samples were dehydrated in a gradient ethanol series and embedded in Epon 812 resin. The ultrathin sections were stained in 2% uranium acetate followed by lead citrate and visualized under a transmission electron microscope (Hitachi, H-7650) operating at 80 kV.
Quantification of Gene Transcripts and Viral dsRNA
The relative accumulation of gene transcripts in the strain DK80 and Δcpatg8 was measured using quantitative real-time RT-PCR as previously described (Shi et al., 2014). Total cDNA was synthesized using an amount of 4 μg of RNA with appropriate gene-specific primers (Table 1). The real-time PCR was performed in a LightCycler 480 (Roche Applied Science) and normalized against that of 18S rRNA. The viral dsRNA accumulation level was examined using the method described previously (Lin et al., 2007). RNA samples stained with ethidium bromide were scanned using a Typhoon 9410 phosphorimager (GE Healthcare Life Sciences). To quantify the relative amount of large and medium dsRNA, the scanned gel image analysis was performed by ImageQuant TL-1D gel analysis software. 18S rRNA was used as the normalization reference.
Virulence Assays
Virulence was tested on dormant stems of Chinese chestnut (Castanea mollissima) with five replicates per fungal strain as previously described (Yao et al., 2013). The inoculated stems were kept at room temperature in a plastic bag to maintain moisture for 4 weeks. After incubation for 4 weeks, canker sizes were measured and the results were subjected to statistical analysis using the PROCGLM procedure (SAS, version 8.0). The type I error rate was set at P < 0.05.
Results
Hypovirus Infection Promotes Autophagy in C. parasitica
Previous studies showed that CHV1-EP713 and virus-encoded protein p29 were presented in vesicles (Dodds, 1980; Jacob-Wilk et al., 2006; Wang et al., 2013). We used an electron microscope to compare the subcellullar structure of the wild-type strain EP155 and virus-infected strain EP155/CHV1-EP713 and found that the number of vesicles was increased in the cytoplasm by more than 3-fold following virus infection (Figure 1).
Figure 1
Rapamycin can induce autophagy (Klionsky et al., 2016). EP155 treated with rapamycin resulted in a similar increase in vesicle numbers (Figure 1). Moreover, rapamycin-induced EP155 exhibited the phenotype similar to that of EP155/CHV-1EP713, including decreased sporulation, growth, and pigment production (Figure 2). To understand whether the autophagy pathway could be induced upon CHV1-EP713 infection, qRT-PCR was performed to compare transcripts of autophagy-related genes. Results showed that expression of cpatg1, cpatg3, cpatg4, cpatg7, cpatg8, cpatg18, and cpatg33 was significantly up-regulated (P < 0.05) by 5.79-, 3.45-, 2.59-, 4.32-, 3.55-, 2.74-, and 3.36-fold, respectively (Figure 3). Thus, it was concluded that virus infection stimulated autophagy in C. parasitica.
Figure 2
Figure 3
cpatg8 Is Essential for Autophagy in C. parasitica
The putative atg8 homolog was inspected against the C. parasitica genome database (http://genome.jgi-psf.org/cgi-bin/dispGeneModel?db=Crypa2&id=102797). The coding region of the cpatg8 gene is composed of three exons with 124 amino acid residues and two introns of 314 bp. The deduced CpATG8 protein showed a high level of homology (94–97% amino acid identity) compared to those of Magnaporthe oryzae, Neurospora crassa, Pichia pastoris, and Aspergillus nidulans, with Chaetomium thermophilum and M. oryzae being the highest at 97% and A. nidulans being the lowest at 94% (Figure S1).
To investigate the functions of the cpatg8 gene, cpatg8 disruption mutants were constructed via homologous recombination with a hygromycin-B-resistant cassette (Figure 4A). Three randomly selected single-spore-derived transformants were screened by PCR and further confirmed by Southern blot analysis (Figures 4B–D). The conidiation level of the Δcpatg8 was drastically reduced and aerial hyphae were significantly less than those of the parent strain DK80 and wild-type strain EP155 (Figures 4E,F). As shown in Figure 4E, the day–night growth patterns of Δcpatg8 were different from its parental or the wild-type strain. The abnormal phenotype of the mutants could be fully restored by reintroducing a wild-type copy of cpatg8 (Figure 4E), suggesting that cpatg8 is solely responsible for the altered phenotype.
Figure 4
Using differential interference microscopy and transmission electron microscopy, we examined changes in the process of autophagy stabilized by addition of phenylmethylsulfonylfluoride (PMSF) (Klionsky et al., 2016) in the Δcpatg8 mutants and DK80 by differential interference microscopy. Only 8.08 ± 2.35% of the vacuoles had autophagic bodies in the Δcpatg8 mutants, whereas it was 79.13 ± 8.21% in DK80, when cultured in EP liquid medium in the presence of 2 mM PMSF for 4 h (Figures 5A,C). Autophagic bodies in vacuoles of the strain DK80 were seen by transmission electron microscopy, but not in the cpatg8 mutant (Figure 5B), suggesting that cpatg8 is a gene essential for autophagy in C. parasitica.
Figure 5
Deletion of cpatg8 Attenuates C. parasitica Virulence and Reduces Accumulation of the Hypovirus RNA
EP155 and parental strain DK80 were highly virulent and incited large cankers on chestnut stems, whereas Δcpatg8 caused very small cankers, similar to those of EP155/CHV1-EP713. Virulence of the Δcpatg8 mutant could be fully restored following reintroduction of the wild-type cpatg8 gene (Figure 6).
Figure 6
atg8 is known to be a key gene of autophagy that functions at different stages of the autophagy pathway (Klionsky et al., 2016). To conclusively establish whether autophagy was required for replication of CHV1-EP713, Δcpatg8 was paired with hypovirus-infected strain EP155/CHV1-EP713. While the converted Δcpatg8 colonies showed viral-infected phenotypes of reduced conidiation and loss of pigmentation, the accumulation level of the viral dsRNA was significantly reduced (Figure 7), demonstrating that cpatg8 plays an important role in CHV1-EP713 replication.
Figure 7
Viral Protein p29 Co-localizes With CpATG8
ATG8 has been used as a marker for autophagy-related structures in a wide range of eukaryotes (Pollack et al., 2009; Voigt and Pöggeler, 2013a; Yin et al., 2016). By co-expression of GFP-CpATG8 and viral p29-RFP in EP155, it was observed that these two proteins co-localized in the vesicles of the cell (Figure 8), likely in the autophagosomes.
Figure 8
Discussion
Autophagy is an evolutionarily conserved biological process found in eukaryotic cells involved in recycling processes. Autophagy can be measured by using fluorescent marker-tagged Atg8 and be inhibited by deletion of autophagy-related genes (Veneault-Fourrey et al., 2006; Duan et al., 2013; Sumita et al., 2017; Ren et al., 2018). Consistently, loss of cpatg8 leads to the inhibited autophagy in C. parasitica (Figure 4), suggesting that cpatg8 is essential for autophagy in this fungus.
Disruption of atg8 has been reported to result in reduced conidiation, impaired aerial mycelial growth, and attenuated virulence in several pathogenic fungi. In the rice blast fungus M. oryzae, it was shown that autophagy was necessary for the blast disease (Kershaw and Talbot, 2009). Disruption of MgATG8 resulted in autophagy-arrested conidial cell death and loss of virulence (Veneault-Fourrey et al., 2006; Liu et al., 2010). In the corn smut fungus Ustilago maydis, autophagy was required for pathogenicity (Nadal and Gold, 2010). In Botrytis cinerea, BcATG8 is essential for autophagy to regulate fungal development and pathogenesis, and deletion of BcATG8 blocked autophagy and significantly impaired aerial hyphal growth, reproductive development, and virulence (Ren et al., 2018). In this regard, our current study was in accordance with the previous findings that ATG8 is required for conidiation and virulence.
Induction of autophagy and exploitation of components of autophagy pathway in favor of viral replication and spread have been reported for many RNA and DNA viruses. For example, HIV blocks the formation of mature autolysosomes in macrophages and exploits the autophagic component during early stages in replication (Kyei et al., 2009). Poliovirus uses autophagy components for genome replication, while dengue and Zika viruses use autophagy components for post-replication processes (Abernathy et al., 2019). In our study, accumulation of autophagosome-like vesicle was found in both CHV1-EP713-infected and rapamycin-treated strains (Figure 1), and genes involved in autophagy were up-regulated in hypovirus-infected strain (Figure 3), suggesting that hypovirus may induce and exploit autophagy for its genome replication. Reduced accumulation of hypoviral dsRNA in cpatg8 null mutant (Figure 7) further supports this assumption. As a matter of fact, it has been reported that hypovirus infection induces proliferation of the vesicle in C. parasitica (Dodds, 1980; Wang et al., 2013) and hypovirus dsRNA and viral encoded p29 had been found to co-fractionate with a trans-Golgi network-derived membrane (Jacob-Wilk et al., 2006), implying that the hypovirus may be trafficked by the vesicles.
The hypovirus-encoded p29 is a multifunctional protein involved in virus replication, suppression of host RNA interference system, post-transcription modification, sporulation, host symptom development, and virulence (Choi et al., 1991; Suzuki et al., 2003; Andika et al., 2019). Our studies also showed hypovirus CHV1-EP713 protein p29-RFP co-localized with GFP-CpATG8. Whether p29 is involved in the process of autophagosome fusion with lysosomes remains to be determined.
Statements
Author contributions
LS carried out the experiment and helped to drafted the manuscript. JW participated in the culture of fungal strains, data analysis, and helped to draft the manuscript. RQ and FY participated in the culture of fungal strains and data analysis. JS designed and supervised the experiment and drafted the manuscript. BC designed and supervised the experiment and revised the manuscript.
Funding
This work was supported in part by grants from the National Natural Science Foundation of China (30960018 and 31170137) and the Natural Science Foundation of Guangxi Province (2012GXNSFAA053044).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcimb.2019.00222/full#supplementary-material
References
1
AbernathyE.MateoR.MajzoubK.van BuurenN.BirdS. W.CaretteJ. E.et al. (2019). Differential and convergent utilization of autophagy components by positive-strand RNA viruses. PLoS Biol. 17:e2006926. 10.1371/journal.pbio.2006926
2
AndikaI. B.KondoH.SuzukiN. (2019). Dicer functions transcriptionally and posttranscriptionally in a multilayer antiviral defense. Proc. Natl. Acad. Sci. U S A. 116, 2274–2281. 10.1073/pnas.1812407116
3
BartoszewskaM.KielJ. A. (2011). The role of macroautophagy in development of filamentous fungi. Antioxid. Redox Signal. 14, 2271–2287. 10.1089/ars.2010.3528
4
ChenM. M.JiangM.ShangJ.LanX.YangF.HuangJ.et al. (2011). CYP1, a hypovirus-regulated cyclophilin, is required for virulence in the chestnut blight fungus. Mol. Plant Pathol. 12, 239–246. 10.1111/j.1364-3703.2010.00665.x
5
ChenY.ChenQ.LiM.MaoQ.ChenH.WuW.et al. (2017). Autophagy pathway induced by a plant virus facilitates viral spread and transmission by its insect vector. PLoS Pathog.13:e1006727. 10.1371/journal.ppat.1006727
6
ChoiG. H.DaweA. L.ChurbanovA.SmithM. L.MilgroomM. G.NussD. L. (2012). Molecular characterization of vegetative incompatibility genes that restrict hypovirus transmission in the chestnut blight fungus Cryphonectria parasitica. Genetics190, 113–127. 10.1534/genetics.111.133983
7
ChoiG. H.PawlykD. M.NussD. L. (1991). The autocatalytic protease p29 encoded by a hypovirulence-associated virus of the chestnut blight fungus resembles the potyvirus-encoded protease HC-Pro. Virology183, 747–752. 10.1016/0042-6822(91)91004-Z
8
ClavelM.MichaeliS.GenschikP. (2017). Autophagy: a double-edged sword to fight plant viruses. Trends Plant Sci. 22, 646–648. 10.1016/j.tplants.2017.06.007
9
DagdasY. F.BelhajK.MaqboolA.Chaparro-GarciaA.PandeyP.PetreB.et al. (2016). An effector of the Irish potato famine pathogen antagonizes a host autophagy cargo receptor. Elife5:e10856. 10.7554/eLife.10856
10
DaweA. L.NussD. L. (2001). Hypoviruses and chestnut blight: exploiting viruses to understand and modulate fungal pathogenesis. Annu. Rev. Genet. 35, 1–29. 10.1146/annurev.genet.35.102401.085929
11
DoddsJ. A. (1980). Association of type 1 viral-like dsRNA with club-shaped particles in hypovirulent strains of Endothia parasitica. Virology107, 1–12. 10.1016/0042-6822(80)90267-6
12
DongX.LevineB. (2013). Autophagy and viruses: adversaries or allies?J. Innate Immun. 5, 480–493. 10.1159/000346388
13
DuanZ.ChenY.HuangW.ShangY.ChenP.WangC. (2013). Linkage of autophagy to fungal development, lipid storage and virulence in Metarhizium robertsii. Autophagy9, 538–549. 10.4161/auto.23575
14
Eusebio-CopeA.SunL.TanakaT.ChibaS.KasaharaS.SuzukiN. (2015). The chestnut blight fungus for studies on virus/host and virus/virus interactions: from a natural to a model host. Virology477, 164–175. 10.1016/j.virol.2014.09.024
15
HafrénA.MaciaJ. L.LoveA. J.MilnerJ. J.DruckerM.HofiusD. (2017). Selective autophagy limits cauliflower mosaic virus infection by NBR1-mediated targeting of viral capsid protein and particles. Proc. Natl. Acad. Sci. U S A. 114, E2026–E2035. 10.1073/pnas.1610687114
16
HaximY.IsmayilA.JiaQ.WangY.ZhengX.ChenT.et al. (2017). Autophagy functions as an antiviral mechanism against geminiviruses in plants. Elife6:e23897. 10.7554/eLife.23897
17
HaywardA. P.Dinesh-KumarS. P. (2011). What can plant autophagy do for an innate immune response?Annu. Rev. Phytopathol. 49, 557–576. 10.1146/annurev-phyto-072910-095333
18
Jacob-WilkD.TurinaM.Van AlfenN. K. (2006). Mycovirus cryphonectria hypovirus 1 elements cofractionate with trans-Golgi network membranes of the fungal host Cryphonectria parasitica. J. Virol. 80, 6588–6596. 10.1128/JVI.02519-05
19
JosefsenL.DroceA.SondergaardT. E.SørensenJ. L.BormannJ.SchäferW.et al. (2012). Autophagy provides nutrients for nonassimilating fungal structures and is necessary for plant colonization but not for infection in the necrotrophic plant pathogen Fusarium graminearum. Autophagy8, 326–337. 10.4161/auto.18705
20
KershawM. J.TalbotN. J. (2009). Genome-wide functional analysis reveals that infection-associated fungal autophagy is necessary for rice blast disease. Proc. Natl. Acad. Sci. U S A. 106, 15967–15972. 10.1073/pnas.0901477106
21
KhanI. A.LuJ. P.LiuX. H.RehmanA.LinF. C. (2012). Multifunction of autophagy-related genes in filamentous fungi. Microbiol. Res. 167, 339–345. 10.1016/j.micres.2012.01.004
22
KlionskyD. J.AbdelmohsenK.AbeA.AbedinMJ.AbeliovichH.Acevedo ArozenaA.et al. (2016). Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy12, 1–222. 10.1080/15548627.2015.1100356
23
KyeiG. B.DinkinsC.DavisA. S.RobertsE.SinghS. B.DongC.et al. (2009). Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. J. Cell Biol. 186, 255–268. 10.1083/jcb.200903070
24
LanX.YaoZ.ZhouY.ShangJ.LinH.NussD. L.et al. (2008). Deletion of the cpku80 gene in the chestnut blight fungus, Cryphonectria parasitica, enhances gene disruption efficiency. Curr. Genet.53, 59–66. 10.1007/s00294-007-0162-x
25
LinH.LanX.LiaoH.ParsleyT. B.NussD. L.ChenB. (2007). Genome sequence, full-length infectious cDNA clone, and mapping of viral double-stranded RNA accumulation determinant of hypovirus CHV1-EP721. J. Virol. 81, 1813–1820. 10.1128/JVI.01625-06
26
LiuT. B.LiuX. H.LuJ. P.ZhangL.MinH.LinF. C. (2010). The cysteine protease MoAtg4 interacts with MoAtg8 and is required for differentiation and pathogenesis in Magnaporthe oryzae. Autophagy6, 74–85. 10.4161/auto.6.1.10438
27
LiuX. H.XuF.SnyderJ. H.ShiH. B.LuJ. P.LinF. C. (2016). Autophagy in plant pathogenic fungi. Semin. Cell Dev. Biol. 57, 128–137. 10.1016/j.semcdb.2016.03.022
28
NadalM.GoldS. E. (2010). The autophagy genes ATG8 and ATG1 affect morphogenesis and pathogenicity in Ustilago maydis. Mol. Plant Pathol. 11, 463–478. 10.1111/j.1364-3703.2010.00620.x
29
NakatogawaH.IchimuraY.OhsumiY. (2007). Atg8, a ubiquitin-like protein required for autophagosome formation, mediates membrane tethering and hemifusion. Cell130, 165–178. 10.1016/j.cell.2007.05.021
30
NussD. L. (2005). Hypovirulence: mycoviruses at the fungal-plant interface. Nat. Rev. Microbiol. 3, 632–642. 10.1038/nrmicro1206
31
PollackJ. K.HarrisS. D.MartenM. R. (2009). Autophagy in filamentous fungi. Fungal Genet. Biol. 46, 1–8. 10.1016/j.fgb.2008.10.010
32
RenW.LiuN.SangC.ShiD.ZhouM.ChenC.et al. (2018). The autophagy gene BcATG8 regulates the vegetative differentiation and pathogenicity of Botrytis cinerea. Appl. Environ. Microbiol. 84:e02455-17. 10.1128/AEM.02455-17
33
SambrookJ.RussellD. W. (2001). Molecular Cloning: A Laboratory Manual. New York, NY: Cold Spring Harbor press.
34
ShiL.LiR.LiaoS.BaiL.LuQ.ChenB. (2014). Prb1, a subtilisin-like protease, is required for virulence and phenotypical traits in the chestnut blight fungus. FEMS Microbiol. Lett. 359, 26–33. 10.1111/1574-6968.12547
35
SumitaT.IzumitsuK.TanakaC. (2017). Characterization of the autophagy-related gene BmATG8 in Bipolaris maydis. Fungal Biol.121, 785–797. 10.1016/j.funbio.2017.05.008
36
SuzukiK.KirisakoT.KamadaY.MizushimaN.NodaT.OhsumiY. (2001). The pre-autophagosomal structure organized by concerted functions of APG genes is essential for autophagosome formation. EMBO J.20, 5971–5981. 10.1093/emboj/20.21.5971
37
SuzukiN.MaruyamaK.MoriyamaM.NussD. L. (2003). Hypovirus papain-like protease p29 functions in trans to enhance viral double-stranded RNA accumulation and vertical transmission. J. Virol. 77, 11697–11707. 10.1128/JVI.77.21.11697-11707.2003
38
Veneault-FourreyC.BarooahM.EganM.WakleyG.TalbotN. J. (2006). Autophagic fungal cell death is necessary for infection by the rice blast fungus. Science312, 580–583. 10.1126/science.1124550
39
VoigtO.PöggelerS. (2013a). Autophagy genes Smatg8 and Smatg4 are required for fruiting-body development, vegetative growth and ascospore germination in the filamentous ascomycete Sordaria macrospora. Autophagy9, 33–49. 10.4161/auto.22398
40
VoigtO.PöggelerS. (2013b). Self-eating to grow and kill: autophagy in filamentous ascomycetes. Appl. Microbiol. Biotechnol. 97, 9277–9290. 10.1007/s00253-013-5221-2
41
WangJ.WangF.FengY.MiK.ChenQ.ShangJ.et al. (2013). Comparative vesicle proteomics reveals selective regulation of protein expression in chestnut blight fungus by a hypovirus. J. Proteomics78, 221–230. 10.1016/j.jprot.2012.08.013
42
YaoZ.ZouC.ZhouH.WangJ.LuL.LiY.et al. (2013). Delta(1)-pyrroline-5-carboxylate/glutamate biogenesis is required for fungal virulence and sporulation. PLoS ONE8:e73483. 10.1371/journal.pone.0073483
43
YinZ.PascualC.KlionskyD. J. (2016). Autophagy: machinery and regulation. Microb. Cell3, 588–596. 10.15698/mic2016.12.546
Summary
Keywords
cpatg8, autophagy, hypovirus, virulence, chestnut blight fungus
Citation
Shi L, Wang J, Quan R, Yang F, Shang J and Chen B (2019) CpATG8, a Homolog of Yeast Autophagy Protein ATG8, Is Required for Pathogenesis and Hypovirus Accumulation in the Chest Blight Fungus. Front. Cell. Infect. Microbiol. 9:222. doi: 10.3389/fcimb.2019.00222
Received
31 January 2019
Accepted
11 June 2019
Published
10 July 2019
Volume
9 - 2019
Edited by
Daohong Jiang, Huazhong Agricultural University, China
Reviewed by
Angie Gelli, University of California, Davis, United States; Ping Wang, School of Medicine, Louisiana State University, United States; Zhengyi Wang, Zhejiang University, China
Updates
Copyright
© 2019 Shi, Wang, Quan, Yang, Shang and Chen.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Jinjie Shang jinjieshang@njnu.edu.cnBaoshan Chen chenyaoj@gxu.edu.cn
†Present Address: Jinzi Wang, School of Marine Sciences and Biotechnology, Guangxi University for Nationalities, Nanning, China
This article was submitted to Fungal Pathogenesis, a section of the journal Frontiers in Cellular and Infection Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.