Abstract
Tenacibaculosis occurs due to the marine bacterial pathogen Tenacibaculum maritimum. This ulcerative disease causes high mortalities for various marine fish species worldwide. Several external clinical signs can arise, including mouth erosion, epidermal ulcers, fin necrosis, and tail rot. Research in the last 15 years has advanced knowledge on the traits and pathogenesis mechanisms of T. maritimum. Consequently, significant progress has been made in defining the complex host-pathogen relationship. Nevertheless, tenacibaculosis pathogenesis is not yet fully understood. Continued research is urgently needed, as demonstrated by recent reports on the re-emerging nature of tenacibaculosis in salmon farms globally. Current sanitary conditions compromise the development of effective alternatives to antibiotics, in addition to hindering potential preventive measures against tenacibaculosis. The present review compiles knowledge of T. maritimum reported after the 2006 review by AvendaƱo-Herrera and colleagues. Essential aspects are emphasized, including antigenic and genomic characterizations and molecular diagnostic procedures. Further summarized are the epidemiological foundations of the T. maritimum population structure and elucidations as to the virulence mechanisms of pathogenic isolates, as found using biological, microbiological, and genomic techniques. This comprehensive source of reference will undoubtable serve in tenacibaculosis prevention and control within the marine fish farming industry. Lastly, knowledge gaps and valuable research areas are indicated as potential guidance for future studies.
1 Introduction
Aquaculture is a prominent and promising food-production industry, globally providing animal-protein sources and helping to cover food shortage gaps arising from population overshoots (). Approximately 17% of animal protein and 7% of all protein for human consumption is derived from fish; indeed, more than 3.3 million people rely on fish for up to 20% of average per capita animal-protein intake (). Increasing demand requires increased fish production, a particularly acute situation considering the recession of fisheries in recent decades (). New technologies are helping to propel the industry, including shrimp and, specifically, fish production (). However, more intensive farming may negatively impact culturing waters, as associated with environmental pollution and the emergence and spread of aquatic pathogens (). Water-borne diseases are, a critical issue facing the global aquaculture industry (). Aquatic diseases are not a singular event but, rather, one of a linked chain of events involving interactions among pathogenic microorganisms, aquatic species, and environmental conditions ().
Relatively few pathogenic bacteria account for most of the financial losses incurred by the industry. However, new āemergingā diseases arise biannually and constantly impose health challenges limiting fish production. Classically, pathogenic bacteria are classified as extracellular, facultative intracellular, and obligate intracellular (). The survival and dispersion of facultative bacteria are uncertain, particularly as environmental conditions worsen. By contrast, most pathogenic microbes regularly exist as assembled colonies on the host or freely live in the aquatic environment (). Interestingly, all bacterial types could turn pathogenic if fish immunity is compromised ().
Prominent among the causes for economic losses in global aquaculture are emerging diseases caused by Tenacibaculum species (Family Flavobacteriaceae, Phylum Bacteroidetes). Most available studies involving Tenacibaculum species associate disease in marine fish with infection caused by Tenacibaculum maritimum (see review by ). This disease was originally described as a Flexibacter infection in association with mortalities among farmed red (Pagrus major) and blackhead (Acanthopagrus schlegelii) seabream in Japan (). From 1977 to 2006, the disease was variably termed in relation to external lesions, fish species, and fish age. These changes finally included a taxonomic name change for the bacterium (see reviews by ; ).
Tenacibaculum spp. infections are today commonly referred to as marine tenacibaculosis or, simply, tenacibaculosis, a term originally coined to describe the ulcerative disease caused by the filamentous T. maritimum bacterium (). Tenacibaculosis is generally associated with gross lesions on the body, including ulcerative and/or necrotic skin lesions, an eroded/hemorrhagic mouth, frayed fins, and tail rot (; ). Despite the association between T. maritimum isolation and the aforementioned clinical signs, consensus as to the primary or opportunistic nature of this pathogen is lacking. Research by numerous groups in recent decades has significantly advanced understandings of the characteristics and pathogenesis of T. maritimum, thereby helping to define complex host-pathogen relationships (). However, tenacibaculosis pathogenesis is still not fully elucidated.
Most published reviews on T. maritimum report evidence existing prior to 2006. Therefore, the purpose of the present review is to compile and summarize knowledge obtained on T. maritimum within the last 15 years. Focus is given to phenotypic, antigenic, and genomic characterizations and to recent molecular diagnostic procedures. Additionally summarized are the epidemiological foundations of the T. maritimum population structure (i.e., host and geographical distribution). Finally reported are findings elucidating the virulence mechanisms of pathogenic T. maritimum isolates through biological, microbiological, and genomic techniques. The compilation of this information will prove invaluable for tenacibaculosis prevention and control in marine fish farming. Lastly, emphasis given to still existing knowledge gaps and valuable research areas will serve as guidance for future investigative efforts.
2 Description of Tenacibaculum maritimum
The original taxonomic classification of the previously mentioned Flexibacter bacterium was a topic of controversy and confusion until . This research reclassified said bacterium as T. maritimum, in addition to adding Tenacibaculum ovolyticum and two other species to the newly formed genus. Today, T. maritimum is the type species of the Tenacibaculum genus, which includes 33 validly and 3 invalidly published species (https://www.bacterio.net/genus/tenacibaculum). All are exclusively found in marine environments attached to or associated with the surface of marine organisms such as macroalgae, various invertebrates, and fish. In addition to T. maritimum, seven other Tenacibaculum fish pathogens have been identified ā T. ovolyticum from Atlantic halibut (Hippoglossus hippoglossus) (; ); T. discolor from European and Asian sea bass (Dicentrarchus labrax and Lates calcarifer) (); T. soleae from Senegalese sole (Solea senegalensis) (); T. dicentrarchi from Atlantic salmon (Salmo salar) (; ); T. finnmarkense from rainbow trout (Oncorhynchus mykiss) (); and T. singaporense () and T. piscium (; ) from Corkwing wrasse (Symphodus melops). Hereinafter, this review will focus only on T. maritimum.
The physical traits of T. maritimum are as follows: filamentous; Gram-negative; usually sized 2 ā 30 µm in length with a diameter of 0.5 µm; gliding motility; and positive growth on media containing ā„ 10% seawater (i.e., no growth with only NaCl as the only added salt) (). Several traits are common to the Tenacibaculum genus, including the production of a primarily zeaxanthin yellow carotenoid pigment, flexirubin-type pigment are absent; the major respiratory quinone is menaquinone-6 and are catalase- and -oxidase positive (). As a point of difference compared to other Tenacibaculum species, including T. ovolyticum () and T. finnmarkense (), T. maritimum absorb Congo red on solid agar when some colonies on agar are directly flooding with drops of a 0 ± 01% aqueous solution of the dye ().
Intraspecific phenotypic similarities among T. maritimum isolates may aid in taxonomic identification when compared to other Tenacibaculum species pathogenic to fish. Indeed, some of the above-mentioned morphotype and physiological properties can serve as initial tube and plate analyses for species differentiation, in addition to the application of traditional, ready-made identification systems (e.g., API ZYM and API 50 CH) (; ; ). However, API results are not always identical due to factors such as the inoculum, isolate, and incubation temperature, among others. For example, differences are reported for tests on nitrate reduction and hydrogen-sulfide production (). The phenotypic and biochemical characteristics used for the precise detection and differentiation of T. maritimum against other fish pathogens are given in TableĀ 1. The complete genome sequence of the type strain NCIMB 2154T consists of a circular chromosome of 3,435,971 base pairs with 2,866 predicted protein-coding genes, excluding any plasmid (). Some of these genes are implicated in T. maritimum virulence and pathogenicity, as discussed in section 8 Virulence Factors.
TableĀ 1
| Characteristic | T. maritimum | T. ovolyticum | T. singaporense | T. discolor | T. piscium | T. soleae | T. dicentrarchi | T. finnmarkense |
|---|---|---|---|---|---|---|---|---|
| Colony morphology | Uneven edge, pale yellow | Regular edge, pale yellow | Orange witd circular shape | Uneven edge, bright yellow | Circular, bright yellow | Circular, yellow | Uneven edge, pale yellow | Undulating margin, yellow |
| Temperature (°C) | 15-34 | 4-25 | 20-45 | 14-38 | 4-25 | 14-30 | 4-30 | 2-20 |
| Congo Red Absorption | + | nt | nt | nt | W | nt | + | ā |
| pH range | 5.9-8.6 | 6-10 | 5-9 | 6-8 | 4-10 | 5-10 | 6-8 | 4-9 |
| Flexirubin type pigment | ā | ā | ā | ā | nt | ā | ā | ā |
| Tween 80 degradation | + | + | nt | ā | ā | ā | V | ā |
| Starch hydrolysis | + | + | + | ā | ā | ā | ā | ā |
| Proline utilization | ā | ā | nt | + | W | ā | ā | + |
| Glutamate utilization | W | ā | nt | + | ā | ā | ā | + |
| Growth with seawater (%) | 30-100 | 70-100 | 30-100 | 30-100 | 10-100 | 55-100 | 30-100 | 50-100 |
| Trypsin | + | nt | ā | + | ā | ā | ā | nt |
| A-Chymotrypsin | + | nt | W | + | ā | ā | ā | ā |
| Nitrate reduction | + | + | + | + | ā | + | nt | + |
Differential phenotypic and biochemical characteristics of the type strains for Tenacibaculum species associated with fish diseases.
Data are from ; ; ; ; , and . +, positive; ā, negative; V, variable; nt, not tested; and W, weak.
3 Antigenic and genetic characterization of Tenacibaculum maritimum
Various typing methods have been applied in epidemiological studies of T. maritimum, including the slide agglutination test; the dot-blot and immunoblotting assays; multiplex PCR (mPCR) serotyping; the randomly amplified polymorphic DNA (RAPD) method; the multi-locus sequence analysis (MLSA); and assembled draft genomes, among others. These methods confirm the existence of intra-specific diversity among T. maritimum isolates. In the early 2000s, three serotypes were identified through immunoblot analyses of lipopolysaccharides with varying degrees of relation to host fish species (; ). Subsequent serotyping research describes up to four serotypes in T. maritimum (; ). This antigenic diversity makes it difficult to select candidate strain(s) for intra-species vaccine development, as described in section 9 Treatment and Vaccination Programs for T. maritimum.
Despite proposed serotyping schemes for T. maritimum, several disadvantages exist for conventional mammal-antisera-based serotyping, including sera availability and result interpretations (). These difficulties have spurred the development of new molecular techniques, such as those proposed by , where determination of the O-antigen structure allows for differentiating serotypes. This method is based on genes coding for the biosynthesis of the O-antigen, which are often located in a single genomic cluster (i.e., the O-AGC) and fall into one of the following three classes: (i) nucleotide sugar biosynthesis genes; (ii) sugar transferase genes; or (iii) genes required for O-unit translocations, chain synthesis, and chain-length determination. Application of this knowledge is evidenced by , a study that identified the O-AGC gene cluster in T. maritimum using a set of recently published T. maritimum genomes (; ) and primers specifically designed for the O-antigens of representative isolates of the defined serotypes (; ). These breakthroughs allowed to develop an mPCR-based serotyping scheme that combines traditional serotyping with a genome-wide association study.
At the genetic level, cluster analyses of the RAPD-PCR profiles for 29 isolates and 3 reference strains of T. maritimum showed that, regardless of the oligonucleotide primer employed, the isolates and strains were separated into two main groups that strongly correlated with the host species and/or the described O serotypes (; ). Elucidation of the T. maritimum genome through next generation sequencing techniques has allowed for (i) the design of primers directed at constitutive genes of the pathogen and (ii) the characterization of population diversity. While an advancement, these evolved developments naturally limited the use of random amplification techniques, such as those previously proposed by , because they are based on a comparison of amplification patterns. These previous limitations have been overcome by through the application of MLSA to 114 isolates representatives of the Tenacibaculum genus, including T. maritimum isolates reflecting the global diversity of this species. The proposed method is based on eleven loci located within single-copy protein-coding genes conserved across the Flavobacteriaceae family were used to design generic degenerated PCR primers for the Tenacibaculum genus. highlighted the existence of a cohesive T. maritimum group and recommended the use thereof to monitor infections caused by Tenacibaculum species. However, not all primer sets given by had the same efficiency during amplification, leading to propose the use of other primer sequences targeting five genes.
Confirmation of the MLSA scheme as a powerful tool for taxonomic affiliation and isolate identification of T. maritimum has been demonstrated with field isolates (; ; ). Such power has even been shown for the pathogen T. dicentrarchi (; ) and several pathogenic species that have yet to be described (). In this sense, noted that genotyping in the Canadian region increased their understandings of the genetic profile of T. maritimum. These authors reported two new sequence types among Western Canadian isolates of T. maritimum. Despite the known antigenic and genetic heterogeneity of T. maritimum hindering development of effective biological products (e.g., vaccines), the available investigative techniques for isolates of interest within the T. maritimum population, including mPCR-serotyping and MLSA, represent a significant and robust advancement towards commercial vaccines.
4 Natural reservoirs and prevalence factors
The natural reservoir(s) of T. maritimum are unclear as little ecological data for this microorganism exist. However, the propensity of T. maritimum to survive for a prolonged time in different seawater microcosms (), as well as its ability to infect different fish species indicates that water is an important infection route. This may explain why T. maritimum has been isolated from sediments, tank surfaces, and water exposed to infected fish stocks (). Some reports suggest that natural T. maritimum outbreaks occur shortly after transferring fish from hatchery tanks to inshore net cages, could be explained by handling stress and/or skin damage, indicating pathogen-to-host access by horizontal transmission in seawater (see ).
Certain bacteria may use the ecosystem along with the normal microbiota of marine organisms as reservoirs (), as has been described for T. maritimum. To this end, jellyfish (Phialella quadrata) blooms could conceivably provide both a colonization site (via initial nematocyst-related injuries) and a source of Tenacibaculum infection (). also suggested that the sea lice (Lepeophtheirus salmonis) might serve as an organic substrate capable of extending Tenacibaculum persistence in seawater. More recently, tracked the diversity and composition of S. salar skin surface microbiota throughout a complete L. salmonis infection cycle, finding that the Tenacibaculum genus was perhaps the most abundant taxon across all mucus and water samples. Indeed, the ability of T. maritimum like member of Flavobacteriaceae family to survive in host skin mucus and cope with the bactericidal activity of the skin mucus reflects the potential of this tissue to act as a major reservoir (; ; ; ).
One factor that plays a key role in the presence of T. maritimum is seawater temperature. Acute and/or chronic exposure to suboptimal temperatures is generally suppressive, especially for the adaptive immunity of fish, thus increasing disease prevalence (). A significant rise in the severity and prevalence of tenacibaculosis has been reported at higher seawater temperatures and salinities (see ). Other evidence reported by demonstrates the influence of water temperature on the experimental induction of tenacibaculosis in Japanese olive flounder (Paralichthys olivaceus) using immersion and dilution methods. These authors observed high mortality rates between 17 and 26 °C but not below 17 °C or above 26 °C. In contrast, declared that warm seawater temperatures have no influence or strong correlation with an increased prevalence of T. maritimum. In turn, the rising seawater temperature around Tasmania has increased tenacibaculosis frequency (), but, interestingly, massive tenacibaculosis outbreaks have also been recorded during the winter (; ). Conversely, reported high disease prevalence in black damsel (Neoglyphidodon melas), Picasso triggerfish (Rhinecanthus assasi), and broomtail wrasse (Cheilinus lunulatus) during winter but no T. maritimum infections during summer. Likewise, reported three outbreaks of tenacibaculosis in wedge sole fish (Dicologlossa cuneata) cultured at 20.5°C in southwestern Spain. The winter water temperature ranged mainly from 15-20°C, which, as concluded by the authors, is perfect for the growth and propagation of T. maritimum. Taken together, these reports could explain the explosive appearance of tenacibaculosis outbreaks worldwide, since, as is known, climate change has increased the temperature of seawater globally (). Further studies are required to elucidate this issue further and assess the risks associated with this and other environmental parameters.
In addition to water temperature, tenacibaculosis is often associated with poor management conditions (e.g., high rearing density, reduced or excessive feed administration, and/or mechanical damage of the skin and mucus barrier) (; ). Adverse growing conditions increase the intensity and distribution pattern of the causative agent in various organs of hosts (). On the other hand, natural outbreaks of tenacibaculosis at farms without a prior history of T. maritimum infection imply that transferred fish may act as asymptomatic vectors. This is consistent with the proposed horizontal transmission of tenacibaculosis, as confirmed by . Transmission of T. maritimum through seawater and directly from one host to another have been proposed as routes of infection (). Likewise, the successful recovery of bacteria from the intestine of apparently healthy infected fish without any histological and pathological lesions reflects another potential reservoir for T. maritimum (). Given all these factors, T. maritimum has the potential to harm a wide range of wild, captive, and farmed fish species, making it a pathogen worthy of serious consideration as a threat to the global fish-aquaculture industry ().
5 Geographical distribution and host susceptibility
The geographical and host distribution of T. maritimum isolates is presented in depth by . Importantly, and as mentioned in section 4 Natural Reservoirs and Prevalence Factors, T. maritimum is a mesophilic microorganism that grows well between 15 and 34°C, a range representative of aquatic environments in which fish are farmed (). Temperature range can likewise vary when considering T. maritimum isolates from warmer-water fish species (), even T. maritimum isolates from salmon and other cold-water species appear to have lower optimal temperatures. Although the optimum growth temperature under laboratory culture conditions is 30°C. Incubation temperatures from 15 to 18°C are probably suitable for most salmonid-related isolates. Despite the slow growth of cultures seeded directly from external lesions, this bacterium forms distinctive colonies with mutable rhizoid edges and adherence capacity on low-nutrient media containing sea salts (e.g., Flexibacter maritimus medium [FMM] and Marine Agar 2216) (). Marine agar supplemented with 50 µg/mL kanamycin has also been devised for the recovery and isolation of T. maritimum directly from skin ulcers (). Underscoring the need for suitable culturing media, microbiology companies have developed an FMM broth1 as the medium of choice for laboratories without immediate access to a natural source of seawater.
These advancements in isolation and culturing mean that T. maritimum has now been retrieved and recognized in more geographies and hosts than those described up to 2006. In Europe, T. maritimum has been isolated in Italy from farmed tub gurnard (Chelidonichthys lucerna L.) and wild turbot (Scophthalmus maximus) (); and in Norway from the lumpsucker cleaner fish (Cyclopterus lumpus) (). In Asia, the pathogen was retrieved from Korean olive flounder (P. olivaceus) (). In Africa, this bacterium has been reported in Egypt in association with gilthead sea bream (Sparus aurata) and European sea bass (D. labrax) (; ). Tenacibaculum maritimum has even extended beyond food-oriented fish to some valuable ornamental fish, including the Picasso triggerfish, black damselfish, and broomtail wrasse in Egypt (; ; ). In French Polynesia, this bacterium has been described as the cause of massive mortalities (up to 90%) among the tropical orbicular batfish (Platax orbicularis) (). Despite significant efforts to remain free-of T. maritimum infections in Chile, which is the second largest producer of salmon after Norway, outbreaks of T. maritimum have been reported in farmed Atlantic salmon () and rainbow trout (), and outbreaks have likewise been reported in Canada among Sockeye salmon (Oncorhynchus nerka) (). Susceptible hosts for T. maritimum and the respective geographic origins are briefly summarized in TableĀ 2.
TableĀ 2
| Geographic origin | Susceptible host | Country | References |
|---|---|---|---|
| Asia | Olive flounder Paralichthys olivaceus | Korea | |
| Europe | Tub gurnard Chelidonichthys lucerna | Italy | |
| Wedge sole Dicologlossa cuneata | South-western Spain | ||
| Lumpfish Cyclopterus lumpus | Norway | ||
| Sand tiger shark Carcharias taurus | Italy | ||
| Atlantic salmon Salmo salar | Spain, Scotland, Ireland | ||
| European sea bass Dicentrarchus labrax | Turkey | ||
| America | Atlantic salmon Salmo salar | Chile | |
| Sockeye salmon Oncorhynchus nerka | Canada | ||
| Rainbow trout Oncorhynchus mykiss | Chile | ||
| Africa | Black damselfish Neoglyphidodon meles Picasso triggerfish Rhinecanthus assasi | Egypt | |
| Broomtail wrasse Cheilinus lunulatus | Egypt | ||
| Gilthead sea bream Sparus aurata | Egypt | ||
| European sea bass Dicentrarchus labrax | Egypt | ||
| Oceania | Orbicular batfish Platax orbicularis | French Polynesia | |
| Chinook salmon Oncorhynchus tshawytscha | New Zealand |
Susceptible host species for Tenacibaculum maritimum and the respective geographic origin (updated since 2006).
6 Presumptive and confirmative diagnostic procedures for Tenacibaculum maritimum
The initial diagnosis of tenacibaculosis caused by T. maritimum was, for a long period, based on clinical signs associated with diseased fish. However, field experience indicates that assigning a specific diagnosis based solely on this criterion is quite difficult as the same signs could also be attributable to other pathogens (). Insufficiency as a diagnostic method becomes clearer knowing that different Tenacibaculum species can be found in the same lesion. Indeed, clinical signs from coinfections can be difficult to distinguish since information is lacking as to which pathogen is responsible for which sign of infection. For example, tenacibaculosis is commonly associated with external clinical signs in Atlantic salmon, but the lesions are very different when caused by T. maritimum (i.e., body and caudal fin lesions) or T. dicentrarchi (i.e., head and snout lesions) (). An erroneous attribution for the cause of mortality is most worrying when considering that such diagnoses are used to substantiate metaphylactic antibacterial treatments to cages containing healthy, moribund, infected, and/or disease-carrying fish. Another common, yet controversial, practice within Chilean salmon farms is the diagnosis of death caused by Tenacibaculum spp. when signs of mixed infection with the intracellular, facultative fish pathogen Piscirickettsia salmonis are present. Prior to 2018, such cases were classified exclusively as piscirickettsiosis (). These cases are now classified as infections caused by a āTenacibaculum-complex.ā For instance, the first isolation of T. maritimum together with T. dicentrarchi from Chilean-farmed Atlantic salmon occurred during a harmful algae bloom caused by Pseudochattonella spp. (). Similar tenacibaculosis coinfections have been reported in salmon farms in Norway (; ), Australia (), and Canada ().
Several studies further indicate differences in the susceptibility of certain fish species to T. maritimum infection based on age, and lesions vary greatly between affected fish species (). Crucial to remember is that within a few days, damaged tissues can significantly deteriorate from early- to advanced-stage ulceration (). Weight also impacts susceptibility; fish weighing 2-80Ā g are more susceptible to acute infection, whereas fish over 100Ā g seem less susceptible (). Further influencing infection severity and mortality rates are temperature, water parameters, rearing conditions, stress, and interfering parasitic infestations (). In a presumptive diagnosis, the main macroscopic lesions associated with T. maritimum infection are external and include ulcerative skin, tissue necrosis, mouth erosion, tail and fin rots, and necrosis of the gills and eyes [see review by ; ]. All of these tissues are usually infected by T. maritimum, resulting in bacterial networks around dead surfaces, producing potent toxins and attenuating host defense mechanisms (; ). The most common pathologic finding internally is paleness of the organs (). However, a more serious T. maritimum infection in a gray mullet (Mugil capito) specimen showed moderate erythematous hemorrhaging at the base of the anal and pelvic fins and septicemic lesions manifested as severe congestion in the gills, kidney, and other visceral organs, with bloody hemorrhagic exudates ().
At the microscopic level, described the pathologic changes in S. sole infected with T. maritimum using light and scanning-electron microscopy. The main lesions observed were detachment of the skin dermis and epidermis, hyaline degeneration, and necrosis in the musculature, as well as an inflammatory response around muscle cells. Moreover, scanning electron microscopy revealed the presence of filamentous, Gram-negative bacteria in the dermis layer and over the scales. Other research in a P. orbiculares specimen associated the intensity of ulcerative skin lesions with the number and area of whitish patches caused by T. maritimum (). The respective histopathological view thereof for affected skin showed severe degeneration in both the dermis and epidermis layers with an aggregation of filamentous bacteria and leukocyte infiltration. These observations could be associated with the moderate hydrophobicity and rapid ability to form biofilms of T. maritimum isolates, as evidenced under in vitro conditions with live and dead cells in multi-layered bacterial aggregates (FigureĀ 1). These traits may contribute to T. maritimum pathogenicity (). The aforementioned points complicate diagnosis and mean that macroscopic and microscopic observations are only a hypothetical approach. The use of laboratory protocols is, therefore, essential.
FigureĀ 1
Definitive diagnosis requires colony isolation on specific media (i.e., FMM agar or media supplemented with antibiotics), but T. maritimum isolation from diseased fish is not always successful. Thereafter, minimal morphological and biochemical traits must be determined. Tenacibaculum maritimum typically display as flat, pale-yellow colonies with irregular edges on FMM agar, but on marine agar, colonies look round and yellow (). However, these traditional microbiological isolation and identification methods require a protracted time for precise diagnosis, resulting in high fish mortalities. These phenotyping assessments are becoming less frequently used due to the ever-increasing availability of advanced analytical methods (e.g., PCR, gene sequencing, and proteomic approaches). Moreover, specific molecular detection may be challenging given the diversity of undescribed Tenacibaculum taxa.
Importantly, T. maritimum as a filamentous bacterium presents many obstacles to laboratory work. Cells aggregate and adhere tightly to different substrates, thus impeding the recognition of T. maritimum colonies (). has evaluated several approaches to improve bacterial culture conditions, including treatment with non-ionic surfactants, detergents, cellulase hydrolysis, and shaking. Higher yields without clustering were obtained through continuous shaking during culturing (i.e., 140 rpm). This finding contrasts to other trials that gave obvious bacterial aggregates. However, bacterial growth depends on the employed culture medium. For example, significantly more limited growth is observed for FMM broth as compared to marine broth (FigureĀ 2).
FigureĀ 2
Undoubtedly, PCR protocols can serve as powerful tools to identify fish pathogens from plate cultures and fish tissues (
TableĀ 3
| Gene of interest | Primers acronym | Designed primers 5ā²ā3ā² | Processed sample | References |
|---|---|---|---|---|
| Conventional PCR (C-PCR) | ||||
| 16SrRNA | F: MAR1 R: MAR2 | AATGGCATCGTTTTAAA CGCTCTCTGTTGCCAGA | Pure and mixed cultures | ( |
| F: Mar1 R: Mar2 | TGTAGCTTGCTACAGATGA AAATACCTACTCGTAGGTACG | Pure and mixed cultures | ( | |
| Nested PCR | ||||
| 16SrRNA | F: 20F R: 1500R | AGAGTTTGATCATGGCTCAG GGTTACCTTGTTACGACTT | Pure and mixed cultures | ( |
| F: Mar1 R: Mar2 | TGTAGCTTGCTACAGATGA AAATACCTACTCGTAGGTACG | Tissues infected fish | ( | |
| F: pA R: pH | AGAGTTTGATCCTGGCTCAG AAGGAGGTGATCCAGCCGCA | Pure and mixed cultures | ( | |
| F: MAR1 R: MAR2 | AATGGCATCGTTTTAAA CGCTCTCTGTTGCCAGA | Tissues of challenged fish | ( | |
| Quantitative real-time PCR (Q-PCR) | ||||
| 16SrRNA | F: MAR3 R: MAR6 Taqman probe | GATGAACGCTAGCGGCAGGC CCGTAGGAGTCTGGTCCGTG CACTTTGGAATGGCATCG | Pure and mixed cultures Tissues infected fish Formalin-fixed | ( |
| F: Tm-rRNA16Fw R: Tm-rRNA16SFv | CTTTGGAATGGCATCGTTTT CGTAGGAGTCTGGTCCGTGT | Pure and mixed cultures | ( | |
| β-actin (internal control) | F: β-actin-Fw R: β-actin-Rv | CTGAAGTACCCCATTGAGCAT CATCTTCTCCCTGTTGG CTTT | Tissues of naturally and experimentally infected fish | ( |
| Outer membrane protein A (ompA) gene | F: R: Probe: | GCCAATAGCAACGGGATACC TCGTGCGACCATCTTTGGT TGAATCAAATGCGATCTT | Tissues of experimentally infected fish | ( |
PCR-based protocols described for species-specific detection of Tenacibaculum maritimum.
Other molecular methods that couple PCR amplification with a serological procedure or species-specific oligonucleotide probes are also available to detect T. maritimum, including the PCR-enzyme-linked immunosorbent assay (PCR-ELISA) (
TableĀ 4
| Locus | Primer Sequences (5ā²ā3ā²) | Amplicon length (bp) | Reference | |
|---|---|---|---|---|
| Forward | Reverse | |||
| atpA | ATTGGWGAYCGTCAAACWGG | CCAAAYTTAGCRAAHGCTTC | 567 | |
| atpD | TGGYCCAGTWATCGATGTTGA | AATACGYTCTTGCATTGCTC | 807 | |
| dnaK | GGWACYACNAAYTCDTGTGT | TCWATCTTMGCTTTYTCAGC | 573 | |
| fusA | ATGGTAACTCACCCATTCCAGA | TGGCATGATGCAACACAAGG | 767 | |
| glyA | CAYTTAACWCAYGGWTCDCC | ACCATRTTTTTRTTTACHGT | 558 | |
| gyrB | AGTATYCARGCRCTRGAAGG | GTWCCTCCTTCRTGYGTRTT | 597 | |
| ileS | CCWACHTTTGGWGCHGAYGA | GAATCRAACCAWACATCAAT | 542 | |
| infB | ATGCCDCAAACWAAAGARGC | GTAATHGCTCCAACYCCTTT | 564 | |
| pgk | GCTCCWCCACCWGTAGAAAC | GCTCCWCCACCWGTAGAAAC | 935 | |
| rlmN | GCKTGTGTDTCDAGYCARGT | CCRCADGCDGCATCWATRTC | 549 | |
| rpoB | ATYTCTCCAAAACGCTGACC | AAAACGAATCAAGGWACGAAYA | 3266 | |
| ACCCTTTCCAAGGCATAAAGG | GAGCCATYGGTTTTGAAAGAGA | |||
| GAGCCATYGGTTTTGAAAGAGA | GAGCCATYGGTTTTGAAAGAGA | |||
| tgt | GAAACWCCWATWTTYATGCC | TAYAWYTCTTCNGCWGGTTC | 486 | |
| trpB | GTWGCNCGWATGAAAATGYT | CCWGGRTARTCYAATCCTGC | 368 | |
| tuf | AGAGAWTTATTRTCTTTCTA | GTTACCTGACCWGCWCCWAC | 554 | |
| ACCTCCTTCACGGATAGC | TTACGATCGTTCGAAGCCCC | 971 | ||
| yqfO | GCBGAARRTTTTGAYAAYGT | AYTTCRTARGCDACYTCTTC | 446 | |
Primer sets used for PCR analysis of Tenacibaculum species loci proposed in the MLST.
Multi-locus sequence analysis is now widely used not only for genetic differentiation and the estimation of evolutionary relationships among Tenacibaculum species, but also for the specific identification of T. maritimum from pure cultures (
Most PCR protocols are (a) time-consuming; (b) liable to produce multi-sized and nonspecific amplicons for environmental and field samples; and (c) require thermal cycling devices (
7 Pathogenicity of Tenacibaculum maritimum infection
Pathogenicity is defined as the hereditary capacity of a microorganism to actuate infection, as interceded by particular harmful variables. Pathogenicity also alludes to the degree of bacterial destructiveness and harmful impact on host tissues (
For example,
Initial pathogenicity studies conducted in the 1990s with commercial fish species such as European sea bass (
The available scientific evidence shows that seawater is of crucial importance in the horizontal transmission of T. maritimum, but other routes of entry to the host cannot be ruled out, such as direct contact with marine invertebrates colonized by the bacterium (
8 Virulence factors
Virulence is the relative capacity of a microorganism to cope with the hostās immune response and to replicate and reproduce, thus resulting in disease development (
Moreover, in vitro work established by
Besides stickiness, the hemagglutinating activity of T. maritimum may also influence its destructiveness. Further demonstrated by
T. maritimum is a proteolytic fish pathogen (
Despite efforts made in the past few decades, the pathogenesis of T. maritimum is a multifactorial process that is still not fully understood. To further elucidate the cell-level immune responses of and the cytotoxic effects against S. senegalensis head-kidney leukocytes,
FigureĀ 3

Microscopic pictures of Senegalese sole head-kidney leukocytes after exposure to (A) L15 medium or (B, C) extracellular products of T. maritimum at 100 µg mL-1 for 24 h. Yellow arrows indicate (B) inner vacuolization, cell elongation and/or degradation and (C) cell clustering and conglomeration. These results were obtained from
One of the most studied virulence mechanisms of T. maritimum is its ability to compete effectively with the host for iron (
The T. maritimum genome also has genes encoding the superoxide dismutases manganese-dependent type (sodA), iron-dependent sodB, and zinc-dependent type (sodC), the last of which is only found in virulent strains (
Not all genetic information on T. maritimum has reached consensus. For example, controversy surrounds the existence of communication processes mediated by quorum sensing.
The genome sequences of the T. maritimum type strain provided valuable insights into the existence of many predicted genes potentially implicated in the virulence and pathogenicity of T. maritimum. Through the analysis of 24 T. maritimum-strain genomes recovered from different hosts and geographical areas,
9 Treatment and vaccination programs for Tenacibaculum maritimum
To date, the only commercially available vaccine for T. maritimum is for turbot, specifically strain LPV1.7 serotype O22. Hence, the control of tenacibaculosis in other cultured species and for other strains is mainly limited to the frequent use of antibiotics and certain disinfectants (
An in vitro study using disk diffusion susceptibility testing on FMM plates, showed that 63 T. maritimum isolates from several hosts and geographical regions were resistant to oxolinic acid but susceptible to amoxicillin, nitrofurantoin, florfenicol, oxytetracycline, and trimethoprim-sulfamethoxazole (
The widespread use of antimicrobials in aquaculture could cause the appearance of multidrug-resistant T. maritimum strains (
Enrofloxacin, a second generation fluoroquinolone, usually exhibits promising antimicrobial activity against Flavobacterium spp. (
The emergence of multiple drug resistant pathogens, together with the negative impact of antibiotics on the beneficial gastrointestinal microbiota of fish, has encouraged developed countries to prohibit the use of all subtherapeutic antibiotics (Regulation [EC] No 1831/2003, Europe) (
Comparably, plant extracts exhibit potent antimicrobial activity against a variety of Gram-positive and Gram-negative bacteria and are generally regarded as safe by the Food and Drug Administration (
Despite recent strategies applied for effective treatment, bacterial fish diseases remain a major economic obstacle to aquaculture globally. The emergence of multidrug-resistant bacterial pathogens increases the need for effective vaccination programs (
Numerous vaccination trials in salmonids exist, but with contradictory outcomes. The first trials of a T. maritimum vaccine for Atlantic salmon farmed in Australia resulted in little or no protection (
To date, no commercial vaccine against tenacibaculosis in salmonids is available, and
10 Conclusion and knowledge gaps
Tenacibaculosis has risen over the past five years to become one of the most devastating bacterial infections impacting various species of farmed fish and geographical regions. The abrupt re-emergence of disease caused by T. maritimum is in addition to the appearance of new Tenacibaculum species, currently placing the global salmonid aquaculture industry at risk. Considering the broader availability of scientific studies on T. maritimum in the last 15 years, we conducted an extensive review on the status of and advancements on this bacterium since 2006. In summary, the taxonomic status of this bacterium is clear, consensus exists regarding intra-specific diversity, and specific, sensitive diagnostic tools are available (i.e., PCR, molecular probes in PCR-ELISA, RT-PCR-EHA, and MALDI-TOF assays, etc.) that are applicable to pure cultures as well as in early detection through infectious signs occurring in farmed fish. Advancements in genome sequencing have paved the way for developing methods invaluable to the genetic (i.e., MLSA) and serotype (i.e., mPCR) tracking of T. maritimum. Both tools could be useful in creating new species-specific vaccines. Other significant advancements include those related to disease replication under laboratory conditions, specifically through the immersion of fish with the pathogen, thus simulating natural conditions. This tool is indispensable in the search for new products for the treatment (e.g., plant-based compounds) and prevention (e.g., vaccines) of tenacibaculosis. Unfortunately, understanding remains lacking regarding the reservoirs for this bacterium and for the risk factors that influence bacterial appearance. Particularly unclear is the influence of environmental factors (e.g., seawater temperature), an important point considering the context of globally increased temperatures due to climate change. The genome has provided information on the existing mechanisms of pathogenicity in T. maritimum, but physiological studies demonstrating the participation of proteins, and not just the presence of the gene, are deficient. Research has also advanced knowledge of the fish response to T. maritimum, but much remains to be explored. This situation is likely the driver behind antibiotics remaining the most used measure to control T. maritimum. As such, there is an urgent need to establish best-practice sanitary measures, to develop new vaccines and autovaccines, and to search for other control measures besides antibiotics, which potentially include herbal-based medications, phages, or probiotics. Lastly, more research is needed to determine why T. maritimum and other Tenacibaculum species are generally considered opportunistic pathogens. This point takes on particular relevance when considering that some Tenacibaculum isolates possess a larger virulence arsenal than other isolates, as specifically due to the diversity within this bacterial genus. Consequently, we must be open to understanding that fish are farmed intensively, and bacterial infections are not restricted and specific to a single microorganism. Rather, coinfections occur, whether with different bacteria or, in many cases, with the same bacterial species but of different genotypes/serotypes. The presence of T. maritimum or other Tenacibaculum species in the aquatic environment can therefore be a factor in the health of farmed fish, regardless of the pathogen being primary, secondary, or, simply, a coexisting microorganism. Future research should focus on resolving the pending questions raised by our review.
Statements
Author contributions
MM, AA, HH, ES, AF and RA-H participated in writing and editing of the manuscript. BA, SA and RA-H constructed the contents of the figures and tables. CR and RA-H participated in and supervised the thorough review of the manuscript. All authors contributed to the article and approved the submitted version.
Funding
MM was supported through a Senior Postdoctoral Fellow Grant awarded by the graduate school of Chulalongkorn University, Thailand. This conducted research was further supported by the Thailand Science Research and Innovation (TSRI) Fund year 2021, Chulalongkorn University_FRB640001_01_31_6. RA-H gratefully acknowledges financial support received through the FONDECYT 1190283 and FONDAP INCAR Grant n°15110027 and 1522A0004 from Agencia Nacional de Investigación y Desarrollo (ANID) from the Chilean Government.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisherās note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Footnotes
1.^https://www.condalab.com/medios-de-cultivo-deshidratados/1050-5471-caldo-fmm.html#/2-formato-500_g
2.^https://www.hipra.com/wcm/connect/hipra/7c54199f-880a-43bc-a46e-4e981deaad2f/ICTHIOVAC-TM-ETI-701222-01.4.pdf?MOD=AJPERES&CACHEID=ROOTWORKSPACE.Z18_L26A0J40OGJR60QGTTTS0N3067-7c54199f-880a-43bc-a46e-4e981deaad2f-mSMeSVA
References
1
AbdelazizM. A. M. (2016). The host/pathogen interaction during experimental infection of Senegalese sole (Solea senegalensis) by Tenacibaculum maritimum. PhD thesis (Universidade do Porto (Portugal)āProQuest Dissertations Publishing, Portugal) 10643756.
2
AbdelbakyA.SolimanA.AbdelsalamM.AboulezzA. (2021). Genotypic characterization of some dermotropic and systemic bacterial pathogens affecting two commercial red Sea fishes. Egyptian J. Aquat. Biol. Fish.25, 297ā312. doi: 10.21608/ejabf.2021.211886
3
Abd El-GalilM. A.HashemM. (2012a). Epidemiological and bacteriological studies on tenacibaculosis in some red Sea fishes, Egypt. Int. J. Env. Sci. Eng(IJESE)3, 25ā32.
4
Abd El-GalilM. A.HashiemM. (2011). Tenacibaculosis in Picasso tigger fish (Rhinecanthus assasi) and black damsel fish (Neoglyphieodon meles) of red sea at hurghada, Egypt. Life Sci. J. Acta Zhengzhou Univ. Overseas Edition8, 1166ā1171.
5
Abd El-GalilM. A.HashiemM. (2012b). Experimental infection of tenacibaculosis and a trial for treatment by plant extract carvacrol in surge wrasses fish (Thalassoma purpureum). Life Sci. J. Acta Zhengzhou Univ. Overseas Edition9, 442ā447.
6
Abdel-LatifH. M. (2013). Assessment of potential pathogenicity of emergent marine bacterium, Tenacibaculum maritimum to thin lipped grey mullet (Mugil capito) farmed in Egypt. Group1, 10.
7
AbramQ. H.DixonB.KatzenbackB. A. (2017). Impacts of low temperature on the teleost immune system. Biology6, 39. doi: 10.3390/biology6040039
8
AkinbowaleO. L.PengH.BartonM. (2006). Antimicrobial resistance in bacteria isolated from aquaculture sources in Australia. J. Appl. Microbiol.100, 1103ā1113. doi: 10.1111/j.1365-2672.2006.02812.x
9
ApablazaP.FrischK.BrevikĆ. J.SmĆ„geS. B. (2017). Primary isolation and characterization of Tenacibaculum maritimum from Chilean Atlantic salmon mortalities associated with a Pseudochattonella spp. algal bloom. J. Aquat. Anim. Health29, 143ā149. doi: 10.1080/08997659.2017.1339643
10
AvendaƱo-HerreraR.IrgangR.MagariƱosB.RomaldeJ. L.ToranzoA. E. (2006b). Use of microcosms to determine the survival of the fish pathogen Tenacibaculum maritimum in seawater. Environ. Microbiol.8, 921ā928. doi: 10.1111/j.1462-2920.2005.00981.x
11
AvendaƱo-HerreraR.IrgangR.NúñezS.RomaldeJ. L.ToranzoA. E. (2005c). Recommendation of an appropriate medium for in vitro drug susceptibility testing of the fish pathogen Tenacibaculum maritimum. Antimicrob. Agents Chemother.49 (1), 82ā87. doi: 10.1128/AAC.49.1.82-87.2005
12
AvendaƱo-HerreraR.IrgangR.SandovalC.Moreno-LiraP. (2016). Isolation, characterization and virulence potential of Tenacibaculum dicentrarchi in salmonid cultures in Chile. Transbound. Emerg. Dis.63, 121ā126. doi:Ā 10.1111/tbed.12464
13
AvendaƱo-HerreraR.MagariƱosB.IrgangR.ToranzoA. E. (2006d). Use of hydrogen peroxide against the fish pathogen Tenacibaculum maritimum and its effect on infected turbot (Scophthalmus maximus). Aquaculture257, 104ā110. doi:Ā 10.1016/j.aquaculture.2006.02.043
14
AvendaƱo-HerreraR.MagariƱosB.López-RomaldeS.RomaldeJ. L.ToranzoA. E. (2004a). Phenotypic characterization and description of two major O-serotypes in Tenacibaculum maritimum strains from marine fishes. Dis. Aquat. Organisms58, 1ā8. doi:Ā 10.3354/dao058001
15
AvendaƱo-HerreraR.MagariƱosB.MoriƱigoM. A.RomaldeJ. L.ToranzoA. E. (2005a). A novel O-serotype in Tenacibaculum maritimum strains isolated from cultured sole (Solea senegalensis). Bull. Eur. Assoc. Fish Pathologists25, 70ā74.
16
AvendaƱo-HerreraR.MagariƱosB.ToranzoA. E.BeazR.RomaldeJ. L. (2004d). Species-specific polymerase chain reaction primer sets for the diagnosis of Tenacibaculum maritimum infection. Dis. Aquat. Organisms62, 75ā83. doi:Ā 10.3354/dao062075
17
AvendaƱo-HerreraR.MancillaM.MirandaC. D. (2023). Use of antimicrobials in Chilean salmon farming: Facts, myths and perspectives. Rev. Aquacult.15, 89ā111. doi:Ā 10.1111/raq.12702
18
AvendaƱo-HerreraR.NúñezS.BarjaJ. L.ToranzoA. E. (2008). Evolution of drug resistance and minimum inhibitory concentration to enrofloxacin in Tenacibaculum maritimum strains isolated in fish farms. Aquacult. Int.16, 1ā11. doi:Ā 10.1007/s10499-007-9117-y
19
AvendaƱo-HerreraR.NúñezS.MagariƱosB.ToranzoA. (2004c). A non-destructive method for rapid detection of Tenacibaculum maritimum in farmed fish using nested PCR amplification. Bull. Eur. Assoc. Fish Pathologists24, 280ā286.
20
Avendaño-HerreraR.OlsenA. B.Saldarriaga-CordobaM.ColquhounD. J. (2022b). Isolation, identification, virulence potential and genomic features of Tenacibaculum piscium isolates recovered from Chilean salmonids. Transbound. Emerg. Dis. doi: 10.1111/tbed.14606
21
AvendaƱo-HerreraR.RodrĆguezJ.MagariƱosB.RomaldeJ.ToranzoA. (2004b). Intraspecific diversity of the marine fish pathogen Tenacibaculum maritimum as determined by randomly amplified polymorphic DNA-PCR. J. Appl. Microbiol.96, 871ā877. doi:Ā 10.1111/j.1365-2672.2004.02217.x
22
Avendaño-HerreraR.Saldarriaga-CórdobaM.IrgangR. (2022a). Draft genome sequence of Tenacibaculum ovolyticum to-7Br, recovered from a farmed Atlantic salmon (Salmo salar). Microbiol. Resource Announcements11 (7), e0025422. doi: 10.1128/mra.00254-22
23
AvendaƱo-HerreraR.ToranzoA. E.MagariƱosB. (2006a). Tenacibaculosis infection in marine fish caused by Tenacibaculum maritimum: A review. Dis. Aquat. Organisms71, 255ā266. doi:Ā 10.3354/dao071255
24
AvendaƱo-HerreraR.ToranzoA.MagariƱosB. (2006c). A challenge model for Tenacibaculum maritimum infection in turbot, Scophthalmus maximus (L.). J. Fish Dis.29, 371ā374. doi:Ā 10.1111/j.1365-2761.2006.00712.x
25
AvendaƱo-HerreraR.ToranzoA. E.RomaldeJ. L.LemosM. L.MagarinosB. (2005b). Iron uptake mechanisms in the fish pathogen Tenacibaculum maritimum. Appl. Environ. Microbiol.71, 6947ā6953. doi: 10.1128/AEM.71.11.6947-6953.2005
26
BaderJ. A.ShottsJr. E. B. (1998). Identification of Flavobacterium and flexibacter species by species-specific polymerase chain reaction primers to the 16S ribosomal RNA gene. J. Aquat. Anim. Health10, 311ā319. doi:Ā 10.1577/1548-8667(1998)010<0311:IOFAFS>2.0.CO;2
27
BarkerD. E.BradenL. M.CoombsM. P.BoyceB. (2009). Preliminary studies on the isolation of bacteria from sea lice, Lepeophtheirus salmonis, infecting farmed salmon in British Columbia, Canada. Parasitol. Res.105, 1173ā1177. doi: 10.1007/s00436-009-1523-9
28
BaxaD. V.KawaiK.KusudaR. (1988). In vitro and in vivo activities of Flexibacter maritimus toxins. Bull. Mar. Sci. Fish. Kochi Univ.10, 1ā8.
29
BernardetJ.-F. (1998). Cytophaga, Flavobacterium, flexibacter and Chryseobacterium infections in cultured marine fish. Fish Pathol.33, 229ā238. doi: 10.3147/jsfp.33.229
30
BernardetJ.-F.KerouaultB.MichelC. (1994). Comparative study on Flexibacter maritimus strains isolated from farmed sea bass (Dicentrarchus labrax) in France. Fish Pathol.29, 105ā111. doi: 10.3147/jsfp.29.105
31
BridelS.BourgeonF.MarieA.SaulnierD. (2020). Genetic diversity and population structure of Tenacibaculum maritimum, a serious bacterial pathogen of marine fish: From genome comparisons to high throughput MALDI-TOF typing. Vet. Res.51, 1ā17. doi: 10.1186/s13567-020-00782-0
32
BridelS.OlsenA.-B.NilsenH.BernardetJ.-F.AchazG.AvendaƱo-HerreraR.et al. (2018). Comparative genomics of Tenacibaculum dicentrarchi and āTenacibaculum finnmarkenseā highlights intricate evolution of fish-pathogenic species. Genome Biol. Evol.10, 452ā457. doi: 10.1093/gbe/evy020
33
BrockT. D.MadiganM. T.MartinkoJ. M.ParkerJ. (2003). Brock Biology of Microorganisms. Upper Saddle River (NJ: Prentice-Hall).
34
BrosnahanC. L.MundayJ. S.HaH. J.PreeceM.JonesJ. B. (2019). New Zealand rickettsia-like organism (NZ-RLO) and Tenacibaculum maritimum: Distribution and phylogeny in farmed Chinook salmon (Oncorhynchus tshawytscha). J. Fish Dis.42, 85ā95. doi: 10.1111/jfd.12909
35
BurchardR. P.RittschofD.BonaventuraJ. (1990). Adhesion and motility of gliding bacteria on substrata with different surface free energies. Appl. Environ. Microbiol.56, 2529ā2534. doi: 10.1128/aem.56.8.2529-2534.1990
36
CarsonJ.SchmidtkeL.LewisT.ValentineP. (1994). Development of a vaccine against disease caused by Flexibacter maritimus: Results of efficacy testing of three types of vaccine. In ValentineP. (Ed.), Barriers and Break-throughs (Hobart, TAS: Research and Development Review Seminar), p. 149ā158.
37
CarsonJ.SchmidtkeL.MccosP. (1993). A salmonid vaccine against Flexibacter maritimus-dream or reality In ValentineP. (Ed.), Seeking and solving: Papers from the Saltas 1993 (Hobart, TAS: Research and Development Review Seminar), p. 113ā120.
38
CasadevallA.PirofskiL.-a. (1999). Host-pathogen interactions: Redefining the basic concepts of virulence and pathogenicity. Infect. Immun.67, 3703ā3713. doi: 10.1128/IAI.67.8.3703-3713.1999
39
CasadevallA.PirofskiL. A. (2001). Host-pathogen interactions: The attributes of virulence. J. Infect. Dis.184, 337ā344. doi: 10.1086/322044
40
CepedaC.GarcĆa-MĆ”rquezS.SantosY. (2003). Detection of Flexibacter maritimus in fish tissue using nested PCR amplification. J. Fish Dis.26, 65ā70. doi: 10.1046/j.1365-2761.2003.00431.x
41
CepedaC.SantosY. (2002). First isolation of Flexibacter maritimus from farmed Senegalese sole (Solea senegalensis, kaup) in Spain. Bull. European Assoc. Fish Pathologists22, 388ā392.
42
ChenM.Henry-FordD.GroffJ. (1995). Isolation and characterization of Flexibacter maritimus from marine fishes of California. J. Aquat. Anim. Health7, 318ā326. doi: 10.1577/1548-8667(1995)007<0318:IACOMF>2.3.CO;2
43
CimicaV.GalarzaJ. M. (2017). Adjuvant formulations for virus-like particle (VLP) based vaccines. Clin. Immunol.183, 99ā108. doi: 10.1016/j.clim.2017.08.004
44
ClarkS. E.JudeB. A.DannerG. R.FeketeF. A. (2009). Identification of a multidrug efflux pump in Flavobacterium johnsoniae. Vet. Res.40, 1ā10. doi:Ā 10.1051/vetres/2009038
45
CunninghamC. O. (2002). Molecular diagnosis of fish and shellfish diseases: Present status and potential use in disease control. Aquaculture206, 19ā55. doi: 10.1016/S0044-8486(01)00864-X
46
DownesJ.YatabeT.Marcos-LopezM.RodgerH. (2018). Investigation of co-infections with pathogens associated with gill disease in Atlantic salmon during an amoebic gill disease outbreak. J. Fish Dis.41, 1217ā1227. doi: 10.1111/jfd.12814
47
Elanco. (2018). Technical Report: An Overview of Emerging Diseases in the Salmonid Farming Industry. Elanco Canada Ltd., Canada. Available online: https://www.vetinst.no/rapporter-og-publikasjoner/rapporter/2019/an-overview-of-emergingdiseases-in-the-salmonid-farming-industry-technical-report/_/attachment/download/879fcbae-cc63-4a88-9391-fff0c18580f9:d79c3cf13885c938419d77c9cca12e5e1ab2b4d6/Emerging%20diseases%20techinical%20report%20-%20january%202019.pdf.
48
EscribanoM.Ramos-PintoL.FernĆ”ndez-BooS.AfonsoA.CostasB.GuardiolaF. (2020). Mucosal immune responses in Senegalese sole (Solea senegalensis) juveniles after Tenacibaculum maritimum challenge: A comparative study between ocular and blind sides. Fish Shellfish Immunol.104, 92ā100. doi: 10.1016/j.fsi.2020.05.080
49
EstensoroI.Jung-SchroersV.Ćlvarez-PelliteroP.SteinhagenD.SitjĆ -BobadillaA. (2013). Effects of Enteromyxum leei (Myxozoa) infection on gilthead sea bream (Sparus aurata)(Teleostei) intestinal mucus: Glycoprotein profile and bacterial adhesion. Parasitol. Res.112, 567ā576. doi: 10.1007/s00436-012-3168-3
50
FaĆldeL. D.LosadaA. P.BermĆŗdezR.SantosY.QuirogaM. I. (2013). Tenacibaculum maritimum infection: Pathology and immunohistochemistry in experimentally challenged turbot (Psetta maxima l.). Microb. Pathogen.65, 82ā88. doi: 10.1016/j.micpath.2013.09.003
51
FAO (2020). State of world fisheries and aquaculture 2020 (Russian edition): Sustainability in action (Rome, Italy: Food & Agriculture Org). doi:Ā 10.4060/ca9229en
52
FergusonH. W.ChristianM. D.HayS.NicolsonJ.SutherlandD.CrumlishM. (2010). Jellyfish as vectors of bacterial disease for farmed salmon (Salmo salar). J. Vet. Diagn. Invest.22, 376ā382. doi: 10.1177/104063871002200305
53
FernĆ”ndez-ĆlvarezC.GonzĆ”lezS. F.SantosY. (2019). Quantitative PCR coupled with melting curve analysis for rapid detection and quantification of Tenacibaculum maritimum in fish and environmental samples. Aquaculture498, 289ā296. doi: 10.1016/j.aquaculture.2018.08.039
54
FernĆ”ndez-ĆlvarezC.SantosY. (2018). Identification and typing of fish pathogenic species of the genus Tenacibaculum. Appl. Microbiol. Biotechnol.102, 9973ā9989. doi: 10.1007/s00253-018-9370-1
55
FernĆ”ndez-ĆlvarezC.Torres-CorralY.Saltos-RoseroN.SantosY. (2017). MALDI-TOF mass spectrometry for rapid differentiation of Tenacibaculum species pathogenic for fish. Appl. Microbiol. Biotechnol.101, 5377ā5390. doi: 10.1007/s00253-017-8324-3
56
FlorioD.GridelliS.FioravantiM. L.ZanoniR. G. (2016). First isolation of Tenacibaculum maritimum in a captive sand tiger shark (Carcharias taurus). J. Zoo Wildlife Med.47, 351ā353. doi: 10.1638/2015-0064.1
57
FrietzeK. M.PeabodyD. S.ChackerianB. (2016). Engineering virus-like particles as vaccine platforms. Curr. Opin. Virol.18, 44ā49. doi: 10.1016/j.coviro.2016.03.001
58
FringuelliE.SavageP.GordonA.BaxterE.RodgerH.GrahamD. (2012). Development of a quantitative real-time PCR for the detection of Tenacibaculum maritimum and its application to field samples. J. Fish Dis.35, 579ā590. doi: 10.1111/j.1365-2761.2012.01377.x
59
FrischK.SmĆ„geS. B.BrevikĆ. J.DuesundH.NylundA. (2018a). Genotyping of Tenacibaculum maritimum isolates from farmed Atlantic salmon in Western Canada. J. Fish Dis.41, 131ā137. doi: 10.1111/jfd.12687
60
FrischK.SmĆ„geS. B.JohansenR.DuesundH.BrevikĆ. J.NylundA. (2018b). Pathology of experimentally induced mouthrot caused by Tenacibaculum maritimum in Atlantic salmon smolts. PloS One13, e0206951. doi: 10.1371/journal.pone.0206951
61
FrischK.SmĆ„geS. B.VallestadC.DuesundH. (2018c). Experimental induction of mouthrot in Atlantic salmon smolts using Tenacibaculum maritimum from Western Canada. J. Fish Dis.41, 1247ā1258. doi: 10.1111/jfd.12818
62
FujitaM. J.KimuraN.YokoseH.OtsukaM. (2012). Heterologous production of bisucaberin using a biosynthetic gene cluster cloned from a deep sea metagenome. Mol. Biosyst.8, 482ā485. doi: 10.1039/C1MB05431G
63
GorskiL. (2021). Serotype Assignment by Sero-agglutination, ELISA, and PCR. In: FoxE. M.BierneH.StesslB. (eds) Listeria Monocytogenes. Methods in Molecular Biology, vol 2220. Humana, New York, NY. doi:Ā 10.1007/978-1-0716-0982-8_5
64
GourziotiE.KolygasM.AthanassopoulouF.BabiliV. (2016). Tenacibaculosis in aquaculture farmed marine fish. J. Hellenic Vet. Med. Soc.67, 21ā32. doi: 10.12681/jhvms.15620
65
GuardiolaF.MabrokM.MachadoM.AzeredoR.AfonsoA.EstebanM.et al. (2019). Mucosal and systemic immune responses in Senegalese sole (Solea senegalensis kaup) bath challenged with Tenacibaculum maritimum: A time-course study. Fish Shellfish Immunol.87, 744ā754. doi: 10.1016/j.fsi.2019.02.015
66
HabibC.HouelA.LunazziA.BernardetJ.-F. (2014). Multilocus sequence analysis of the marine bacterial genus tenacibaculum suggests parallel evolution of fish pathogenicity and endemic colonization of aquaculture systems. Appl. Environ. Microbiol.80, 5503ā5514. doi: 10.1128/AEM.01177-14
67
HansenG. H.BerghĆ.MichaelsenJ.KnappskogD. (1992). Flexibacter ovolyticus sp. nov., a pathogen of eggs and larvae of Atlantic halibut, Hippoglossus hippoglossus l. Int. J. System. Evol. Microbiol.42, 451ā458. doi: 10.1099/00207713-42-3-451
68
HaridyM.HasheimM.Abd El-GalilM.SakaiH.YanaiT. (2015). Pathological findings of Tenacibaculum maritimus infection in black damselfish, Neoglyphieodon melas and Picasso triggerfish, Rhinecanthus assasi in red Sea, Egypt. Vet. Sci. Technol.6, 214. doi:Ā 10.4172/2157-7579.1000214
69
HassanM. A.Abd AllahN. A.MabrokM. (2021). Inevitable impact of some environmental stressors on the frequency and pathogenicity of marine vibriosis. Aquaculture536, 736447. doi: 10.1016/j.aquaculture.2021.736447
70
HenrĆquez-NúñezH.EvrardO.KronvallG.AvendaƱo-HerreraR. (2012). Antimicrobial susceptibility and plasmid profiles of Flavobacterium psychrophilum strains isolated in Chile. Aquaculture354, 38ā44. doi: 10.1016/j.aquaculture.2012.04.034
71
HigginsR. (2000). Bacteria and fungi of marine mammals: A review. Can. Vet. J.41, 105.
72
ImbertyA.VarrotA. (2008). Microbial recognition of human cell surface glycoconjugates. Curr. Opin. Struct. Biol.18, 567ā576. doi: 10.1016/j.sbi.2008.08.001
73
IrgangR.AvendaƱo-HerreraR. (2022). Evaluation of the in vitro susceptibility of Tenacibaculum dicentrarchi to tiamulin using minimum inhibitory concentration tests. J. Fish Dis.45 (6), 795ā799. doi: 10.1111/jfd.13604
74
IrgangR.MancillaM.AvendaƱo-HerreraR. (2021). Florfenicol and oxytetracycline susceptibility patterns in Chilean isolates of Tenacibaculum dicentrarchi: An emerging pathogen for farmed salmonids. J. Fish Dis.44, 1043ā1046. doi: 10.1111/jfd.13380
75
ItoM.OkinoN.TaniM. (2014). New insight into the structure, reaction mechanism, and biological functions of neutral ceramidase. Biochim. Biophys. Acta (BBA) Mol. Cell Biol. Lipids1841, 682ā691. doi: 10.1016/j.bbalip.2013.09.008
76
IzumiS.AranishiF. (2004). Relationship between gyrA mutations and quinolone resistance in Flavobacterium psychrophilum isolates. Appl. Environ. Microbiol.70, 3968. doi: 10.1128/AEM.70.7.3968-3972.2004
77
JangY.-H.JeongJ.-B.YeoI.-K.KimK.-Y.HarikrishnanR.HeoM.-S. (2009). Biological characterization of Tenacibaculum maritimum isolated from cultured olive flounder in Korea and sensitivity against native plant extracts. J. Fish Pathol.22, 53ā65.
78
KirjusinaM.BriedeI.Bondad-ReantasoM. (2007). Extension manual on some important viruses, parasites and bacteria of aquatic animals in Latvia, NDC/LZRA/FAO. Riga. p. 69
79
KlakeggĆ.AbaynehT.FauskeA. K.FülberthM.SĆørumH. (2019). An outbreak of acute disease and mortality in Atlantic salmon (Salmo salar) postāsmolts in Norway caused by Tenacibaculum dicentrarchi. J. Fish Dis.42, 789ā807. doi: 10.1111/jfd.12982
80
KleinD. (2002). Quantification using real-time PCR technology: Applications and limitations. Trends Mol. Med.8, 257ā260. doi: 10.1016/S1471-4914(02)02355-9
81
KolygasM.GourziotiE.VatsosI.AthanassopoulouF. (2012). Identification of Tenacibaculum maritimum strains from marine farmed fish in Greece. Vet. Rec.170, 623. doi: 10.1136/vr.100778
82
KumarG.EngleC. R. (2016). Technological advances that led to growth of shrimp, salmon, and tilapia farming. Rev. Fish. Sci. Aquacult.24, 136ā152. doi: 10.1080/23308249.2015.1112357
83
LeeM.JunS.-Y.YoonB.-Y.SongS.LeeK.HaN.-C. (2012). Membrane fusion proteins of type I secretion system and tripartite efflux pumps share a binding motif for TolC in gram-negative bacteria. PloS One7, e40460. doi: 10.1371/journal.pone.0040460
84
LeungT. L.BatesA. E. (2013). More rapid and severe disease outbreaks for aquaculture at the tropics: Implications for food security. J. Appl. Ecol.50, 215ā222. doi: 10.1111/1365-2644.12017
85
LevipanH. A.Tapia-CammasD.MolinaV.IrgangR.ToranzoA. E.MagariƱosB.et al. (2019). Biofilm development and cell viability: An undervalued mechanism in the persistence of the fish pathogen Tenacibaculum maritimum. Aquaculture511, 734267. doi: 10.1016/j.aquaculture.2019.734267
86
LiekeT.MeineltT.HoseinifarS. H.PanB.StrausD. L.SteinbergC. E. (2020). Sustainable aquaculture requires environmental-friendly treatment strategies for fish diseases. Rev. Aquacult.12, 943ā965. doi: 10.1111/raq.12365
87
LinT.LinL.ZhangF. (2014). Review on molecular typing methods of pathogens. Open J. Med. Microbiol.4, 147. doi: 10.4236/ojmm.2014.43017
88
LiD.OkuN.HasadaA.ShimizuM.IgarashiY. (2018). Two new 2-alkylquinolones, inhibitory to the fish skin ulcer pathogen Tenacibaculum maritimum, produced by a rhizobacterium of the genus burkholderia sp. beilstein. J. Organic Chem.14, 1446ā1451. doi: 10.3762/bjoc.14.122
89
LlewellynM.LeadbeaterS.GarciaC.SylvainF.-E. (2017). Parasitism perturbs the mucosal microbiome of Atlantic salmon. Sci. Rep.7, 1ā10. doi: 10.1038/srep43465
90
LopezP.BridelS.SaulnierD.DavidR.MagariƱosB.TorresB. S.et al. (2022a). Genomic characterization of Tenacibaculum maritimum O-antigen gene cluster and development of a multiplex PCR-based serotyping scheme. Transbound. Emerg. Dis.69 (5), e2876āe2888. doi:Ā 10.1111/tbed.14637
91
LópezJ.NúñezS.MagariƱosB.CastroN.NavasJ.de la HerranR.et al. (2009). First isolation of Tenacibaculum maritimum from wedge sole, Dicologoglossa cuneata (Moreau). J. Fish Dis.32, 603ā610. doi: 10.1111/j.1365-2761.2009.01029.x
92
LópezJ.PiƱeiro-VidalM.GarcĆa-LamasN.de la HerranR.NavasJ.Hachero-CruzadoI.et al. (2010). First isolation of Tenacibaculum soleae from diseased cultured wedge sole, Dicologoglossa cuneata (Moreau), and brill, Scophthalmus rhombus (L.). J. Fish Dis.33, 273ā278. doi: 10.1111/j.1365-2761.2009.01105.x
93
LopezP.SaulnierD.Swarup-GaucherS.DavidR. (2022b). First isolation of virulent Tenacibaculum maritimum isolates from diseased orbicular batfish (Platax orbicularis) farmed in Tahiti island. Pathogens11, 131. doi: 10.3390/pathogens11020131
94
MabrokM.ElayarajaS.ChokmangmeepisarnP.JaroenramW. (2021). Rapid visualization in the specific detection of Flavobacterium columnare, a causative agent of freshwater columnaris using a novel recombinase polymerase amplification (RPA) combined with lateral flow dipstick (LFD) assay. Aquaculture531, 735780. doi: 10.1016/j.aquaculture.2020.735780
95
MabrokM.MachadoM.SerraC.AfonsoA.ValenteL.CostasB. (2016). Tenacibaculosis induction in the Senegalese sole (Solea senegalensis) and studies of Tenacibaculum maritimum survival against host mucus and plasma. J. Fish Dis.39, 1445ā1455. doi: 10.1111/jfd.12483
96
MagariƱosB.PazosF.SantosY.RomaldeJ. L.ToranzoA. E. (1995). Response of Pasteurella piscicida and Flexibacter maritimus to skin mucus of marine fish. Dis. Aquat. Organisms21, 103ā108. doi: 10.3354/dao021103
97
MagiG.Avendano-HerreraR.MagarinosB.ToranzoA.RomaldeJ. (2007). First reports of flexibacteriosis in farmed tub gurnard (Chelidonichthys lucernus l.) and wild turbot (Scophthalmus maximus) in Italy. Bull. European Assoc. Fish Pathologists27, 177.
98
MarcoglieseD. J. (2008). The impact of climate change on the parasites and infectious diseases of aquatic animals. Rev. Scientifique Technique27, 467ā484. doi: 10.20506/rst.27.2.1820
99
MasumuraK.WakabayashiH. (1977). An outbreak of gliding bacterial disease in hatchery-born red seabream (Pagrus major) and gilthead (Acanthopagrus schlegeli) fry in Hiroshima. Fish Pathol.12, 171ā177. doi: 10.3147/jsfp.12.171
100
MelbaB.NihadF.BrettM.DavidH. (2021). A 12-point checklist for surveillance of diseases of aquatic organisms: A novel approach to assist multidisciplinary teams in developing countries. Rev. Aquacult.13, 1469ā1487. doi:Ā 10.1111/raq.12530
101
MichelC.Matte-TailliezO.KerouaultB.BernardetJ. F. (2005). Resistance pattern and assessment of phenicol agents' minimum inhibitory concentration in multiple drug resistant Chryseobacterium isolates from fish and aquatic habitats. J. Appl. Microbiol.99, 323ā332. doi: 10.1111/j.1365-2672.2005.02592.x
102
MiyakeS.SohM.AzmanM. N.NgohS. Y.OrbĆ”nL.SeedorfH. (2020). Insights into the microbiome of farmed Asian sea bass (Lates calcarifer) with symptoms of tenacibaculosis and description of Tenacibaculum singaporense sp. nov. Antonie van Leeuwenhoek113, 737ā752. doi: 10.1007/s10482-020-01391-9
103
MolenaarE. J.CaddellR. (2019). āInternational fisheries law: Achievements, limitations and challenges,ā in Strengthening international fisheries law in an era of changing oceans hart(Oxford, UK).
104
MoustafaM.EissaA.LailaA.GaafarA.AbumouradI.ElgendyM. (2014). Mass mortalities in mari-cultured European sea bass (Dicentrarchus labrax) at northern Egypt. Res. J. Pharm. Biol. Chem. Sci.5, 95ā109.
105
MoustafaM.EissaA.LailaA.GaafarA.AbumouradI.ElgendyM. (2015). Investigations into the potential causes of mass kills in mari-cultured gilthead sea bream (Sparus aurata) at northern Egypt. Res. J. Pharm. Biol. Chem. Sci.6, 466ā477.
106
NekoueiO.VanderstichelR.MingT.KaukinenK. H. (2018). Detection and assessment of the distribution of infectious agents in juvenile Fraser river sockeye salmon, Canada, in 2012 and 2013. Front. Microbiol.9, 3221. doi: 10.3389/fmicb.2018.03221
107
NowlanJ. P.BritneyS. R.LumsdenJ. S.RussellS. (2021). Application of quantitative-PCR to monitor netpen sites in British Columbia (Canada) for Tenacibaculum species. Pathogens10, 414. doi: 10.3390/pathogens10040414
108
NowlanJ. P.LumsdenJ. S.RussellS. (2020). Advancements in characterizing Tenacibaculum infections in Canada. Pathogens9 (12), 1029. doi: 10.3390/pathogens9121029
109
OdaM.TakahashiM.MatsunoT.UooK.NagahamaM.SakuraiJ. (2010). Hemolysis induced by Bacillus cereus sphingomyelinase. Biochim. Biophys. Acta (BBA) Biomembr.1798, 1073ā1080. doi: 10.1016/j.bbamem.2010.03.004
110
OfekI.DoyleR. J. (1994). Principles of bacterial adhesion. In: Bacterial Adhesion to Cells and Tissues. (Boston, MA: Springer). doi:Ā 10.1007/978-1-4684-6435-1_1
111
OfekI.DoyleR. J. (2012). Bacterial adhesion to cells and tissues. In: OfekI.DoyleR. J., editors. (New York: Chapman & Hall)
112
OlsenA. B.GullaS.SteinumT.ColquhounD. J.NilsenH. K.DuchaudE. (2017). Multilocus sequence analysis reveals extensive genetic variety within Tenacibaculum spp. associated with ulcers in seaāfarmed fish in Norway. Vet. Microbiol.205, 39ā45. doi: 10.1016/j.vetmic.2017.04.028
113
OlsenA. B.NilsenH.SandlundN.MikkelsenH.SĆørumH.ColquhounD. (2011). Tenacibaculum sp. associated with winter ulcers in sea-reared Atlantic salmon Salmo salar. Dis. Aquat. Organisms94, 189ā199. doi: 10.3354/dao02324
114
OlsenA. B.SpilsbergB.NilsenH. K.LagesenK. (2020). Tenacibaculum piscium sp. nov., isolated from skin ulcers of sea-farmed fish, and description of Tenacibaculum finnmarkense sp. nov. with subdivision into genomovars finnmarkense and ulcerans. Int. J. System. Evol. Microbiol.70, 6079ā6090. doi: 10.1099/ijsem.0.004501
115
PasquaM.GrossiM.ZennaroA.FanelliG. (2019). The varied role of efflux pumps of the MFS family in the interplay of bacteria with animal and plant cells. Microorganisms7, 285. doi: 10.3390/microorganisms7090285
116
PazosF. (1997). Flexibacter maritimus: Estudio fenotĆpico, inmunológico y molecular (Spain: Universidade de Santiago de Compostela, Spain).
117
PazosF.SantosY.MaciasA.NúñezS.ToranzoA. (1996). Evaluation of media for the successful culture of Flexibacter maritimus. J. Fish Dis.19, 193ā197. doi: 10.1111/j.1365-2761.1996.tb00701.x
118
PƩrez-PascualD.LunazziA.MagdelenatG.RouyZ. (2017). The complete genome sequence of the fish pathogen Tenacibaculum maritimum provides insights into virulence mechanisms. Front. Microbiol.8, 1542. doi: 10.3389/fmicb.2017.01542
119
PiƱeiro-VidalM.Centeno-SesteloG.RiazaA.SantosY. (2007). Isolation of pathogenic Tenacibaculum maritimum-related organisms from diseased turbot and sole cultured in the Northwest of Spain. Bulletin of the European Association of Fish Pathologists, 27(1), 29ā35.
120
PiƱeiro-VidalM.RiazaA.SantosY. (2008a). Tenacibaculum discolor sp. nov. and Tenacibaculum gallaicum sp. nov., isolated from sole (Solea senegalensis) and turbot (Psetta maxima) culture systems. Int. J. System. System. Evol. Microbiol. Microbiol.58, 21ā25. doi: 10.1099/ijs.0.65397-0
121
PiƱeiro-VidalM.CarballasC. G.Gomez-BarreiroO.RiazaA.SantosY. (2008b). Tenacibaculum soleae sp. nov., isolated from diseased sole (Solea senegalensis kaup). Int. J. System. Evol. Microbiol.58, 881ā885. doi: 10.1099/ijs.0.65539-0
122
PiƱeiro-VidalM.GijónD.ZarzaC.SantosY. (2012). Tenacibaculum dicentrarchi sp. nov., a marine bacterium of the family Flavobacteriaceae isolated from European sea bass. Int. J. System. Evol. Microbiol.62, 425ā429. doi: 10.1099/ijs.0.025122-0
123
PowellM.CarsonJ.van GelderenR. (2004). Experimental induction of gill disease in Atlantic salmon Salmo salar smolts with Tenacibaculum maritimum. Dis. Aquat. Organisms61, 179ā185. doi: 10.3354/dao061179
124
RahmanT.SugaK.KanaiK.SugiharaY. (2014). Biological and serological characterization of a non-gliding strain of Tenacibaculum maritimum isolated from a diseased puffer fish takifugu rubripes. Fish Pathol49, 121ā129. doi: 10.3147/jsfp.49.121
125
RatledgeC.DoverL. G. (2000). Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol.54, 881ā941. doi: 10.1146/annurev.micro.54.1.881
126
ReyadA. M.AttaH. M.MahranH. A. (2013). Antibacterial activity of Nocardiopsis dassonvillei yscl2334 against Tenacibaculum maritimum isolated from diseased fishes in marine aquaculture. Egyptian J. Exp. Biol. (Botany)9, 183ā191.
127
RomaldeJ. L.RaveloC.López-RomaldeS.Avendano-HerreraR.MagariƱosB.ToranzoA. E. (2005). Vaccination strategies to prevent emerging diseases for Spanish aquaculture. Develop. Biologicals121, 85ā95.
128
RomeroM.AvendaƱo-HerreraR.MagariƱosB.CĆ”maraM.OteroA. (2010). Acylhomoserine lactone production and degradation by the fish pathogen Tenacibaculum maritimum, a member of the CytophagaāFlavobacteriumāBacteroides (CFB) group. FEMS Microbiol. Lett.304, 131ā139. doi: 10.1111/j.1574-6968.2009.01889.x
129
SalatiF.CubaddaC.VialeI.KusudaR. (2005). Immune response of sea bass Dicentrarchus labrax to Tenacibaculum maritimum antigens. Fish. Sci.71, 563ā567. doi: 10.1111/j.1444-2906.2005.01000.x
130
SantosY.PazosF.BarjaJ. (1999). Flexibacter maritimus, causal agent of flexibacteriosis in marine fish. In:Ā OlivierGĀ (ed.)Ā ICES Identification Leaflets for Diseases and Parasites of Fish and Shellfish. No. 55, pp.Ā 1ā6. (Copenhagen, Denmark: International Council for the Exploration of the Sea).
131
SantosY.PazosF.BarjaJ. (2019). ICES Tenacibaculum maritimum, causal agent of tenacibaculosis in marine fish.
132
SerraC. R.AlmeidaE. M.GuerreiroI.SantosR. (2019). Selection of carbohydrate-active probiotics from the gut of carnivorous fish fed plant-based diets. Sci. Rep.9, 1ā15. doi: 10.1038/s41598-019-42716-7
133
ShengY.AbreuI. A.CabelliD. E.MaroneyM. J.MillerA. F.TeixeiraM.et al. (2014). Superoxide dismutases and superoxide reductases. Chem. Rev.114, 3854ā3918. doi: 10.1021/cr4005296
134
SilvaM. T. (2012). Classical labeling of bacterial pathogens according to their lifestyle in the host: Inconsistencies and alternatives. Front. Microbiol.3, 71. doi: 10.3389/fmicb.2012.00071
135
SimonO.KlausB. (2008). The marketing and the use of feed additives in the European union with particular regard to zootechnical feed additives. Eur. Food Feed Law Rev.3, 132ā154.
136
SmĆ„geS. B.BrevikĆ. JDuesundH.OttemK. F.WatanabeK.et al. (2016a). Tenacibaculum finnmarkense sp. nov., a fish pathogenic bacterium of the family Flavobacteriaceae isolated from Atlantic salmon. Antonie van Leeuwenhoek109, 273ā285. doi: 10.1007/s10482-015-0630-0
137
SmĆ„geS. B.FrischK.BrevikĆ. JWatanabeK.NylundA. (2016b). First isolation, identification and characterisation of Tenacibaculum maritimum in Norway, isolated from diseased farmed sea lice cleaner fish Cyclopterus lumpus l. Aquaculture464, 178ā184. doi: 10.1016/j.aquaculture.2016.06.030
138
SneeringerS.BowmanM.ClancyM. (2019). The U.S. and EU Animal Pharmaceutical Industries in the Age of Antibiotic Resistance, ERR-264, U.S. Department of Agriculture, Economic Research Service. Available at: https://www.ers.usda.gov/webdocs/publications/93179/err-264.pdf?v=961.
139
SoltaniM.MundayB.BurkeC. (1996). The relative susceptibility of fish to infections by Flexibacter columnaris and Flexibacter maritimus. Aquaculture140, 259ā264. doi: 10.1016/0044-8486(95)01157-9
140
SoniyaM.KuberanT.AnithaS.SankareswariP. (2013). In vitro antibacterial activity of plant extracts against gram positive and gram negative pathogenic bacteria. Int. J. Microbiol. Immunol. Res.2, 1ā5.
141
StaroscikA. M.NelsonD. R. (2008). The influence of salmon surface mucus on the growth of Flavobacterium columnare. J. Fish Dis.31 (1), 59ā69. doi: 10.1111/j.1365-2761.2007.00867.x
142
SubasingheR.SotoD.JiaJ. (2009). Global aquaculture and its role in sustainable development. Rev. Aquacult.1, 2ā9. doi: 10.1111/j.1753-5131.2008.01002.x
143
SuomalainenL. R.TiirolaM.ValtonenE. (2006). Chondroitin AC lyase activity is related to virulence of fish pathogenic Flavobacterium columnare. J. Fish Dis.29, 757ā763. doi: 10.1111/j.1365-2761.2006.00771.x
144
SuzukiM. (2015). Tenacibaculum. In Bergeyās Manual of Systematics of Archea and Bacteria, John Wiley &Ā Sons.Ā Inc.Ā andĀ Bergey ĢsĀ ManualĀ Trust, p. 7.Ā doi:Ā 10.1002/9781118960608.gbm0034
145
SuzukiM.NakagawaY.HarayamaS.YamamotoS. (2001). Phylogenetic analysis and taxonomic study of marine cytophaga-like bacteria: Proposal for Tenacibaculum gen. nov. with Tenacibaculum maritimum comb. nov. and Tenacibaculum ovolyticum comb. nov., and description of Tenacibaculum mesophilum sp. nov. and Tenacibaculum amylolyticum sp. nov. Int. J. System. Evol. Microbiol.51, 1639ā1652. doi: 10.1099/00207713-51-5-1639
146
TesdorpfJ. E.GeersA. U.StrubeM. L.GramL.Bentzon-TiliaM. (2022). Roseobacter group probiotics exhibit differential killing of fish pathogenic Tenacibaculum species. Appl. Environ. Microbiol.88, e02418āe02421. doi: 10.1128/aem.02418-21
147
ToranzoA. E.MagariƱosB.RomaldeJ. L. (2005). A review of the main bacterial fish diseases in mariculture systems. Aquaculture246, 37ā61. doi: 10.1016/j.aquaculture.2005.01.002
148
ToranzoA.RomaldeJ.DopazoC.MagariƱosB.BarjaJ. (2004). Disease trends in the primary marine fish species cultured in Spain: A 20-year study. World Aquacul.35, 35ā38.
149
ToyamaT.Kita-TsukamotoK.WakabayashiH. (1996). Identification of Flexibacter maritimus, Flavobacterium branchiophilum and Cytophaga columnaris by PCR targeted 16S ribosomal DNA. Fish Pathol.31, 25ā31. doi: 10.3147/jsfp.31.25
150
ValdesS.IrgangR.BarrosM. C.IlardiP. (2021). First report and characterization of Tenacibaculum maritimum isolates recovered from rainbow trout (Oncorhynchus mykiss) farmed in Chile. J. Fish Dis. 44, 1481ā1490 doi: 10.1111/jfd.13466
151
van GelderenR.CarsonJ.GudkovsN.NowakB. (2010b). Physical characterisation of Tenacibaculum maritimum for vaccine development. J. Appl. Microbiol.109, 1668ā1676. doi: 10.1111/j.1365-2672.2010.04795.x
152
van GelderenR.CarsonJ.NowakB. (2009a). Experimental vaccination of Atlantic salmon (Salmo salar l.) against marine flexibacteriosis. Aquaculture288, 7ā13. doi: 10.1016/j.aquaculture.2008.11.012
153
van GelderenR.CarsonJ.NowakB. (2009b). Effect of extracellular products of Tenacibaculum maritimum in Atlantic salmon, Salmo salar l. J. Fish Dis.32, 727ā731. doi: 10.1111/j.1365-2761.2009.01032.x
154
van GelderenR.CarsonJ.NowakB. (2010a). Experimentally induced marine flexibacteriosis in Atlantic salmon smolts Salmo salar. i. pathogenicity. Dis. Aquat. Organisms91, 121ā128. doi: 10.3354/dao02219
155
van GelderenR.CarsonJ.NowakB. (2011). Experimentally induced marine flexibacteriosis in Atlantic salmon smolts Salmo salar. II. pathology. Dis. Aquat. Organisms95, 125ā135. doi: 10.3354/dao02329
156
VilarP.FaĆldeL.BermĆŗdezR.ViglianoF. (2012). Morphopathological features of a severe ulcerative disease outbreak associated with Tenacibaculum maritimum in cultivated sole, Solea senegalensis (L.). J. Fish Dis.35, 437ā445. doi: 10.1111/j.1365-2761.2012.01360.x
157
WakabayashiH.HikidaM.MasumuraK. (1986). Flexibacter maritimus sp. nov., a pathogen of marine fishes. Int. J. System. Evol. Microbiol.36, 396ā398. doi: 10.1099/00207713-36-3-396
158
WankaK. M.DamerauT.CostasB.KruegerA.SchulzC.WuertzS. (2018). Isolation and characterization of native probiotics for fish farming. BMC Microbiol.18, 1ā13. doi: 10.1186/s12866-018-1260-2
159
WarsenA. E.KrugM. J.LaFrentzS.StanekD. R.LogeF. J.CallD. R. (2004). Simultaneous discrimination between 15 fish pathogens by using 16S ribosomal DNA PCR and DNA microarrays. Appl. Environ. Microbiol.70, 4216ā4221. doi: 10.1128/AEM.70.7.4216-4221.2004
160
WattsJ. E.SchreierH. J.LanskaL.HaleM. S. (2017). The rising tide of antimicrobial resistance in aquaculture: Sources, sinks and solutions. Mar. Drugs15, 158. doi: 10.3390/md15060158
161
WhitfieldC.WilliamsD. M.KellyS. D. (2020). Lipopolysaccharide o-antigensābacterial glycans made to measure. J. Biol. Chem.295 (31), 10593ā10609. doi: 10.1074/jbc.REV120.009402
162
WilsonT.CarsonJ. (2003). Development of sensitive, high-throughput one-tube RT PCR enzyme hybridisation assay to detect selected bacterial fish pathogens. Dis. Aquat. Organisms54, 127ā134. doi: 10.3354/dao054127
163
WilsonT.CarsonJ.BowmanJ. (2002). Optimisation of one-tube PCR-ELISA to detect femtogram amounts of genomic DNA. J. Microbiol. Methods51, 163ā170. doi: 10.1016/S0167-7012(02)00055-6
164
WilsonT. K.DouglasM.DunnV. (2019). First identification in Tasmania of fish pathogens Tenacibaculum dicentrarchi and T. soleae and multiplex PCR for these organisms and T. maritimum. Dis. Aquat. Organisms136, 219ā226. doi: 10.3354/dao03407
165
YamamotoT.KawaiK.OshimaS.-i. (2010). Evaluation of an experimental immersion infection method with Tenacibaculum maritimum in Japanese flounder Paralichthys olivaceus. Aquacult. Sci.58, 481ā489.
166
YangS.RothmanR. E. (2004). PCR-based diagnostics for infectious diseases: Uses, limitations, and future applications in acute-care settings. Lancet Infect. Dis.4, 337ā348. doi: 10.1016/S1473-3099(04)01044-8
167
YardimciR.TimurG. (2016). Antigenic characterisation of Tenacibaculum maritimum isolates from sea bass (Dicentrarchus labrax, l.) farmed on the Aegean Sea coasts of Turkey. J. Aquac. Res. Dev.7, 2. doi:Ā 10.4172/2155-9646.1000408
Summary
Keywords
Tenacibaculum maritimum, tenacibaculosis, pathogenicity, marine fish, aquaculture
Citation
Mabrok M, Algammal AM, Sivaramasamy E, Hetta HF, Atwah B, Alghamdi S, Fawzy A, AvendaƱo-Herrera R and Rodkhum C (2023) Tenacibaculosis caused by Tenacibaculum maritimum: Updated knowledge of this marine bacterial fish pathogen. Front. Cell. Infect. Microbiol. 12:1068000. doi: 10.3389/fcimb.2022.1068000
Received
12 October 2022
Accepted
28 November 2022
Published
06 January 2023
Volume
12 - 2022
Edited by
Manuel L. Lemos, University of Santiago de Compostela, Spain
Reviewed by
Mark J. McBride, University of WisconsināMilwaukee, United States; David Hunnicutt, St. Norbert College, United States
Updates

Check for updates
Copyright
© 2023 Mabrok, Algammal, Sivaramasamy, Hetta, Atwah, Alghamdi, Fawzy, Avendaño-Herrera and Rodkhum.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Channarong Rodkhum, channarong.r@chula.ac.th; Ruben AvendaƱo-Herrera, reavendano@yahoo.com; ravendano@unab.cl
This article was submitted to Molecular Bacterial Pathogenesis, a section of the journal Frontiers in Cellular and Infection Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.