Abstract
Background:
The COVID-19 pandemic has led to the excessive use of antimicrobials in critically ill patients. Infections caused by Acinetobacter baumannii have increased significantly both regionally and globally during the COVID-19 pandemic, posing dramatic challenges for intensive care unit (ICU) patients. This study aimed to determine the prevalence, antimicrobial resistance patterns, presence of selected antimicrobial resistance genes, and genetic diversity of A. baumannii isolates obtained from COVID-19 cases admitted to the ICU at the University Hospital in Iran.
Materials and methods:
This was a cross-sectional and single-center study comprising patients with A. baumannii infections admitted to the ICU with COVID-19 between April and November 2021. The demographic and clinical data of the patients were collected. Antimicrobial susceptibility testing was conducted based on Clinical Laboratory Standards Institute guidelines. This study used PCR and multiplex PCR to investigate antibiotic resistance genes (ARGs) and global clones (GC), respectively. Genetic diversity was investigated by repetitive element sequence-based PCR (REP-PCR).
Results:
The prevalence of A. baumannii coinfection in COVID-19 cases was 8.1% (43/528). More than 90% (39/43) of A. baumannii isolates were resistant to cefepime, ampicillin-sulbactam, gentamicin, trimethoprim-sulfamethoxazole and amikacin. Furthermore, 44.2% (19/43) of isolates were resistant to colistin. There were 91% (39/43) isolates that were extensively drug-resistant (XDR). The most prevalence carbapenem resistance encoding genes were bla-OXA-23 65.1% (29/43) and blaNDM 41.8% (18/43). The most common aminoglycoside resistance genes were aac(6’)-Ib 65.1% (28/43) and ant(2)-Ia 46.5% (20/43). Isolates from the prominent Global clone GCII comprised 83.7% (36/43) of total isolates. Genetic fingerprinting using REP-PCR revealed that 39 typeable A. baumannii isolates were categorized into 12 distinct genotypes, of which 72% (28/39) of isolates belonged to one genotype.
Conclusion:
The high prevalence of XDR A. baumannii such as carbapenem and colistin-resistant strains, poses a significant concern for the treatment of COVID-19 patients, heightening the risk of therapeutic failure. The data demonstrate the dissemination of a single A. baumannii clone carrying multiple ARGs within our hospital. Regarding the limited therapeutic options, it is crucial to implement effective prevention and containment policies to curb the spread of these strains.
Introduction
Respiratory infections caused by acute coronavirus syndrome 2 (SARS-COV-2) were first reported in December 2019 in Wuhan, China, and subsequently rapidly spread globally (Sharma et al., 2020). According to the World Health Organization (WHO) report dated December 30, 2023, the virus has been identified in more than 773 million individuals across 220 countries and has unfortunately caused the death of more than 7 million people (Organization WH, 2023). The clinical manifestations of coronavirus infection vary from asymptomatic infection to severe viral pneumonia, requiring treatment in an intensive care unit (ICU) or mechanical ventilation (Zeng et al., 2021). Hospitalization of COVID-19 patients, especially in the ICU, creates ideal conditions for acquiring healthcare-associated infections (HAIs) or secondary infections, particularly with multidrug-resistant (MDR) Gram-negative pathogens such as Acinetobacter baumannii (). During the COVID-19 pandemic, there has been a significant increase in the prevalence of A. baumannii infections both regionally and globally (; Mobarak-Qamsari et al., 2023; Petazzoni et al., 2023). This organism exhibits high rates of resistance to multiple antibiotics, including carbapenems, aminoglycosides, fluoroquinolones, and polymyxins, due to both rapidly acquired resistance genes and intrinsic resistance (). In 2017, Carbapenem-resistant A. baumannii (CRAB) was listed at the top of WHO priorities for the development of new antibiotics (Tacconelli et al., 2018). Clonal spread of CRAB has been reported worldwide, with global clones 1 and 2 (GC1 and GC2) frequently associated with the increased resistance of this microorganism (Zarrilli et al., 2012). Infections caused by extensively drug-resistant (XDR) or MDR bacteria lead to higher ICU mortality and morbidity rates, along with increased healthcare costs, while available therapeutic options are limited (). The treatment of patients with COVID-19 co-infected with antibiotic-resistant bacteria circulating frequently in hospitals is extremely challenging. Therefore, in order to combat antibiotic resistance and implement prevention control practices, the detection of antibiotic-resistant bacteria is essential (). The aim of the current study was to evaluate the prevalence, antibiotic resistance profiles and genetic relatedness of A. baumannii isolates obtained from patients with COVID-19 infection admitted to the ICU in a tertiary care hospital in Tehran, Iran.
Methods
Setting and sampling
This was a cross-sectional and single-center study, including patients admitted to Shariati Hospital, a tertiary referral hospital in Tehran, Iran, between April and November 2021. Patients were included in the current study based on the following criteria (Sharma et al., 2020): laboratory-confirmed SARS-CoV-2 infection using an RT–PCR test on a nasopharyngeal swab (Organization WH, 2023); unilateral or bilateral interstitial infiltrates confirmed by chest X-ray (Zeng et al., 2021); the presence of acute hypoxemic respiratory failure requiring mechanical ventilation. Infections were considered nosocomial if the positive culture for A. baumannii was obtained more than 48 hours after hospital admission. To distinguish true co-infection from colonization, a combination of clinical, microbiological, and diagnostic criteria was employed. Only patients with positive cultures from both clinically relevant sites (e.g., blood, sputum, bronchoalveolar lavage (BAL), urine, wound) accompanied by signs and symptoms of infection, such as fever, respiratory distress, or sepsis, were considered to have co-infections. In contrast, patients with positive cultures from non-infectious sites (e.g., throat or rectal swabs) who did not exhibit clinical signs of infection were classified as colonized. Patient data were obtained from hospital computerized databases. The following information was collected: clinical, demographic, and laboratory findings; underlying conditions; microbiological data; duration of ICU stay.
Definitions
Pulmonary infections were classified into two categories: (a) co-infections, referring to cases where patients with confirmed COVID-19 simultaneously harbored other pathogens within the first 48 hours, and (b) secondary infections, characterized by the emergence of new pathogenic infections occurring beyond 48 hours following hospital admission (). A bloodstream infection is identified by the presence of a likely pathogen in at least one positive blood culture. For organisms common to skin flora, multiple positive cultures (e.g., two or more) are often needed to confirm infection and rule out contamination (Timsit et al., 2020). Septic shock was defined according to the 2016 Third International Consensus Definitions for Sepsis and Septic Shock (Singer et al., 2016). Urinary tract infection was diagnosed based on both clinical and microbiological evidences (Van Laethem et al., 2021).
Isolate identification
One isolate per patient was included in this study. All bacterial isolates were identified using standard laboratory methods, including Gram-staining, oxidase and catalase tests, oxidative/fermentative tests, motility, and growth ability at 42°C (Vasconcellos et al., 2017). Species identification was confirmed by amplification of gltA gene (encoding species citrate synthase), as described previously (Wong et al., 2014). The A. baumannii isolates were stored at –70°C in trypticase soy broth with 20% glycerol until used for the study.
Antibiotic susceptibility testing
The antimicrobial susceptibility was determined using the Kirby Bauer (disc agar diffusion) method based on Clinical and Laboratory Standards Institute (CLSI) guidelines (Weinstein MP et al., 2022). For disk diffusion test, eleven antimicrobial disks (MAST, United Kingdom) were used including: amikacin)30 μg(, gentamicin (10 μg), cefepime (30 μg), ceftazidime (30 μg), cefotaxime (30 μg), ciprofloxacin (5μg), piperacillin-tazobactam (10 μg), trimethoprim-sulfamethoxazole (30 μg), ampicillin-sulbactam (30μg), meropenem (10 μg) and imipenem (10 μg). The broth microdilution method was implemented to determine the minimum inhibitory concentration (MIC) of colistin according to CLSI guidelines (Weinstein MP et al., 2022). Additionally, the broth disk elution method was used to confirm the resistance to colistin according to CLSI guideline Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality control strains. The investigated isolates which were resistant to three or more different classes of antibiotics except for carbapenems, were considered as MDR phenotype and MDR isolates which were resistant to meropenem, were considered as XDR phenotype ().
DNA extraction
To obtain genomic DNA, the boiling method was implemented as previously described (). DNA purity and quantification was assessed using NanoDrop device (Thermo Scientific,Wilmington, DE, USA). The supernatant was stored at −20°C as the DNA template to be used in PCR reactions.
Detection of antibiotic resistance genes
The presence of class D carbapenemases genes (blaOXA−23−like, blaOXA−24−like and blaOXA−58−like) was investigated by multiplex-PCR method as described previously (Woodford et al., 2006). Furthermore, isolates harbouring the class B carbapenemases or metallobeta-lactamases (MBL) genes (blaNDM, blaIMP, blaVIM-1), class A carbapenemase (blaKPC, blaTEM), aminoglycoside resistance genes (aac(6′)-Ib, aac(3)-Ia, ant(2″)-Ia and aph(3’)- Ia) and colistin resistance determinant (mcr-1) were detected by single PCR as described previously (; Robicsek et al., 2006; Nguyen et al., 2010; ; ; ; ; ; Pourajam et al., 2022). Positive and negative controls were used for each of the investigated ARGs during PCR. The primers and the PCR conditions used for the amplification are listed in Table 1.
Table 1
| Gene | Primer sequence (5’ to 3’) | Product size (bp) | PCR programme* | Reference |
|---|---|---|---|---|
| aac(6′)-Ib | TTGCGATGCTCTATGAGTGGCTA CTCGAATGCCTGGCGTGTTT | 482 | 94°C, 60s; 61°C, 40s; 72°C, 30s: 30 cycles | (Vasconcellos et al., 2017) |
| aac(3)-Ia | GCAGTCGCCCCTAAAACAAA CACTTCTTCCCGTATGCCCAACTT | 464 | 94°C, 60s; 61°C, 40s; 72°C, 30s: 30 cycles | (Wong et al., 2014) |
| ant(2″)-Ia | ACGCCGTGGGTCGATGTTTGATGT CTTTTCCGCCCCGAGTGAGGTG | 572 | 94°C, 60s; 67°C, 40s; 72°C, 35s: 30 cycles | |
| aph(3’) Ia | CGAGCATCAAATGAAACTGC GCGTTGCCAATGATGTTACAG | 624 | 94°C, 60s; 57°C, 40s; 72°C, 30s: 30 cycles | |
| TEM | TGCGGTATTATCCCGTGTTG TCGTCGTTTGGTATGGCTTC | 297 | 94°C, 60s; 55°C, 40s; 72°C, 30s: 30 cycles | (Weinstein MP et al., 2022) |
| VIM-1 | AGTGGTGAGTATCCGACAG ATGAAAGTGCGTGGAGAC | 261 | 94°C, 60s; 56°C, 40s; 72°C, 30s: 30 cycles | () |
| KPC | CGTCTAGTTCTGCTGTCTTG CTTGTCATCCTTGTTAGGCG | 798 | 94°C, 60s; 60°C, 40s; 72°C, 40: 30 cycles | (Woodford et al., 2006) |
| IMP | CATGGTTTGGTGGTTCTTGT ATAATTTGGCGGACTTTGGC | 448 | 94°C, 60s; 56°C, 40s; 72°C, 30s: 30 cycles | () |
| NDM | GGTTTGGCGATCTGGTTTTC CGGAATGGCTCATCACGATC | 621 | 94°C, 60s; 62°C, 40s; 72°C, 35s: 30 cycles | () |
| mcr-1 | CGGTCAGTCCGTTTGTTC CTTGGTCGGTCTGTAGGG | 309 | 94°C, 60s; 56°C, 40s; 72°C, 30s: 30 cycles | () |
| OXA-23-like | GATCGGATTGGAGAACCAGA ATTTCTGACCGCATTTCCAT | 501 | 94°C, 60s; 57°C, 45s; 72°C, 60: 30 cycles | (Timsit et al., 2020) |
| OXA-24-like | GGTTAGTTGGCCCCCTTAAA AGTTGAGCGAAAAGGGGATT | 246 | ||
| OXA-58-lik | AAGTATTGGGGCTTGTGCTG CCCCTCTGCGCTCTACATAC | 599 |
The primers and the conditions used for the amplification of genes encoding antibiotic resistance.
*Before the first cycle of gene amplification, the sample was subjected to denaturation at 94°C for a duration of 5 minutes. Following the final cycle, the sample underwent an extension phase at 72°C for 5 minutes.
Identification of global clones
Alleles of ompA, csuE and OXA-51-like genes were amplified using multiplex-PCR method in order to identify group 1 (GC2) or group 2 (GC1) as previously described (Turton et al., 2007). The primers sequences are provided in Table 2. Each PCR reaction mixture contained: 12.5 μL PCR Master Mix (Ampliqon, Denmark), which contains Taq DNA polymerase, PCR Buffer, and dNTPs, 1 μL of 20 pM of each primer (Metabion, Germany) and 100 ng of genomic DNA. Amplification reaction was performed by thermal cycler with an initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 45s, annealing at 57°C for 45s, and extension at 72°C for 1 min, afterwards final extension at 72°C for 5 min. After visualization of products by gel electrophoresis, if all three genes (Table 2) associated with group I are detected as positive, the isolates are classified under group 1. Similarly, if all three genes associated with group II are positive, the isolates are classified under group 2. In cases when ompA from group II, along with csuE and OXA66 from group I, are positive, the isolates are classified under group 3 of the global clone.
Table 2
| Gene | Primer sequence (5' to 3') | Product size(bp) | Tm (°C) | Ref |
|---|---|---|---|---|
| Group1ompA Forward | GATGGCGTAAATCGTGGTA | 355 | 55 | () |
| Group 1ompA Reverse | CAACTTTAGCGATTTCTGG | 355 | 53 | |
| Group 1csuE Forward | CTTTAGCAAACATGACCTACC | 702 | 57 | |
| Group 1csuE Reverse | TACACCCGGGTTAATCGT | 702 | 54 | |
| Group1OXA66 Forward | GCGCTTCAAAATCTGATGTA | 559 | 54 | |
| Group1OXA66 Reverse | GCGTATATTTTGTTTCCATTC | 559 | 54 | |
| Group 2ompA Forward | GACCTTTCTTATCACAACGA | 343 | 54 | |
| Group 2ompA Reverse | CAACTTTAGCGATTTCTGG | 343 | 57 | |
| Group 2csuE Forward | GGCGAACATGACCTATTT | 580 | 52 | |
| Group 2csuE Reverse | CTTCATGGCTCGTTGGTT | 580 | 54 | |
| Group2OXA69 Forward | CATCAAGGTCAAACTCAA | 162 | 49 | |
| Group2OXA69 Reverse | TAGCCTTTTTTCCCCATC | 162 | 52 |
Primers used for identification of Global Clones.
Repetitive Extragenic Palindromic Element PCR (Rep-PCR) Genotyping
A.baumannii isolates were subjected to molecular typing by REP-PCR using the primer pairs REP1R-I (IIIICGICGICATCIGGC) and REP 2-I (ICGICTTATCIGGCCTAC) which were implemented to amplify putative REP like elements in the bacterial chromosomes (). DNA amplification was performed in a final volume of 25 μl containing 12.5 μl of 2X Multi-Star PCR Master Mix (Bio-FACT, South Korea), 1 μl of each primer, 8.5 μl of distilled water, and 2 μl of the template DNA. Amplification reaction was performed by thermal cycler with an initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 45°C for 1 min, and extension at 72°C for 1 min, afterwards final extension at 72°C for 16 min. After visualization of products by gel electrophoresis, REP-PCR patterns were analyzed Using http://insilico.ehu.es/dice_upgma/ and isolates that revealed similarity cut-off ≥80% of their banding patterns were considered as the same types and isolates with similarity cut-off <80% were taken as different types.
Statistical analysis
All data regarding the results of microbial tests, clinical findings and demographic characteristics, were added to the statistical package IBM SPSS Version 26 (Armonk, NY, USA) and analysis was performed using descriptive statistical tests.
Results
Prevalence of A. baumannii infections in Patients with COVID-19
Between April and November 2021, a total of 3,868 patients were admitted to intensive care units (ICUs), of whom 528 were diagnosed with PCR-confirmed COVID-19. Among these, 8.1% (43/528) were infected with A. baumannii and were included in this study. All isolates were confirmed to be A. baumannii by amplifying the gltA gene. Of 43 A. baumannii isolates, 81.4% (35/43) were recovered from respiratory samples, 14% (6/43) from blood, and 4.6% (2/43) from urine samples. The majority of isolates were recovered from males, comprising 62.8% (27/43). The age range was 18 to 87 years, with a mean age of 66.7 years. The most prevalent comorbidity in patients was hypertension, affecting 48.8% (21/43), followed by chronic heart disease in 39.5% (17/43), and diabetes in 30.2% (13/43). Ultimately, at the end of a median length of stay of 26.2 days, 88.4% (38/43) patients had died (Table 3). Meropenem was administered to all patients in the current study. Additionally, 91% (39/43) of the patients received a combination therapy of meropenem and colistin.
Table 3
| Parameters | (Mean ± SD) | |
|---|---|---|
| Age | 66.7 ± 11.1 | |
| Duration of Hospital Stay | 26.2 ± 27/1 | |
| Laboratory findings on admission | CRP (mg/L) | 110 ± 42.6 |
| ESR | 89 ± 36.3 | |
| WBC | 11800 ± 19591 | |
| Platelet count | 164 ± 102 | |
| n (%) | ||
| Gender | Male | 27 (62.8) |
| Female | 16 (37.2) | |
| Outcome | Expired | 38 (88.4) |
| Discharged | 5 (11.6) | |
| Sample source | Respiratory tract samples | 35 (81.4) |
| Blood | 6 (14) | |
| Urine | 2 (4.6) | |
| Comorbidities | Diabetes | 13 (30.23) |
| Hypertension | 21 (48/84) | |
| Chronic heart disease | 17 (39.53) | |
| Chronic respiratory disease | 1 (2.33) | |
| Immunodeficiency | 7 (16.28) | |
| Cancer | 4 (9.3) | |
| addiction | 3 (6.98) | |
| Chronic kidney disease | 5 (11.63) | |
Demographic Characteristics and laboratory findings of Hospitalized COVID-19 Patients (n=43) with A. baumannii coinfection.
Antimicrobial susceptibility tests
All 43 A. baumannii isolates were tested against a panel of 11 antibiotic discs and colistin as recommended by the CLSI-2021. The frequency of resistance to most tested antibiotics was high. Among the 43 A. baumannii strains isolated from COVID-19 patients, the highest resistance rate was observed against cefotaxime 100% (43/43), followed by 97.7% (42/43) resistance against each imipenem, meropenem, piperacillin-tazobactam and ciprofloxacin. The resistance rate against cefepime and ampicillin-sulbactam was 95.3% (41/43), 93% (40/43) against gentamicin, 90.7% (39/43) against each trimethoprim-sulfamethoxazole and amikacin and 88.4% (38/43) against ceftazidime. The most active antimicrobial agent against A. baumannii strains from COVID-19 patients was colistin with 55.8% (24/43) sensitivity. Most of the isolates, 91% (39/43), were XDR (resistant to +3 antibiotic classes), and 9% (4/43) were MDR phenotypes. Ten distinct patterns of antibiotic resistance were identified among 43 A. baumannii strains from COVID-19 patients in which the most prevalent patterns were resistant to all tested antibiotics expect colistin 44.2% (19/43) and resistant to all tested antibiotics 34.8% (15/43), respectively (Table 4).
Table 4
| Isolate No. | Sample source | Gender | Outcome | Resistance pattern | Resistance gene | REP type |
|---|---|---|---|---|---|---|
| AB2 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, VIM, TEM | G |
| AB3 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, OXA-23-Like | Untypeable |
| AB5 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | aac6´Ib | G |
| AB6 | BAL | Male | Expired | IMI, MEM, SAM, TS, CTX | aac3-Ia, OXA-23-Like | D |
| AB7 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, TS, SAM, PTZ, CPM | aac6´Ib, NDM, VIM, KPC, TEM, OXA-23-Like | F |
| AB8 | Urine | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM, COL | aac6´Ib, NDM, TEM, OXA-23-Like | C |
| AB12 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CIP, GM, AK, SAM, COL, PTZ, CPM | aph3´Ia, ant2´ Ia, OXA-23-Like, OXA-58-Like | Untypeable |
| AB19 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, OXA-23-Like | G |
| AB24 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | aac6´Ib, NDM, VIM, KPC | H |
| AB28 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, OXA-24-Like | G |
| AB33 | Blood | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, ant2´ Ia, TEM, OXA-23-Like | J |
| AB34 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, ant2´ Ia, OXA-23-Like | A |
| AB36 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, ant2´ Ia, aph3´Ia, NDM, OXA-23-Like | G |
| AB37 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, aac3-Ia, aph3´Ia, NDM, OXA-23-Like | G |
| AB39 | Teracheal discharge | Male | Discharged | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | aac6´Ib, ant2´ Ia, NDM, TEM, OXA-23-Like, OXA-58-Like | G |
| AB42 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | OXA-24-Like | G |
| AB47 | Teracheal discharge | Female | Discharged | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, ant2´ Ia, OXA-23-Like | B |
| AB48 | blood | Male | Discharged | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, ant2´ Ia, OXA-23-Like, NDM | G |
| AB50 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, SAM, PTZ, CPM | aac6´Ib, ant2´ Ia, OXA-24-Like | G |
| AB51 | Blood | Male | Expired | IMI, MEM, PTZ, CIP, CPM, GM, CTX, AK | aac6´Ib, ant2´ Ia, OXA-24-Like | G |
| AB53 | Teracheal discharge | Male | Expired | IMI, MEM, PTZ, CIP, CPM, GM, CTX, AK | aac6´Ib, aac3-Ia | G |
| AB57 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | VIM | G |
| AB58 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | aac6´Ib, aph3´Ia, NDM, TEM | G |
| AB59 | Blood | Female | Expired | IMI, MEM, CTX, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | OXA-48, aac6´Ib | G |
| AB60 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, KPC, TEM, OXA-23-Like | G |
| AB62 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | aac6´Ib, aph3´Ia, TEM, OXA-23-Like | G |
| AB68 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | ant2´ Ia, aph3´Ia, NDM, VIM, OXA-24-Like | E |
| AB69 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | NDM, aac6´Ib, | G |
| AB72 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aac6´Ib, TEM, OXA-24-Like | I |
| AB75 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | TEM | K |
| AB76 | Blood | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | aph3´Ia, TEM, OXA-23-Like, OXA-24-Like | G |
| AB78 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | ant2´ Ia, IMP | L |
| AB79 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | ant2´ Ia, OXA-23-Like | Untypeable |
| AB80 | BAL | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | ant2´ Ia, TEM, OXA-23-Like | G |
| AB84 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | TEM, OXA-24-Like | G |
| AB85 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | ant2´ Ia, TEM, OXA-23-Like | G |
| AB86 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, PTZ, CPM | ant2´ Ia, TEM, OXA-23-Like | G |
| AB89 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | NDM, TEM, OXA-24-Like | G |
| AB96 | Teracheal discharge | Female | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | ant2´ Ia, TEM, OXA-24-Like | G |
| AB98 | Teracheal discharge | Male | Discharged | IMI, MEM, CTX, CAZ, CIP, TS, SAM, COL, PTZ, CPM | aac6´Ib, TEM, OXA-23-Like | Untypeable |
| AB105 | Teracheal discharge | Male | Expired | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | aac6´Ib, ant2´ Ia, TEM, OXA-24-Like | G |
| AB109 | Teracheal discharge | Male | Expired | PTZ, SAM, CIP, TS, CAZ, CTX | aac6´Ib, OXA-58-Like | G |
| AB118 | Wound | Female | Discharged | IMI, MEM, CTX, CAZ, CIP, GM, AK, TS, SAM, COL, PTZ, CPM | OXA-24-Like | G |
The demographic, molecular characteristics and antimicrobial resistance profile of 43 Acinetobacter baumannii isolates obtained from patients with Covid-19 infection.
BAL, Broncho Alveolar Lavage; IMI, Imipenem; MEM, Meropenem; PTZ, Piperacillin-tazobactam; SAM, Ampicillin-sulbactam; CTX, Cefotaxime; CAZ, Ceftazidime; CIP, Ciprofloxacin; GM, Gentamicin; AK, Amikacin; TS, Trimethoprim-sulfamethoxazole; COL, Colistin; CPM, Cef.
Detection of ARGs
The rate of genes encoding class D carbapenemases which were detected using Multiplex PCR was OXA-23-like 67.4% (29/43), OXA-24-like 30.2% (13/43) and OXA-58-like 7% (3/43). Amongst the MBLs; blaNDM was detected in 41.8%, (18/43), blaIMP 2.3% (1/43) and blaVIM-1 9.3% (4/43) isolates. Class A β-lactamase blaKPC was detected in 9.3% (4/43) isolates and 48/8% (21/43) of isolates harbored blaTEM gene. The following percentages of selected genes encoding aminoglycoside-modifying enzymes (AMEs) [aac(6’)-Ib 65.1% (28/43), aac(3)-Ia, 4.7% (2/43), ant(2`)-Ia 46.5% (20/43), aph(3’)-Ia 16.3% (7/43)] were observed among analyzed strains. PCR amplification of mcr-1 primers did not bring about a product for colistin resistance encoding gene. Our study shown the presence of at least one AME and β-lactamase encoding gene in 88.37% (38/43) and 67.4% (29/43) of isolates, respectively (Table 4).
Global clones lineages
Multiplex PCR for the identification of GCs indicated 83.7% (36/43), 11.6% (5/43) and 4.7% (2/43) of A. baumannii isolates belonged to GC II, GC I and GC III, respectively (Figure 1).
Figure 1
REP-PCR genotyping
The clonal relatedness of 43 A. baumannii isolates was studied by REP-PCR, which amplified 5 to 9 bands with molecular weight ranging from 150 bp to 1.2 kb and were labelled A to L. Among 43 A. baumannii isolates, 39 isolates were typed by REP-PCR and no bands were observed in 4 isolates (Figure 1). By using a cut off value of ≥80% as the threshold, 12 patterns among 39 tested isolates were observed, in which 11 patterns were detected once, while the remaining 1 pattern was repeatedly observed. Genotype G was the most prevalent, accounting for 72% (28/39) of the isolates. Of this genotype, 96% (27/28) exhibited resistance to carbapenems.
Discussion
Given the increased incidence of infections caused by MDR and XDR strains of A. baumannii, this pathogen has emerged as a significant threat to vulnerable ICU patients, especially those facing critical conditions, such as COVID-19 patients. In this cross-sectional study, the prevalence of A. baumannii co-infection in COVID-19 patients was 8.1%, which was similar with other reports from Iran (7.44%) (), Jordan (8.1%) () and India (8.9%) (); whereas, in other studies conducted in Italy (15.5%) (), China (21.8%) (Sang et al., 2021), Iran (41% and 51%) (; Pourajam et al., 2022) and United States (62%) (Perez et al., 2020), the incidence of co-infection was significantly higher than the rate of present Study. The observed variation may be attributed to the differences in healthcare systems and infection control practices (Organization WH, 2016), patient demographics and characteristics (), diagnostic methods and surveillance (), regional epidemiology (Peleg et al., 2008) and study design and methodology (von Elm et al., 2007). Our study reveals that the number of males infected with A. baumannii in ICU was higher than the number of females infected with A. baumannii. This may be due to the differences in immunologic reaction because testosterone has immunosuppressive effect in males while estradiol has a pro-inflammatory effect in females (). The mortality rates among COVID-19 patients varied widely across different countries, ranging from 16% to 100% (; Novović et al., 2023). Our study revealed a high mortality rate (88.4%) among COVID-19 patients infected with A. baumannii. A study conducted in Qom, Iran, Sharifipour et al. observed that among 17 COVID-19 patients with A. baumannii infections, 17 (100%) died. In another study in Serbia showed the mortality rate was 100% (Novović et al., 2023), while a study in South Korea had a lower mortality rate of 64.3% (). Possible explanations for these differences in mortality rates might be attributed to variation in clinical supervision, the accessibility of therapeutics, healthcare organization and staff training (). Additionally, comorbidities also play a crucial role in the mortality of COVID-19 patients. Hypertension, cardiovascular disease, and diabetes were the most common comorbidities observed in our study, consistent with similar findings elsewhere (Woodford et al., 2006; ). In this study, the median length of stay in the ICU was higher (26.2 days) compared with other studies from Iran (15.8 days), South Korea (16.8 days) and Italy (12 days) (). The variation in the median length of stay might be related to several factors, including differences in healthcare systems, treatment protocols, patient demographics, and the prevalence and resistance patterns of A. baumannii (Vincent et al., 2014; Rosenthal et al., 2020). Regarding antibiotic resistance, our isolates were extremely resistant to the most evaluated antibiotics. Furthermore, out of the 43 isolates, 98% were CRAB, 91% were XDR and 9% were MDR. This high rate of antibiotic resistance in our hospital was possible as a result of the excessive or misuse of antibiotics, which creates the selection pressure for development of resistance. Alarmingly, 44.2% of our isolates were resistant to colistin, that is considered to be high with respect to previous studies (; ; ). In spite of high resistance rate to colistin, none of the isolates in present study harbored mcr-1 gene. It seems that other colistin resistance mechanisms reported in A. baumannii, including mutation of the PmrAB system and loss of lipopolysaccharide (LPS) production might be involved in the resistance (Palmieri et al., 2020; Zafer et al., 2023). In this study, we identified various ARGs, and the most were OXA-23-like (67.4%), aac(6’)-Ib (65.1%), blaTEM (48.8%), ant(2`)-Ia (46.5%), blaNDM (41.8%) and OXA-24-like (30.2%). In a previous study from the southwestern of Iran, Farajzadeh et al. observed that OXA-23-like (32.2%), blaVIM (31.4%), blaIMP (25.7%) were the most common carbapenemase genes among clinical isolates of A. baumannii (). In Egypt, Benmahmod et al. reported that OXA-23-like (94%), blaKPC (56%) and blaNDM (30%) were the most prevalent carbapenemase genes among A. baumannii strains isolated from clinical samples (). In Saudi Arabia, Alyamani et al. observed that OXA-23-like (91%) and blaTEM (71%) were the most prevalent carbapenemase and class A β-lactamase encoding genes among A. baumannii isolates (). In a Chinese study, 100%, 100%, 67.53% and 31.17% of the CRAB harbored blaVIM, OXA-23-like, blaIMP and blaNDM genes, respectively (Zhu et al., 2022). In Algeria, the most prevalent AME genes in A. baumannii isolates were aac(3)-Ia (91.1%) and aph(3′)-VI (50.7%) (). A study from China, Nie et al. reported that ant(3′′)-I (66.47%), aac(3)-I (45.09%), aph(3′)-I (34.1%) and aac(6’)-Ib (32.37%) were the most prevalent AME genes among A. baumannii isolates (Nie et al., 2014). As mentioned earlier, the prevalence of ARGs varied widely between different countries. These differences may be attributed to different patterns in use of antimicrobial agents, horizontal spread of resistance determinants, dissemination of specific clones harboring various types of ARGs and the number of studied isolates. In the current study, 8 (18.6%) isolates were negative for the seven carbapenemases tested, indicating that other mechanisms such as porin loss, overexpression of efflux pumps, AmpC enzymes might contribute to carbapenem resistance (may lead to resistance to carbapenems), which were not investigated in present study (). Our data exhibited the coexistence of carbapenemases and aminoglycoside resistance genes among CRAB isolates, similar to previous reports from India () and Iran (). These findings highlighted the difficulty in treating CRAB due to the presence of multiple ARGs. Infections with CRAB carrying multiple ARGs are usually associated with a high level of mortality and morbidity. As reported previously, the majority of A. baumannii isolates that are MDR and XDR belong to two international clones (GC1 and GC2) (). In agreement with other studies (; ), the current study demonstrated the predominance of GC2 isolates in our collection (83.7%). Molecular typing is a relevant tool for epidemiological purposes and examining the genetic structure of the organisms (). To further examine the genetic relatedness of A. baumannii isolates, the REP-PCR typing method was employed. In this work, 43 isolates were examined, leading to the identification of 12 distinct patterns among the 39 typeable isolates. Notably, a significant proportion (72%) of our isolates were grouped into a single genotype or clone, suggesting that these isolates were closely related and the spread of these isolates were associated with a clonal outbreak. It should be noted that we observed that isolates belonging to genotype G have the distinct ARGs, indicating that the horizontal transmission may occurred. Generally, isolation of many resistant bacteria in hospitals such as CRAB can be driven by two epidemiological scenarios: the emergence and spread of a specific clone, or the persistence and coexistence of multiple clones (). Our data are in concordance with the first scenario, because one clone is circulating in our hospital. To prevent the circulation of specific clones in hospitals, effective infection prevention and control are crucial. The hospital infection control committee (HICC) is present in the majority of Iranian hospitals, but HICC lacks an efficient program for infection prevention and control (; ). These committees exist generally on paper; in practice, they scarcely exist (; ; ). These issues are exacerbated during crises like the COVID-19 pandemic, potentially facilitating the horizontal transmission and spread of specific clones of multidrug-resistant organisms (). It should be emphasized that the present study had several limitations. First, the major limitation of this study was its retrospective design. Second, owing to the small sample size and single-center design, the findings may not be generalizable to patient populations in different hospitals and countries. Third, utilization other typing approaches such as multi-locus sequence typing and pulsed-field gel electrophoresis for further genotypic characterization is recommended.
Conclusion
The high prevalence of MDR A. baumannii such as carbapenem and colistin-resistant strains, poses a significant concern for the treatment of COVID-19 patients, heightening the risk of therapeutic failure. The REP-PCR typing data demonstrate the dissemination of a single A. baumannii clone carrying multiple ARGs within our hospital. Regarding the limited therapeutic options, it is crucial to implement effective prevention and containment policies to curb the spread of these isolates.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The studies involving humans were approved by Ethics Committee of Tehran University of Medical Sciences, Tehran, Iran. The studies were conducted in accordance with the local legislation and institutional requirements. The ethics committee/institutional review board waived the requirement of written informed consent for participation from the participants or the participants’ legal guardians/next of kin because No clinical samples were drawn for this study, clinical samples collected as routine clinical care for these patients and remnant of samples were used. Therefore, informed consent was not sought, and informed consent waiver was approved by the ethics committee of Tehran University of Medical Sciences.
Author contributions
MG: Investigation, Methodology, Writing – original draft. FJ: Resources, Writing – review & editing. SA: Writing – review & editing. SH: Formal analysis, Software, Writing – review & editing. ME: Writing – review & editing. RB: Supervision, Writing – original draft.
Funding
The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This research has been supported by Tehran University of Medical Sciences and Health Services. Study grant no. 1400-2-101-54321.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
AbdollahiA.AliramezaniA.SalehiM.Norouzi ShadehiM.GhourchianS.DouraghiM. (2021). Co-infection of ST2(IP) carbapenem-resistant Acinetobacter baumannii with SARS-CoV-2 in the patients admitted to a Tehran tertiary referral hospital. BMC Infect. Dis.21, 927. doi: 10.1186/s12879-021-06642-2
2
AlsheikhA. D.AbdallaM. A.AbdullahM.HasanH. (2022). The prevalence of bacterial and fungal coinfections among critically ill COVID-19 patients in the ICU in Jordan. Int. J. Microbiol.2022, 9992881. doi: 10.1155/2022/9992881
3
Al-SultanA. A.EvansB. A.AboulmagdE.Al-QahtaniA. A.BoholM. F. F.Al-AhdalM. N.et al. (2015). Dissemination of multiple carbapenem-resistant clones of Acinetobacter baumannii in the Eastern District of Saudi Arabia. Front. Microbiol.6. doi: 10.3389/fmicb.2015.00634
4
AlyamaniE. J.KhiyamiM. A.BooqR. Y.AlnafjanB. M.AltammamiM. A.BahwerthF. S. (2015). Molecular characterization of extended-spectrum beta-lactamases (ESBLs) produced by clinical isolates of Acinetobacter baumannii in Saudi Arabia. Ann. Clin. Microbiol. Antimicrob.14, 38. doi: 10.1186/s12941-015-0098-9
5
BakourS.TouatiA.SahliF.AmeurA. A.HaouchineD.RolainJ. M. (2013). Antibiotic resistance determinants of multidrug-resistant Acinetobacter baumannii clinical isolates in Algeria. Diagn. Microbiol. Infect. Dis.76, 529–531. doi: 10.1016/j.diagmicrobio.2013.04.009
6
BarbatoD.CastellaniF.AngelozziA.IsonneC.BaccoliniV.MigliaraG.et al. (2019). Prevalence survey of healthcare-associated infections in a large teaching hospital. Ann. Ig.31, 423–435.
7
BeigM.BadmastiF.SolgiH.NikbinV. S.SholehM. (2023). Carbapenemase genes distribution in clonal lineages of Acinetobacter baumannii: a comprehensive study on plasmids and chromosomes. Front. Cell Infect. Microbiol.13. doi: 10.3389/fcimb.2023.1283583
8
BenmahmodA. B.SaidH. S.IbrahimR. H. (2019). Prevalence and mechanisms of carbapenem resistance among acinetobacter baumannii clinical isolates in Egypt. Microb. Drug Resist.25, 480–488. doi: 10.1089/mdr.2018.0141
9
BinaM.PournajafA.MirkalantariS.TalebiM.IrajianG. (2015). Detection of the Klebsiella pneumoniae carbapenemase (KPC) in K. pneumoniae Isolated from the Clinical Samples by the Phenotypic and Genotypic Methods. Iran J. Pathol.10, 199–205.
10
BoralJ.GençZ.PınarlıkF.EkinciG.KuskucuM. A.İrkörenP.et al. (2022). The association between Acinetobacter baumannii infections and the COVID-19 pandemic in an intensive care unit. Sci. Rep.12, 20808. doi: 10.1038/s41598-022-25493-8
11
BoralB.UnaldiÖErginA.DurmazR.EserÖK. (2019). A prospective multicenter study on the evaluation of antimicrobial resistance and molecular epidemiology of multidrug-resistant Acinetobacter baumannii infections in intensive care units with clinical and environmental features. Ann. Clin. Microbiol. Antimicrob.18, 19. doi: 10.1186/s12941-019-0319-8
12
CaiY.ChenC.ZhaoM.YuX.LanK.LiaoK.et al. (2019). High prevalence of metallo-β-lactamase-producing enterobacter cloacae from three tertiary hospitals in China. Front. Microbiol.10, 1610. doi: 10.3389/fmicb.2019.01610
13
CDC. (2019). Antibiotic Resistance Threats in the United States, 2019. Atlanta, GA: U.S. Department of Health and Human Services, CDC.
14
CeparanoM.BaccoliniV.MigliaraG.IsonneC.RenziE.TufiD.et al. (2022). Acinetobacter baumannii isolates from COVID-19 patients in a hospital intensive care unit: molecular typing and risk factors. Microorganisms10 (4). doi: 10.3390/microorganisms10040722
15
ChenC. H.HuangC. C. (2013). Molecular epidemiological study of clinical Acinetobacter baumannii isolates: phenotype switching of antibiotic resistance. Ann. Clin. Microbiol. Antimicrob.12, 21. doi: 10.1186/1476-0711-12-21
16
ChenL.LiH.WenH.ZhaoB.NiuY.MoQ.et al. (2020). Biofilm formation in Acinetobacter baumannii was inhibited by PAβN while it had no association with antibiotic resistance. MicrobiologyOpen9, e1063. doi: 10.1002/mbo3.1063
17
CultreraR.BarozziA.LibanoreM.MarangoniE.PoraR.QuartaB.et al. (2021). Co-infections in critically ill patients with or without COVID-19: A comparison of clinical microbial culture findings. Int. J. Environ. Res. Public Health18 (8). doi: 10.3390/ijerph18084358
18
EmaneiniM.BeigverdiR.van LeeuwenW. B.RahdarH.Karami-ZarandiM.HosseinkhaniF.et al. (2018). Prevalence of methicillin-resistant Staphylococcus aureus isolated from burn patients in Iran: A systematic review and meta-analysis. J. Glob Antimicrob. Resist.12, 202–206. doi: 10.1016/j.jgar.2017.10.015
19
EndaleH.MathewosM.AbdetaD. (2023). Potential causes of spread of antimicrobial resistance and preventive measures in one health perspective-A review. Infect. Drug Resist.16, 7515–7545. doi: 10.2147/IDR.S428837
20
EsfandiariA.SalariH.RashidianA.Masoumi AslH.Rahimi ForoushaniA.Akbari SariA. (2018). Eliminating healthcare-associated infections in Iran: A qualitative study to explore stakeholders’ Views. Int. J. Health Policy Manage.7, 27–34. doi: 10.15171/ijhpm.2017.34
21
Farajzadeh SheikhA.SavariM.Abbasi MontazeriE.KhoshnoodS. (2020). Genotyping and molecular characterization of clinical Acinetobacter baumannii isolates from a single hospital in Southwestern Iran. Pathog. Glob Health114, 251–261. doi: 10.1080/20477724.2020.1765124
22
GhotaslouR.Yeganeh SefidanF.AkhiM. T.AsgharzadehM.Mohammadzadeh AslY. (2017). Dissemination of genes encoding aminoglycoside-modifying enzymes and armA among enterobacteriaceae isolates in northwest Iran. Microb. Drug Resist.23, 826–832. doi: 10.1089/mdr.2016.0224
23
GiakkoupiP.XanthakiA.KanelopoulouM.VlahakiA.MiriagouV.KontouS.et al. (2003). VIM-1 Metallo-beta-lactamase-producing Klebsiella pneumoniae strains in Greek hospitals. J. Clin. Microbiol.41, 3893–3896. doi: 10.1128/JCM.41.8.3893-3896.2003
24
GrasselliG.GrecoM.ZanellaA.AlbanoG.AntonelliM.BellaniG.et al. (2020a). Risk factors associated with mortality among patients with COVID-19 in intensive care units in Lombardy, Italy. JAMA Intern. Med.180, 1345–1355.
25
GrasselliG.ZangrilloA.ZanellaA.AntonelliM.CabriniL.CastelliA.et al. (2020b). Baseline characteristics and outcomes of 1591 patients infected with SARS-coV-2 admitted to ICUs of the Lombardy region, Italy. Jama323, 1574–1581. doi: 10.1001/jama.2020.5394
26
HafizT. A.AlghamdiS. S.MubarakiM. A.AlghamdiS. S. M.AlothaybiA.AldawoodE.et al. (2023). A two-year retrospective study of multidrug-resistant Acinetobacter baumannii respiratory infections in critically Ill patients: Clinical and microbiological findings. J. Infect. Public Health16, 313–319. doi: 10.1016/j.jiph.2023.01.004
27
HallinM.DeplanoA.StruelensM. J. (2012). “Molecular Typing of Bacterial Pathogens: A Tool for the Epidemiological Study and Control of Infectious Diseases,” in New Frontiers of Molecular Epidemiology of Infectious Diseases. Eds. MorandS.BeaudeauF.CabaretJ. (Springer Netherlands, Dordrecht), 9–25.
28
HamedS. M.HusseinA. F. A.Al-AgamyM. H.RadwanH. H.ZaferM. M. (2022). Genetic configuration of genomic resistance islands in acinetobacter baumannii clinical isolates from Egypt. Front. Microbiol.13, 878912. doi: 10.3389/fmicb.2022.878912
29
IbrahimM. E. (2019). Prevalence of Acinetobacter baumannii in Saudi Arabia: risk factors, antimicrobial resistance patterns and mechanisms of carbapenem resistance. Ann. Clin. Microbiol. Antimicrob.18, 1. doi: 10.1186/s12941-018-0301-x
30
JamnaniA. N.MontazeriM.MirzakhaniM.MoosazadehM.HaghighiM. (2022). Evaluation of bacterial coinfection and antibiotic resistance in patients with COVID-19 under mechanical ventilation. SN Compr. Clin. Med.4, 19. doi: 10.1007/s42399-021-01114-9
31
KarthikeyanK.ThirunarayanM. A.KrishnanP. (2010). Coexistence of blaOXA-23 with blaNDM-1 and armA in clinical isolates of Acinetobacter baumannii from India. J. Antimicrob. Chemother.65, 2253–2254. doi: 10.1093/jac/dkq273
32
KhuranaS.SinghP.SharadN.KiroV. V.RastogiN.LathwalA.et al. (2021). Profile of co-infections & secondary infections in COVID-19 patients at a dedicated COVID-19 facility of a tertiary care Indian hospital: Implication on antimicrobial resistance. Indian J. Med. Microbiol.39, 147–153. doi: 10.1016/j.ijmmb.2020.10.014
33
KimJ. Y.LeeW. J.SuhJ. W.KimS. B.SohnJ. W.YoonY. K. (2023). Clinical impact of COVID-19 in patients with carbapenem-resistant Acinetobacter baumannii bacteraemia. Epidemiol. Infect.151, e180. doi: 10.1017/S0950268823001644
34
KyriakidisI.VasileiouE.PanaZ. D.TragiannidisA. (2021). Acinetobacter baumannii antibiotic resistance mechanisms. Pathogens10 (3). doi: 10.3390/pathogens10030373
35
LansburyL.LimB.BaskaranV.LimW. S. (2020). Co-infections in people with COVID-19: a systematic review and meta-analysis. J. Infect.81, 266–275. doi: 10.1016/j.jinf.2020.05.046
36
LucienM. A. B.CanarieM. F.KilgoreP. E.Jean-DenisG.FénélonN.PierreM.et al. (2021). Antibiotics and antimicrobial resistance in the COVID-19 era: Perspective from resource-limited settings. J. Glob. Infect. Dis.104, 250–254. doi: 10.1016/j.ijid.2020.12.087
37
MalaebR.HaiderA.AbdulateefM.HameedM.DanielU.KabilwaG.et al. (2023). High mortality rates among COVID-19 intensive care patients in Iraq: insights from a retrospective cohort study at Médecins Sans Frontières supported hospital in Baghdad. Front. Public Health11, 1185330. doi: 10.3389/fpubh.2023.1185330
38
MamishiS.PourakbariB.TeymuriM.BabamahmoodiA.MahmoudiS. (2014). Management of hospital infection control in Iran: a need for implementation of multidisciplinary approach. Osong Public Health Res. Perspect.5, 179–186. doi: 10.1016/j.phrp.2014.06.001
39
Mobarak-QamsariM.JenaghiB.SahebiL.Norouzi-ShadehiM.SalehiM.-R.Shakoori-FarahaniA.et al. (2023). Evaluation of Acinetobacter baumannii, Klebsiella pneumoniae, and Staphylococcus aureus respiratory tract superinfections among patients with COVID-19 at a tertiary-care hospital in Tehran, Iran. Eur. J. Med. Res.28, 314. doi: 10.1186/s40001-023-01303-3
40
NguyenN. T.HaV.TranN. V.StablerR.PhamD. T.LeT. M.et al. (2010). The sudden dominance of blaCTX-M harbouring plasmids in Shigella spp. Circulating in Southern Vietnam. PloS Negl. Trop. Dis.4, e702. doi: 10.1371/journal.pntd.0000702
41
NieL.LvY.YuanM.HuX.NieT.YangX.et al. (2014). Genetic basis of high level aminoglycoside resistance in Acinetobacter baumannii from Beijing, China. Acta Pharm. Sin. B.4, 295–300. doi: 10.1016/j.apsb.2014.06.004
42
NovovićK.Kuzmanović NedeljkovićS.PoledicaM.NikolićG.GrujićB.JovčićB.et al. (2023). Virulence potential of multidrug-resistant Acinetobacter baumannii isolates from COVID-19 patients on mechanical ventilation: The first report from Serbia. Front. Microbiol.14, 1094184. doi: 10.3389/fmicb.2023.1094184
43
Organization WH (2016). Guidelines on core components of infection prevention and control programmes at the national and acute health care facility level91.
44
Organization WH (2023). COVID-19 epidemiological update 2023.
45
PalmieriM.D’AndreaM. M.PelegrinA. C.PerrotN.MirandeC.BlancB.et al. (2020). Abundance of colistin-resistant, OXA-23- and armA-producing acinetobacter baumannii belonging to international clone 2 in Greece. Front. Microbiol.11, 668. doi: 10.3389/fmicb.2020.00668
46
PelegA. Y.SeifertH.PatersonD. L. (2008). Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev.21, 538–582. doi: 10.1128/CMR.00058-07
47
PerezS.InnesG.MaroyaWaltersS.MehrJ.AriasJ.et al. (2020). Increase in hospital-acquired carbapenem-resistant acinetobacter baumannii infection and colonization in an acute care hospital during a surge in COVID-19 admissions — New Jersey, February–July 2020. MMWR69, 1827. doi: 10.15585/mmwr.mm6948e1
48
PetazzoniG.BellinzonaG.MerlaC.CorbellaM.MonzilloV.SamuelsenØet al. (2023). The COVID-19 Pandemic Sparked Off a Large-Scale Outbreak of Carbapenem-Resistant Acinetobacter baumannii from the Endemic Strains at an Italian Hospital. Microbiol. Spectr.11, e04505–e04522. doi: 10.1128/spectrum.04505-22
49
PourajamS.KalantariE.TalebzadehH.MellaliH.SamiR.SoltaninejadF.et al. (2022). Secondary bacterial infection and clinical characteristics in patients with COVID-19 admitted to two intensive care units of an academic hospital in Iran during the first wave of the pandemic. Front. Cell Infect. Microbiol.12, 784130. doi: 10.3389/fcimb.2022.784130
50
RobicsekA.StrahilevitzJ.SahmD. F.JacobyG. A.HooperD. C. (2006). qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother.50, 2872–2874. doi: 10.1128/AAC.01647-05
51
RosenthalV. D.Bat-ErdeneI.GuptaD.BelkebirS.RajhansP.ZandF.et al. (2020). International Nosocomial Infection Control Consortium (INICC) report, data summary of 45 countries for 2012-2017: Device-associated module. Am. J. Infect. Control.48, 423–432. doi: 10.1016/j.ajic.2019.08.023
52
SangL.XiY.LinZ.PanY.SongB.LiC. A.et al. (2021). Secondary infection in severe and critical COVID-19 patients in China: a multicenter retrospective study. Ann. Palliat Med.10, 8557–8570. doi: 10.21037/apm-21-833
53
SharmaA.TiwariS.DebM. K.MartyJ. L. (2020). Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2): a global pandemic and treatment strategies. Int. J. Antimicrob. Agents.56, 106054. doi: 10.1016/j.ijantimicag.2020.106054
54
SingerM.DeutschmanC. S.SeymourC. W.Shankar-HariM.AnnaneD.BauerM.et al. (2016). The third international consensus definitions for sepsis and septic shock (Sepsis-3). Jama315, 801–810. doi: 10.1001/jama.2016.0287
55
TacconelliE.CarraraE.SavoldiA.HarbarthS.MendelsonM.MonnetD. L.et al. (2018). Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis.18, 318–327. doi: 10.1016/S1473-3099(17)30753-3
56
TimsitJ. F.RuppéE.BarbierF.TabahA.BassettiM. (2020). Bloodstream infections in critically ill patients: an expert statement. Intensive Care Med.46, 266–284. doi: 10.1007/s00134-020-05950-6
57
TurtonJ. F.GabrielS. N.ValderreyC.KaufmannM. E.PittT. L. (2007). Use of sequence-based typing and multiplex PCR to identify clonal lineages of outbreak strains of. Acinetobacter. baumannii. Clin. Microbiol. Infect.13, 807–815. doi: 10.1111/j.1469-0691.2007.01759.x
58
Van LaethemJ.WuytsS. C. M.PierreuxJ.SeylerL.VerscheldenG.DepondtT.et al. (2021). Presumed urinary tract infection in patients admitted with COVID-19: are we treating too much? Antibiot. (Basel).10 (12). doi: 10.3390/antibiotics10121493
59
VasconcellosF.CasasM. R. T.TavaresL. C. B.GarciaD.CamargoC. H. (2017). In vitro activity of antimicrobial agents against multidrug- and extensively drug-resistant Acinetobacter baumannii. J. Med. Microbiol.66, 98–102. doi: 10.1099/jmm.0.000422
60
VincentJ. L.MarshallJ. C.Namendys-SilvaS. A.FrançoisB.Martin-LoechesI.LipmanJ.et al. (2014). Assessment of the worldwide burden of critical illness: the intensive care over nations (ICON) audit. Lancet Respir. Med.2, 380–386. doi: 10.1016/S2213-2600(14)70061-X
61
von ElmE.AltmanD. G.EggerM.PocockS. J.GøtzscheP. C.VandenbrouckeJ. P. (2007). The Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) statement: guidelines for reporting observational studies. Lancet370, 1453–1457. doi: 10.1016/S0140-6736(07)61602-X
62
Weinstein MPL. B.PatelJ.MathersA.CampeauS.MazzulliT.. (2022). CLSI supplement M100. 32rd ed (Philadelphia, United States: Clinical and Laboratory Standards Institute).
63
WongY. P.ChuaK. H.ThongK. L. (2014). One-step species-specific high resolution melting analysis for nosocomial bacteria detection. J. Microbiol. Methods107, 133–137. doi: 10.1016/j.mimet.2014.10.001
64
WoodfordN.EllingtonM. J.CoelhoJ. M.TurtonJ. F.WardM. E.BrownS.et al. (2006). Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int. J. Antimicrob. Agents.27, 351–353. doi: 10.1016/j.ijantimicag.2006.01.004
65
ZaferM. M.HusseinA. F. A.Al-AgamyM. H.RadwanH. H.HamedS. M. (2023). Retained colistin susceptibility in clinical Acinetobacter baumannii isolates with multiple mutations in pmrCAB and lpxACD operons. Front. Cell Infect. Microbiol.13, 1229473. doi: 10.3389/fcimb.2023.1229473
66
ZarrilliR.PournarasS.GiannouliM.TsakrisA. (2012). Global evolution of multidrug-resistant Acinetobacter baumannii clonal lineages. Int. J. Antimicrob. Agents.41 (1), 11–9.
67
ZengH.MaY.ZhouZ.LiuW.HuangP.JiangM.et al. (2021). Spectrum and clinical characteristics of symptomatic and asymptomatic coronavirus disease 2019 (COVID-19) with and without pneumonia. Front. Med. (Lausanne).8, 645651. doi: 10.3389/fmed.2021.645651
68
ZhuY.ZhangX.WangY.TaoY.ShaoX.LiY.et al. (2022). Insight into carbapenem resistance and virulence of Acinetobacter baumannii from a children’s medical centre in eastern China. Ann. Clin. Microbiol. Antimicrob.21, 47. doi: 10.1186/s12941-022-00536-0
Summary
Keywords
Acinetobacter baumannii, SARS-CoV-2, co-infection, antibiotic resistance, resistance genes, global clones, ICU, REP-PCR
Citation
Ghamari M, Jabalameli F, Afhami S, Halimi S, Emaneini M and Beigverdi R (2025) Acinetobacter baumannii infection in critically ill patients with COVID-19 from Tehran, Iran: the prevalence, antimicrobial resistance patterns and molecular characteristics of isolates. Front. Cell. Infect. Microbiol. 14:1511122. doi: 10.3389/fcimb.2024.1511122
Received
14 October 2024
Accepted
30 December 2024
Published
30 January 2025
Volume
14 - 2024
Edited by
Andreas Erich Zautner, University Hospital Magdeburg, Germany
Reviewed by
Sylwia Andrzejczuk, Medical University of Lublin, Poland
Hagen Frickmann, Bundeswehr Hospital Hamburg, Germany
Updates
Copyright
© 2025 Ghamari, Jabalameli, Afhami, Halimi, Emaneini and Beigverdi.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Reza Beigverdi, r-beigverdi@tums.ac.ir
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.