Abstract
Background:
During COVID-19 pandemic, men had reduced serum testosterone and higher mortality rate than women. Variations in high density lipoprotein (HDL) levels were detected in severe COVID-19 individuals. We evaluated the response of testicular macrophages, steroidogenic activity and lipid metabolism of Leydig cells in SARS-CoV-2-infected K18-hACE2 mice.
Methods:
Testes were analyzed under light and electron microscope. Immunolocalization of human angiotensin converting enzyme (hACE2) and viral proteins (spike and nucleocapsid) were evaluated in association with the expression of viral recognition receptor, Rigi. Steroidogenesis was evaluated by the expression of steroidogenic factor-1 (Sf1), and the immunolocalization of steroidogenic proteins and testosterone. Pro-inflammatory (TNF-α, IL-1β, IL-6), anti-inflammatory (IL-10) cytokines, macrophages (CD68 and CD163) and macrophage inhibitory factor (MIF) were detected by immunolocalization and Western blot. The expression of lipid metabolism genes (Srebp, Dgat1 and Scarb1) were investigated by RT-qPCR.
Results:
In the infected animals, the Leydig cells showed enhanced immunolocalization of hACE2, spike and nucleocapsid. The expression of Rigi, pro-inflammatory cytokines and number of macrophages increased, confirming viral infection. Sf1 expression, steroidogenic proteins and testosterone were reduced whereas the expression of Dgat1, Srebp and Scarb1 increased. Lipid droplets-enriched Leydig cells and viral particles in lipids were observed. The infected Leydig cells also showed enhanced pro-inflammatory cytokines immunolabeling.
Conclusion:
SARS-CoV-2 infects Leydig cells, activates its immune response and impairs steroidogenesis. The virus uses the steroidogenic machinery and induces lipid metabolism pathways for its survival and replication in these cells. These findings support the low testosterone and HDL levels in men with severe COVID-19.
1 Introduction
SARS-CoV-2, the virus responsible for severe acute respiratory syndrome (COVID-19), infects various organs through its interaction with angiotensin-converting enzyme 2 (ACE2), the main receptor of this virus (). According to data from the Genotype-Tissue Expression Project, the testes exhibited the highest expression of ACE2 (), which was detected in the endothelium, peritubular myoid cells, spermatogonia, spermatocytes, spermatids, spermatozoa, Sertoli cells and Leydig cells (LCs) (; Navarra et al., 2020; Wang and Xu, 2020; ; Ribeiro et al., 2023; ).
The testis is an immunologically privileged organ due to mechanisms that protect interstitial and germ cells against pathogens (Reviewed by ). In the interstitial tissue, two distinct populations of macrophages were identified: 1) the recently recruited or transient CD68-positive macrophages (also called M1), characterized by the formation of reactive oxygen intermediates and the expression of pro-inflammatory cytokines (Wang et al., 2017; Zhu et al., 2022); 2) the resident population of CD163-positive macrophages (also called M2), which express anti-inflammatory cytokines, such as IL-10, and other factors (; ). These populations are regulated by macrophage inhibitory factor (MIF), which promotes the recruitment of macrophages and the functional polarization from M1 to M2 phenotype (; Pacheco-Fernández et al., 2019). In the testis, M2 macrophages are in close contact with LCs by cytoplasmic interdigitations (), establishing a crosstalk between these cells (). Studies have demonstrated that, under normal conditions, macrophages-derived cytokines play a role in the steroidogenic activity of LCs (; Reviewed by ; ).
During viral infections, the initial defense against RNA viruses comprises pattern recognition receptors (PRRs), which trigger innate immune responses (Reviewed by Rehwinkel and Gack, 2020). Among the PRRs, the cytoplasmic receptors RIG-I (retinoic acid-inducible 1) and MDA5 (melanoma differentiation-associated 5) play pivotal roles in the host’s antiviral response (; Thoresen et al., 2021), confirming the innate immune activation following viral infection (). The binding of RIG-I and MDA5 to viral RNA fragments induces their interaction with mitochondrial antiviral signaling protein (MAVS) (Thorne et al., 2021). This protein activates IKK-α/β/NF‐κB and IRF3/7 (Interferon Regulatory Factor 3 and 7) pathways, which induce the expression of cytokines and type I IFN genes, respectively (Zou et al., 2021).
During the Covid-19 pandemic, men were more vulnerable to the disease and had higher risk of developing severe forms of COVID-19 than women (Xie et al., 2020; ; Richardson et al., 2020). According to in vitro (; ) and in vivo (; ) studies, analysis of post-mortem testes from COVID-19 patients (; ; ) and literature reviews (Nassau et al., 2022; Ly et al., 2023; ). SARS-CoV-2 infects testicular cells, impairs the testicular structure and changes the testosterone levels, confirming the susceptibility of testes to SARS-CoV-2 infection in both patients and transgenic K18-hACE2 animal models (; ). Different single-stranded RNA viruses, such as hepatitis C virus (Sagan et al., 2006), picornavirus () and Zika virus (Stoyanova et al., 2023) have shown that these pathogens exploit lipid metabolism, remodeling cellular pathways to create viral replication platforms. SARS-CoV-2, a single-stranded RNA virus, remodels the host cell for its replication through the formation of replication organelles (ROs), which consist of double-membrane vesicles (DMVs) (; Soares et al., 2023). Moreover, SARS-CoV-2 can reprogram the host cell lipid metabolism, increasing and accumulating lipid droplets (LDs) in the cell cytoplasm. These LDs are used as a viral replication platform and viral assembly (; Soares et al., 2023).
The biosynthesis of testosterone by LCs is a complex steroidogenic process that depends on continuous cholesterol esters supply from LDs (Reviewed by Shen et al., 2016). In LCs, LDs are scattered throughout the cytoplasm or associated with mitochondria or surrounded by concentric layers of smooth endoplasmic reticulum (SER) cisternae, named spirally arranged cisternae (SAC) (Ohata, 1979; Mori et al., 1982). In LCs, LDs may be formed via SCAP/SREBP1 complex signaling, which induces: 1) endocytosis of high-density lipoprotein (HDL) through LDL receptor (LDLR) and HDL receptor (named scavenger receptor class B type I (SR-B1)), respectively (Shimizu-Albergine et al., 2016; ); and 2) lipogenesis via activation of diacylglycerol O-acyltransferase 1 (DGAT-1), a transmembrane enzyme located in SER that catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol, giving rise to LDs (Reviewed by Yen et al., 2008; Oresti et al., 2013). Thus, the initial step of steroidogenesis depends on the cholesterol transport via steroidogenic acute regulatory protein (StAR)-related lipid transfer protein 4 (StARD4) to the mitochondrial membrane (Reviewed by Miller, 2007). The cholesterol is internalized by StAR into the mitochondria, where the initial steps of steroidogenesis take place (Reviewed by Miller, 2007). Finally, in SER, androstenedione is converted into testosterone by 17β-HSD (; Wang et al., 2017). The critical regulator of steroidogenesis is the steroidogenic factor-1 (SF-1), a transcription factor and key regulator of genes that encode the steroidogenic enzymes (Sugawara et al., 1996; Manna et al., 2003). The steroidogenic process is susceptible to imbalance caused by different viral pathogens (Wu et al., 2016; Ma et al., 2016; Uraki et al., 2017), which can trigger an inflammatory process through the increase of cytokines. Under normal conditions, LCs are able to produce cytokines, such as TNF-α, IL-6, and IL-1β (Warren et al., 1990; ; Verhoeven et al., 1988; ; Semedo et al., 2022), which regulate steroidogenesis (Reviewed by ; ). However, under inflammatory conditions, high levels of cytokines impair LCs steroidogenesis and induce changes in the testis (Lysiak, 2004; ).
To evaluate the severe acute respiratory syndrome (SARS), caused by the novel coronavirus (SARS-CoV-1) during the 2003 epidemic, McCray et al. (2007) developed a transgenic mouse (K18-hACE2) that expresses the human angiotensin-converting enzyme 2 (hACE2) and allows either SARS-CoV-1 (McCray et al., 2007) or SARS-CoV-2 infection (Moreau et al., 2020). Thus, this model has been used for the evaluation of antiviral therapeutic agents, vaccines and for the comprehension of COVID-19 pathogenesis (; Rodrigues et al., 2022; ).
In the present study, we used SARS-CoV-2-infected K18-hACE2 transgenic mice to evaluate the immune response of testicular interstitial cells. To understand the cellular mechanisms involved in the virus-induced steroidogenic failure, the localization of the virus in the LCs and its relationship with steroidogenesis and lipid metabolism were investigated.
2 Materials and methods
2.1 Preparation of SARS-CoV-2 samples
The B1 strain of SARS-CoV-2 (Brazil/SPBR-02/2020 strain) was isolated from COVID-19 positive-tested patients at the Hospital of Ribeirão Preto of the University of São Paulo. The virus was propagated and titrated in Vero E6 cells under BSL-3 conditions at FMRP/USP (Ribeirão Preto, Brazil). Cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and antibiotic/antimycotic drugs (Penicillin 10,000 U/mL; Streptomycin10,000 μg/mL). The viral inoculum was added to Vero cells in DMEM incubated at 37°C with 5% CO2 for 48 h, and the cytopathogenic effect was observed under microscope. Cell monolayer was collected, and the supernatant was stored at -70°C. Virus titration was made by the plaque-forming units (PFU).
2.2 K18-hACE2 transgenic mice: treatment and viral inoculation
Male mice (Mus musculus) of the C57BL/6 lineage (background), genetically modified (K18-hACE2), were utilized in this study. These mice have been used as model for SARS-CoV-2-induced disease since the infected animal presents clinical signs, and biochemical and histopathological changes compatible with the human disease (; Rodrigues et al., 2022; ).
The animals were maintained and treated according to ARRIVE guidelines 2.0, and the protocol regarding the treatment of animals was approved by the Ethical Committee for Animal Research of Dental School, UNESP, Araraquara, São Paulo, Brazil (CEUA 021/2021).
Twenty K18-hACE2 mice, aged 12 weeks, were sourced from the Jackson Laboratory and bred at the Animal Special Breeding Center at the FMRP/USP. These animals were kept in the vivarium of the Center for Research in Virology II under 12h light and 12h dark cycle at controlled temperature (23 ± 2 °C) and humidity (65-75%), with water and food ad libitum. In a Biosafety Levels 3 laboratory (BSL3) at the FMRP/USP, the animals were divided into 2 groups: control group (CG; n=10) and infected group (IG; n=10). The animals of IG were inoculated with 5x104 PFU of SARS-CoV-2 (in 40 μL) by intranasal route while the control mice were inoculated with DMEM. The animal’s weight and clinical signs were evaluated daily. It is important to emphasize that, according to previous studies (Moreau et al., 2020), the 5-day period of infection is the maximum period supported by the animal without suffering.
2.3 Histological procedures
After the fifth day of infection, the animals were anesthetized with 80 mg/kg BW of ketamine hydrochloride (Francotar, Virbac do Brasil Ind. Com. Ltda, Jurubatuba, Brazil, Reg.MA: 7.885) and 8 mg/kg BW of xylazine hydrochloride (Virbaxyl; Virbac do Brasil Ind. Com. Jurubatuba, Brazil, Reg.MA:7.899), and fragments of the left testes were collected and frozen at -80°C for molecular analysis or fixed in Karnovsky’s solution (as described below) for analysis under the transmission electron microscope (TEM). The right testes were fixed for 48 hours in 4% formaldehyde solution (Merck ERK, Germany) buffered with 0.1M sodium phosphate (pH 7.4), dehydrated in increasing concentrations of ethanol and embedded in historesin or paraffin. The sections were stained with H.E. for morphological and morphometric analyses. The paraffin sections were also adhered to silanized slides and submitted to immunohistochemistry and immunofluorescence analyses as described below.
2.4 Transmission electron microscopy
The samples were fixed for 16 hours in a solution containing 4% formaldehyde (Merck ERK, Germany) and 5% glutaraldehyde buffered with 0.1 M sodium cacodylate (pH 7.2) (Sasso-Cerri and Cerri, 2008). After washing in 0.1M sodium cacodylate (pH 7.2), the specimens were transferred to a 1% osmium tetroxide solution buffered with 0.1 M sodium cacodylate at pH 7.2 for 1 hour. After washings with distilled water, the specimens were immersed in 2% aqueous uranyl acetate for 1.5 hours, dehydrated in increasing concentrations of ethanol, treated with propylene oxide and then embedded in Araldite resin.
The Araldite polymerization was performed in an incubator oven at 56°C for 72 hours, and the semithin sections were obtained from an ultramicrotome (Ultracut UCT, Leica), and stained with 1% toluidine blue to select the area of interest. The blocks were trimmed, and the ultrathin sections were collected on 200–300 mesh copper grids. The ultrathin sections were contrasted with an alcoholic solution of 2% uranyl acetate for 15 minutes and lead citrate. The ultrathin sections were examined in a transmission electron microscope FEI (TECNAI G2 Spirit, FEI Company) of the Biosciences Institute of UNESP-Botucatu (São Paulo, Brazil).
2.5 Nuclear area of Leydig cells
Six animals per group were used, and the analyses were performed using a DP-71 camera (Olympus, Tokyo, Japan) attached to an Olympus BX-51 microscope (Tokyo, Japan).
In non-serial HE-stained testicular sections, twenty fields of interstitial tissue per animal were randomly selected. In each field, the minor and major diameters of five LC nuclei were measured, totaling 100 LCs/animal under 400x. Typical LC nuclei showing ovoid shape and punctate peripherical chromatin were measured using an image analysis system (Image Pro-Express 6.0, Olympus). The nuclear area was calculated using the formula for obtaining the area of an ellipse: A=πab (a=length of the semi-major axis; b=length of the semi-minor axis).
2.6 Immunohistochemistry and immunofluorescence analyses
CD68 (ED1 macrophage marker) and CD163 (ED2 macrophage marker) were detected by immunohistochemistry. StAR (steroidogenic acute regulatory protein), 17β-HSD (steroidogenic enzyme), testosterone, IL-1β, TNF-α and IL-6 (pro-inflammatory cytokines), hACE2 (human angiotensin-converting enzyme 2), spike and nucleocapsid proteins (viral proteins) were detected by immunofluorescence.
Sections were immersed in 0.001 M citrate buffer (pH 6.0) and heated at 95°C in a microwave oven for 30 min for antigen recovery. For detection of CD68 and CD163 by immunohistochemistry, the sections were previously immersed in 2% hydrogen peroxide for endogenous peroxidase inactivation. All sections were incubated in 2% BSA for 30 minutes, and incubated at 4°C overnight with the following primary antibodies (Table 1): anti-CD68 polyclonal antibody; anti-CD163 monoclonal antibody; anti-StAR polyclonal antibody; anti-17β-HSD6 polyclonal antibody; anti-testosterone polyclonal antibody; anti-IL-1β polyclonal antibody, anti-IL-6 polyclonal IgG, anti-TNF-α monoclonal [52B83] antibody, anti-human ACE2 monoclonal antibody, anti-SARS-CoV-2 Spike Protein S1 and anti-SARS-CoV-2 nucleocapsid protein antibody. Sections incubated with anti-CD68 and anti-CD163 antibodies (Table 1) were washed in PBS and incubated at room temperature with biotinylated anti-mouse or anti-rabbit IgG secondary antibody and peroxidase-labeled-streptavidin (Universal Dako LSAB Kit, Dako Inc., Carpinteria, CA, USA). The sections were stained with 3.3’-diaminobenzidine (DAB: Dako Liquid DAB+Substrate Chromogen system, Dako Inc., Carpinteria, CA, USA), counterstained with Carazzi’s hematoxylin and mounted with Permount® resin mounting medium. The testicular sections subjected to immunofluorescence reaction were washed in PBS and incubated in the dark with the following secondary antibodies (Table 1): Alexa Fluor®594 anti-rabbit antibody, Alexa Fluor®488 anti-mouse IgG antibody and Alexa Fluor®641 anti-donkey polyclonal antibody for 1 hour at room temperature. After washing in PBS, nuclear staining was performed with DAPI (Molecular Probes by Life Technologies; Carlsbad, CA, USA) for 5 min in the dark at room temperature, and the slides were mounted with Fluoromount® mounting medium (Dako Inc., Carpinteria, CA, USA) or Fluro-Gell III Mounted Medium® (Electron Microscopy Sciences). To check for possible unspecific binding of the secondary antibodies to the tissues, negative controls were performed by incubating sections with non-immune serum instead of primary antibodies.
Table 1
| Antibody name | Dilution | Catalog number | Manufacturer | RRID |
|---|---|---|---|---|
| Mouse anti-ACE2 monoclonal antibody | 1:50 | sc-73668 | Santa Cruz Biotechnology, USA | AB_2861379 |
| Rabbit anti-SARS-CoV-2 Spike Protein S1 Recombinant monoclonal antibody | 1:250 | MA5-36247 | Invitrogen by Thermo Fisher Scientific | AB_2890589 |
| Rabbit anti-SARS-CoV-2 nucleocapsid protein monoclonal antibody | 1:3000 | ab271180 | Abcam, Cambridge, UK | – |
| Rabbit anti-IL-1β polyclonal antibody | 1:400 | ab9722 | Abcam, Cambridge, UK | AB_308765 |
| Goat anti-IL-6 (M19) polyclonal antibody | 1:400 | sc-1265 | Santa Cruz Biotechnology, USA | AB_2127470 |
| Mouse anti-TNF-α monoclonal [52B83] antibody | 1:200 | ab1793 | Abcam, Cambridge, UK | AB_302615 |
| Rabbit anti-CD163 monoclonal antibody | 1:100 | ab182422 | Abcam, Cambridge, UK | AB_2753196 |
| Rabbit anti-CD68 polyclonal antibody | 1:100 | ab125212 | Abcam, Cambridge, UK | AB_10975465 |
| Rabbit anti-17β-HSD6 polyclonal antibody | 1:500 | sc-393936 | Santa Cruz Biotechnology, USA | AB_2891064 |
| Rabbit anti-StAR polyclonal antibody | 1:1000 | PAS-95765 | Invitrogen by Thermo Fisher Scientific | – |
| Mouse anti-testosterone polyclonal antibody | 1:100 | ab217912 | Abcam, Cambridge, UK | AB_308765 |
| Rabbit anti-IL-10 polyclonal antibody | 1:500 | sc-8438 | Santa Cruz Biotechnology, USA | AB_627793 |
| Rabbit anti-MIF polyclonal antibody | 1:200 | 251415 | ABBIOTEC, USA | AB_10636927 |
| Rabbit anti-β-tubulin monoclonal antibody | 1:8000 | ab108342 | Abcam, Cambridge, UK | AB_10866289 |
| HRP-conjugated anti-rabbit secondary antibody | 1:9000 | A9169 | Sigma-Aldrich, USA | |
| Alexa Fluor®488 anti-mouse antibody | 1:1000 | ab150113 | Abcam, Cambridge, UK | AB_2576208 |
| Alexa Fluor®488 anti-rabbit antibody | 1:1000 | ab150077 | Abcam, Cambridge, UK | AB_2630356 |
| Alexa Fluor®594 anti-mouse antibody | 1:1000 | ab150116 | Abcam, Cambridge, UK | AB_2650601 |
| Alexa Fluor® 647 anti-rabbit antibody | 1:1000 | ab150075 | Abcam, Cambridge, UK | AB_2752244 |
| Alexa Fluor®647 anti-goat antibody | 1:1000 | ab150135 | Abcam, Cambridge, UK | AB_2687955 |
Primary and secondary antibodies.
2.6.1 Number of CD68+ and CD163+ macrophages
In four non-serial testicular sections per animal (n=6), 20 fields of interstitial tissue were randomly captured under an Olympus BX-51 microscope (Olympus, Tokyo, Japan) equipped with a camera DP-71 (Olympus, Tokyo, Japan), at 400x. In these fields, a standardized area of interstitial tissue per animal was measured using Image-Pro Express® software (Olympus, Tokyo, Japan). In this area, the number of CD68- and CD163-positive macrophages was quantified, and the number of CD68 and CD163 macrophages per µm2 of interstitial tissue was calculated.
2.6.2 Analysis of the immunofluorescent area
Immunofluorescent areas were analyzed using DFC 550 Camera (Leica, Germany) attached to a BM4000 B LED microscope (Leica, Germany) and the Leica Application Suite software (LAS 4.3, Leica, Germany). The StAR, 17β-HSD, testosterone, IL-1β, TNF-α and IL-6 immunofluorescent areas were measured at 400x. All parameters of the software, including exposure, gain and saturation as well as the threshold adjustment and color range were rigorously standardized for each immunolabeling analyzed so that only areas with intense red or green fluorescence were measured.
In four non-serial testicular sections per animal (n=6), the immunofluorescent area of each marker was measured in a total standardized area of interstitial tissue per animal, and the respective areas/mm² of interstitial tissue were calculated.
2.7 Double immunofluorescence analysis
To confirm the presence of SARS-Cov-2 in the testicular cells and hACE2 by immunolocalization, a double immunofluorescence staining was performed to detect hACE2 and spike in the same section. Moreover, to confirm if the LCs express an inflammatory profile, double immunofluorescences for detection of 17β-HSD6+IL-6, 17β-HSD6+IL-1β and StAR+TNF-α were also performed. The double immunofluorescence reactions were performed according to . After antigen recovery, the sections were incubated overnight at 4°C with the following primary antibodies (Table 1): anti-human ACE2 monoclonal antibody, anti-17β-HSD6 polyclonal antibody or anti-StAR polyclonal antibody. The day after, the sections were washed and incubated with Alexa Fluor®488 anti-mouse antibody or Alexa Fluor®594 anti-rabbit IgG antibody (Table 1) for 1 hour at room temperature. After washing in PBS, the sections were incubated overnight at 4°C with the following antibodies (Table 1): anti-SARS-CoV-2 Spike Protein S1, anti-IL-6 polyclonal antibody, anti-IL-1β polyclonal antibody and anti-TNF-α monoclonal antibody. The day after (third day), the sections were washed in high salt PBS and incubated in Alexa Fluor®594 anti-rabbit IgG antibody, Alexa Fluor®641 anti-donkey polyclonal antibody or Alexa Fluor®488 anti-mouse antibody (Table 1) for 1 hour at room temperature. After washing in PBS, nuclear staining was performed with DAPI for 5min in the dark at the room temperature, and the slides were mounted with Fluoromount® mounting medium. Negative controls were performed following the same protocol and steps, except that the primary antibodies were replaced by non-immune serum. Immunofluorescence was analyzed using DFC 550 Camera (Leica, Germany) attached to a BM4000 B LED microscope (Leica, Germany) and the Leica Application Suite software (LAS 4.3, Leica, Germany). The immunofluorescence labeling in green (17β-HSD), red (IL-6) and yellow (resulted from the overlay of green and red fluorescence) were quantified. All software parameters, including exposure, gain, saturation as well as threshold and color range adjustments were rigorously standardized for each immunolabeling analyzed so that only areas with intense yellow fluorescence were computed. In the non-serial testicular sections, the immunofluorescent area for each marker was measured in a standardized total area of interstitial tissue per animal, and the immunofluorescent areas of 17β-HSD, IL-6 and 17β-HSD+IL-6/mm² of interstitial tissue were calculated for each animal.
2.8 Western Blot
Frozen testes samples (n=4) were homogenized with lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 5 ng/mL of each protease inhibitor: Pepstatin, Leupeptin, Aprotinin Table 2, Antipain and Chymostatin (Sigma-Aldrich, code: P834-1ML, lot: #014M4024V)) and maintained overnight at 4°C. After centrifugation for 20 min at 8,944g, the supernatant was collected and the measurement of protein concentration was performed by Bradford (Sigma-Aldrich, EUA) assay. Protein samples (30µg) were separated in 12% or 20% SDS-PAGE and transferred to a nitrocellulose membrane 0.2µm (Bio-Rad Laboratories, USA). The membranes were treated for 1h with blocking solution containing 5% non-fat dry milk diluted in PBS/T (PBS/0.2% Tween 20) for nonspecific blocking and incubated overnight at 4°C with the following primary antibodies (Table 1): anti-MIF polyclonal IgG antibody and anti-IL-10 polyclonal IgG antibody diluted in blocking solution. After washes in 6 M urea buffer and 0.2% PBS/T, the membranes were incubated with HRP-conjugated anti-rabbit secondary antibody, diluted in blocking solution for 1h at room temperature. The reactions were detected using enhanced chemiluminescence system (ECL Plus, Boster Bio, USA).
Table 2
| Gene | NCBI access no: | Length (bp) | Oligonucleotides sequences (5’-3’) | Tm |
|---|---|---|---|---|
| Human Ace2 | NM_001371415.1 | 21 | F: GCTAGTCGACAGTGGGGAAAC | 60,0° |
| (Exxtend, Brazil) | 21 | R: TGTCCTTGCCCTTATATAGTTCC | 56,0° | |
| Mouse Ace2 | NM_001130513.1 | 20 | F: GGACTAAGCCATGCAGGAAG | 57,0° |
| (Exxtend, Brazil) | 22 | R: TGCAAAGAAAGGAGTCATTCAC | 54,0° | |
| Rigi | NM_172689.3 | 22 | F: GGCAAGGGAACTGAAAACCATC | 58,0° |
| (Exxtend, Brazil) | 20 | R: AAGCCGCACTTTCTGGTAGA | 55,0° | |
| Dgat-1 | NM_010046.4 | 21 | F: GAGGGGAAGACACAGAAGCTC | 60,0° |
| (Exxtend, Brazil) | 21 | R: GTGTGTGCGCTCTCTCTCAAA | 58,0° | |
| Scarb1 | NM_016741.2 | 23 | F: CAGCCTGACAAGTCGCATGGCTC | 63,0° |
| (Exxtend, Brazil) | 22 | R: AAAAGCACGCTGGCCCATGGTG | 61,0° | |
| Srepb1 | 20 | F: TAGAGCATATCCCCCAGGTG | 57,0° | |
| (Exxtend, Brazil) | 20 | R: GGTACGGGCCACAAGAAGTA | 57,0° | |
| Sf1/Nr5a1 | NM_001316687.1 | 20 | F: TCTTGTCCTCCCCACAACCTG | 58,0° |
| (Exxtend, Brazil) | 20 | R: GAGAGGTTCGCTGTGCTAGG | 60,0° | |
| β-Actin | NM_007393.5 | 18 | F: CTGCGCTTCCTTTGTCCC | 57,0° |
| (Exxtend, Brazil) | 20 | R: GACAATTGAGAAAGGGCGTG | 55,0° |
Sequence of primers used in qPCR.
As positive controls, the membranes were stripped and re-probed with anti-β-tubulin monoclonal antibody (Table 1). The assays were performed in triplicate for CG and IG.
All bands were identified in Ponceau-stained membranes. The optical density (OD) of the band intensities of each lane (total protein) and the OD of the proteins of interest were quantified using Image Lab software (version 5.2.1, Bio-Rad). The results were obtained according to the normalized data using GraphPad Prism® 8.3.4 software (GraphPad Software, CA, USA).
2.9 Reverse transcription and real-time polymerase chain reaction
The primers design was performed using the murine sequences available at the University of California, Santa Cruz (UCSC) Genome Browser and the Primer3 program (Untergasser et al., 2012) (Table 2).
Testis fragments (n=4) were collected and immersed in RNA Keeper stabilizing reagent (LGC Biotecnologia, Cotia, Brazil; 14-0002-01) and stored at -80°C. Testis RNA was isolated and purified using Aurum Total RNA Mini Kit (Bio-Rad Laboratories, Hercules, CA, USA; 732-6820). The cDNA was obtained using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cheshire, UK; 4368814) according to the manufacturer’s protocol. The real-time PCR was performed using the QuantStudio 3 Real-Time PCR instrument (Applied Biosystems, ThermoFisher; Life Technologies Holdings) and the PowerUp SYBR Green Master Mix (Applied Biosystems, Cheshire, UK; A25742). The qPCR cycling conditions were as follows: 40 cycles of denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 1 min, and a final extension step with ramp rate 0,15°C/second at 95 °C for 1 5s. For gene expression analysis, the results were reported as mean ± SD, using the formula ΔCt = [Ct target gene–Ct housekeeping gene β-actin]. Relative expression is derived from log(2^–ΔΔCt), where ΔΔCt = ΔCt testes of IG – mean of ΔCt control group.
2.10 Statistical analysis
For the morphometric and immunofluorescence/immunohistochemistry analysis, 6 mice per group were used. For the Western blot and qPCR, 4 animals per group were used, and the experiments were performed in triplicate and duplicate, respectively. The data were checked for normal distribution by the Kolmogorov and Smirnov’s normality test and, according to the data distribution. Statistical comparisons were performed using Student’s t test, assuming significance at p ≤ 0.05, using the GraphPad Prism® 4.3 software (GraphPad Software, CA, USA). The results were expressed as box and whiskers plots.
3 Results
3.1 Detection of hACE2 and spike protein (S1) in the testicular cells of the K18-hACE2 transgenic mice
hACE2 was detected in seminiferous tubules and in the interstitial tissue in both groups (Figures 1A–E), whereas S1, as expected, was observed only in IG (Figures 1B, D, E). In this group, S1 immunofluorescence was observed in the epithelial cells (Figure 1B) and in the interstitial cells, including in the LCs (Figures 1D, E). In the human testis, evident hACE2 immunofluorescence was also observed in the Leydig cells (Figure 1F), similarly to the transgenic mice, confirming the reaction specificity. The hAce2, mAce2 and Rigi mRNA expression increased 6-fold, 9-fold and 5-fold, respectively, (p=0.0021; p=0.0383; p=0.0014) in IG compared to CG (Figures 1G–I).
Figure 1
The double 17β-HSD and S1 immunofluorescence showed typical 17β-HSD immunofluorescence in the LCs of CG (Figure 1J) whereas, in IG, this double immunofluorescence confirmed the co-localization of S1 in the LCs (Figure 1K). S1 immunofluorescence was also observed in other interstitial cells, probably macrophages (Figure 1K).
3.2 SARS-CoV-2 activates macrophages and increases cytokines and MIF in interstitial tissue
In the interstitial tissue of testes of animals from the CG and IG, CD68 and CD163- immunolabeled macrophages (Figures 2A–D) were found in CG and IG. However, in IG, a high incidence of CD68+ and CD163+ macrophages (Figures 2B, D) were found compared to CG (Figures 2A, C). The quantitative analysis confirmed a significant increase (p=0.0001) in the number of CD68 and CD163- immunolabeled macrophages (2.3-fold and 1.7-fold, respectively) in IG compared to CG (Figures 2E, F). The analysis by Western blot showed a weak signal of MIF protein levels in CG; however, this factor increased 1.7-fold (p=0.0272) in IG (Figure 2G).
Figure 2
In testicular sections from both CG and IG groups, IL-1β, TNF-α and IL-6 immunoexpression were detected in the interstitial cells (Figures 3A–F). However, an intense immunoexpression for these cytokines was observed in the interstitial cells of the IG animals (Figures 3B, D, F) when compared to CG (Figures 3A, C, E). The immunofluorescent area of IL-1β, TNF-α and IL-6 increased 1.7-fold, 2-fold and 1.9-fold, respectively, (p=0.0001) in IG compared to CG (Figures 3G–I). The analysis by Western blot showed a weak signal of IL-10 protein levels in CG in comparison to 1.8-fold increase (p=0.0111) in the levels of this protein in IG (Figure 3J).
Figure 3
3.3 Infection by SARS-CoV-2 impairs LCs structure and steroidogenesis
In H.E.-stained testicular sections of CG, the seminiferous tubules and interstitial tissue showed organized epithelial histoarchitecture and typical interstitial cells, respectively (Figure 4A). However, in IG, the seminiferous tubules showed numerous intraepithelial spaces (Figure 4B).
Figure 4
Either in CG or IG, typical steroidogenic organelles were found in the Leydig cells, including lipid inclusions and the smooth endoplasmic reticulum forming spirally arranged cisternae (SAC). In both H.E.-stained sections and semithin sections, the CG exhibited typical LCs with round/ovoid nucleus (Figure 4C), lipid droplets and SAC (Figures 4C, E). However, in IG, these cells showed irregular and reduced nucleus (Figure 4D), numerous lipid droplets filling the cytoplasm (Figures 4D, F) and the SAC were apparently smaller than in CG (Figures 4E, F). The nuclear area of the LCs was significantly reduced in IG animals (p=0.0001) when compared to CG (Figure 4G). The analysis by RT-qPCR showed that Srebp1, Dgat-1 and Scarb1 gene expression increased 2.6-fold, 2.2-fold and 1.2-fold, respectively, in IG compared to CG (Figures 4H–J).
Under TEM, the cytoplasm of the LCs showed mitochondria and SAC, delimiting lipid droplets in both CG and IG groups (Figures 5A–C). In IG, numerous lipid droplets were filling the cytoplasm; some of them were larger than those of CG (Figures 5A–C). The SAC were apparently smaller in IG than those of CG, and an electron opaque granular material was usually found in the central core of these whorls (Figures 5D, H). This granular material showed electron opaque structures similar to nucleocapsid (Figures 5D–G, 6A, F, G), as well as spheroid structures measuring around ~140nm, similar to viral particles (Figure 5H).
Figure 5
Figure 6
In some interstitial regions of IG, LCs with atypical nucleus were found (Figure 6A). These cells showed irregular dilations of the nuclear membrane; due to folding, some of them were seen in cross section (Figure 6B). Double-membrane vesicles were also observed next to the nucleus. In some of them, enveloped viral particles measuring around 120nm were observed. In these viral particles, electron opaque structures similar to nucleocapsid were also found (Figure 6B).
In IG, nucleocapsid protein immunolabeling was observed surrounding the lipid droplets, within and/or in close contact with the nuclei and/or as immunofluorescent masses through the cytoplasm (Figures 6C–E). These findings were similar to those observed under TEM, which showed electron opaque granular material containing nucleocapsid proteins in the periphery of lipid droplets and in the core of SAC (Figures 6F, G).
LCs in close contact with macrophages containing lysosomes were also usually observed in IG (Figure 7A). In the cytoplasm of these LCs, small or large double membrane vesicles containing enveloped viral particles were found (Figures 7B–D, F). In the SAC core, small and large lipid inclusions were fusing with each other (Figure 7E). Electron opaque material and viral particles measuring around 100nm were also observed in these lipid droplets (Figure 7E). In the macrophages, coated vesicles (Figures 7A, G–I) were also found and could be differentiated from the viral particles (Figures 7B, C, E, F).
Figure 7
In the testicular sections of animals from both CG and IG groups, StAR, 17β-HSD and testosterone immunoexpression was detected in the LCs cytoplasm. However, the immunoexpression of these markers was weaker in IG (Figures 8B, D, F) than in CG (Figures 8A, C, E). This finding was confirmed by the significant reduction (65%, 47% and 56%, respectively) of the immunofluorescent areas of StAR, 17β-HSD and testosterone (p=0.0001) in IG (Figures 8G–I). The steroidogenic factor-1 (Sf1) mRNA expression also reduced (74%; p=0.0017) in IG when compared to CG (Figure 8J).
Figure 8
3.4 Immunoexpression of TNF-α, IL-6 and IL-1β in infected LCs
Either in CG or in IG, the interstitial tissue showed StAR or 17β-HSD-immunolabeled LCs, in green fluorescence, as well as TNF-α, IL-1β and IL-6 in other interstitial cells (macrophages), in red fluorescence. The co-localization of these cytokines with steroidogenic proteins (yellow fluorescence) was also detected in the LCs (Figures 9A–F). Notably, in IG, in parallel to the reduction of LCs markers (StAR and 17β-HSD; green fluorescence), an evident increase was noted in the cytokines-immunolabeled interstitial cells (in red) and in the co-localized StAR+TNF-α, 17βHSD+IL-1β and 17βHSD+IL-6 immunolabeling (yellow fluorescence), when compared with CG (Figures 9B, D, F). The measurement of the co-localized immunofluorescent areas confirmed that 17β-HSD+IL-6 immunolabeling increased 1.3-fold (p=0.0001) in IG compared to CG (Figure 9G).
Figure 9
4 Discussion
In this study, the testes of the transgenic mice K18-hACE2 expressed human Ace2 (hACE2) and were infected by SARS-CoV-2. Although some studies have demonstrated SARS-CoV-2 virus particles in the LCs, the subcellular localization of the virus and the structural and functional changes of these cells in response to the viral infection have been poorly addressed. In the LCs of animals from the IG, assembled viral particles and/or nucleocapsid proteins were observed in close contact or within lipids droplets and spirally arranged cisternae, confirming a tropism of SARS-CoV-2 for LC steroidogenic machinery. Indeed, the infection induced a significant reduction of steroidogenesis and Sf-1 downregulation (Figure 10). In contrast, the high concentration of lipids droplets in the infected LCs, in association with Srebp1, Dgat1 and Scarb1 overexpression, indicated increased lipogenesis and cholesterol uptake (Figure 10). These findings confirm that SARS-CoV-2 exploits the LCs machinery and the lipid metabolism pathways in favor of its replication. The intense immunoexpression of cytokines in these hypofunctional steroidogenic cells suggests a transition of these cells to an immunological phenotype to eliminate the virus.
Figure 10
4.1 SARS-CoV-2 infects testicular cells
In addition to the testicular expression of hACE2, an enhanced immunolocalization of hACE2 was observed in the interstitial cells and seminiferous epithelium of the transgenic K18-hACE2 mice, corroborating previous findings (; Navarra et al., 2020; Wang and Xu, 2020; ; Ribeiro et al., 2023; ). High levels of ACE2 have been demonstrated in human Leydig cells (Wang and Xu, 2020). This finding agrees with our results since enhanced hACE2 immunoexpression was observed in the Leydig cells of the non-infected transgenic mice, confirming that this cell type is susceptible to infection. It is important to emphasize that mAce2 was also expressed in the testes of the transgenic mice, confirming that the expression of hAce2 did not interfere in the expression of mAce2. In IG, either hACE2 or mACE2 expression increased significantly, confirming that the testicular tissues were infected by the virus. The increased expression of both viral recognition sensor (Rigi) and TNF-α corroborates this finding since studies have shown that ACE2 expression is upregulated by cytokines as well as by the activation of pathways triggered by viral sensors (Zhuang et al., 2020; ).
Although spike and nucleocapsid proteins were detected in the testicular sections by immunofluorescence, the ultrastructural analyses under TEM were essential to confirm the presence of viral particles in the LCs as well as to better understand their association with the steroidogenic hypofunction. For the identification of the viral particles, we considered several major criteria, such as the presence of nucleocapsid proteins, which may be surrounded by an envelope in case of assembled virus, the size of assembled virus (60 to 150 nm) and the presence of double membrane vesicles (DMVs) (Revised by ; Revised by ). Indeed, all these structures were found in the LCs of IG animals, including the presence of DMVs containing assembled viral particles measuring around 120nm. Similar findings were also observed in the LCs of post-mortem testes from COVID-19 patients (; ; ). In the present study, in addition to DMVs, we also observed nucleocapsid proteins in the lipid droplets, spirally arranged cisternae and in the nuclear membrane dilations of LCs under TEM. Most of these findings were confirmed by the immunolocalization of nucleocapsid protein, indicating that the virus seems to hijack the LCs and exploit their cellular structures for its replication.
4.2 SARS-CoV-2 activates testicular macrophages recruitment and the production of cytokines
According to , an increased number of macrophages in the testes is associated with testicular inflammation since macrophages produce high levels of cytokines and impair testicular function (Lysiak et al., 2003; Lysiak, 2004; ). Post-mortem testes of COVID-19 individuals showed increased number of CD68 macrophages (; ). The recruitment of M1 (CD68) macrophages and the functional polarization of these cells to M2 (CD163) macrophages are induced by MIF (; Pacheco-Fernández et al., 2019). In the present study, a significant increase in the number of M1 macrophages was also found in the infected animals; this finding is corroborated by the high MIF protein levels as well as by the intense immunoexpression of IL-1β, TNF-α, and IL-6, the main pro-inflammatory cytokines produced by M1 macrophages under inflammatory conditions (). In addition to M1, a significant increase in the number of M2 macrophages was also observed in IG, suggesting a possible polarization of M1 to M2 macrophages, likely due to high MIF levels. Since M2 macrophages produce IL-10 under normal conditions (), preventing a detrimental immune response against infections (), it is possible that the increased number of these cells and the high IL-10 levels, observed in IG, are related to the maintenance of testicular homeostasis, ensuring the pathogen elimination.
Studies have demonstrated that RIG-I activation induces an inflammatory response in infected testes (Zhu et al., 2013; Wu and Chen, 2014; Wu et al., 2016). Indeed, the significant increase in Rigi expression, in IG, corroborates SARS-CoV-2 infection in testicular cells as well as enhanced immunoexpression of IL-1β, TNF-α and IL-6 (Figure 10). Our data are supported by the findings of , which demonstrated overexpression of IL-1β, TNF-α, and IL-6 mRNA levels in the testes of SARS-CoV-2-infected K18-hACE2 animals.
4.3 SARS-CoV-2 infection impairs LCs steroidogenic activity
Our results showed a considerable immunoexpression of cytokines (TNF-α, IL-6, and IL-1β) in the interstitial cells of control animals, corroborating previous studies which confirmed that these cytokines regulate steroidogenesis under physiological conditions (Reviewed by ; ). However, the viral infection impaired steroidogenic activity in the testes of the K18-hACE2 mice. In vivo and in vitro studies have demonstrated that high levels of cytokines impair the steroidogenic cascade, inhibiting the expression of key proteins such as StAR, 3β-HSD, and 17β-HSD/P450c17 (; ; Soliman et al., 2021). In vitro studies have shown that TNF-α impairs testosterone production by LCs and decreases mRNA levels of CYP11A1 and CYP17A1 (Xiong and Hales, 1993; ). According to Samir et al. (2017), TNF-α and IL-6 inhibit androgen secretion through CYP17A1 cytochrome P450 and luteinizing hormone/choriogonadotropin receptor (LHCGR) mRNA downregulation. Moreover, TNF-α reduces the expression of INSL3 (insulin like 3), HSD3B1 (3 beta- and steroid delta-isomerase 1) and NOS3 (Nitric Oxide Synthase 3) while IL-6 reduces the expression of LHCGR and StAR (Samir et al., 2017). IL-6 also reduces the release of androgens due to Sf-1 downregulation (McIlmoil et al., 2015; ). Our findings showed enhanced TNF-α, IL-6, and IL-1β immunoexpressions in association with significant reduction in the immunoexpression of testosterone, StAR, and 17β-HSD along with the downregulation of Sf1 gene, corroborating the anti-androgenic effect of these pro-inflammatory cytokines in the LCs (Figure 10). Several studies have demonstrated reduction in the testosterone levels of COVID-19 patients (; Salonia et al., 2021; ). Moreover, in the testis of patients who died from COVID-19, the levels of StAR, 3β-HSD, and 17β-HSD were significantly reduced and associated with low intratesticular testosterone levels (), corroborating our findings.
4.4 SARS-CoV-2 uses LC steroidogenic machinery and induces lipogenesis for its own replication
The interruption of steroidogenesis, observed in IG, was associated with a notable presence of lipid droplets in the cytoplasm of LCs. According to , the SF-1 deficiency causes lipid droplets accumulation in LCs due to suppression of the steroidogenic proteins StAR and CYP11A1. The treatment of mice with diethylcarbamazine also reduces testosterone and induces a high concentration of lipid droplets in the cytoplasm of Leydig cells (Saraiva et al., 2006, 2008). Therefore, the accumulation of lipid droplets is caused by blockade of steroidogenesis, including the mobilization of cholesterol, which is re-esterified and stored in lipid droplets (Saraiva et al., 2006). These data corroborate our findings, indicating that the lipid accumulation observed in the LCs of the animals from the IG may be, at least in part, due to impaired steroidogenic activity. On the other hand, in vitro studies have confirmed that coronavirus plays a role in lipid metabolism (Yan et al., 2019), and lipid droplets accumulation has been detected in SARS-CoV-2-infected Vero E6 cells and type II pneumocytes of lung tissues from COVID-19 patients (Nardacci et al., 2021). SARS-CoV-2 virus optimizes its replication through the formation of Replication organelles (ROS) named DMVs in infected cells (Nardacci et al., 2021), and approximately 40% of the ROs are in close contact to lipid droplets, whose fatty acids are derived from the smooth endoplasmic reticulum, a crucial organelle for the biogenesis of DMVs (Ricciardi et al. (2022). These processes depend on the production of phospholipids through the activation of several pathways and genes (Reviewed by ), including lipogenic genes, such as Dgat1 (Reviewed by ). In Calu-3 cells, lipid droplets are involved in the SARS-CoV-2 infectious cycle based on the concept that the nucleocapsid protein drives Dgat-1 and Dgat-2 expression, promoting lipid droplets formation (Yuan et al., 2021). Therefore, SARS-CoV-2 is able to reprogram lipid metabolism via Dgat1, leading to accumulation of lipid droplets, which have been used by the virus as a viral assembly platform ().
Under TEM, the LCs of IG showed nucleocapsid-like proteins surrounding lipid droplets, and SAC were circumscribing a central region containing a thin granular material containing nucleocapsid-like proteins. Moreover, viral particles were found surrounding or within lipid droplets. To confirm if the infection induced lipogenesis, the expression of Dgat1 was evaluated, and the overexpression of this gene reinforced the idea that lipid droplets are not only accumulated due to steroidogenic blockade but are also derived from “de novo” lipogenesis activated by the viral infection. Since lipogenesis depends on the cholesterol supply via endocytosis through the receptors LDLR and HDLR (Shimizu-Albergine et al., 2016; ), we evaluated the expression of Srebp1 and Scarb1 genes, which encodes, respectively, the transcription factor SREBP (regulator of biosynthesis and uptake of cholesterol and fatty acids) and HDLR. Indeed, the testis of animals from the IG showed significant overexpression of Srebp and Scarb1. These findings corroborate previous studies, which have shown that SCAP/SREBP accelerates the accumulation of cholesterol in cells by increasing intracellular cholesterol biosynthesis (; Soares et al., 2023), a crucial step for SARS-CoV-2 replication (). Moreover, either Srebp knockdown or the inactivation of SREBP inhibits SARS-CoV-2 replication and lipid droplets formation in Calu-3 cells (). Therefore, our findings show that SARS-CoV-2 exploits lipid metabolism pathways in the LCs through the activation of SCAP/SREBP-1, which triggers Scarb1 and Dgat1 overexpression, culminating in cholesterol endocytosis and lipogenesis (Figure 10).
It is important to emphasize that clinical studies have demonstrated that serum HDL levels reduce drastically, compared to LDL, in men with high risk of death by COVID-19 (; ). Moreover, this pattern was more prevalent in men than in women (Parra et al., 2023). In this context, in addition to the consumption of cholesterol (HDL) by cells of diverse organs, such as hepatic cells as well as adrenocortical cells, which produce high levels of cortisol in severe Covid-19 patients (Tan et al., 2020), we can suggest that the vulnerability of male patients to Covid-19 may be related, at least in part, to the susceptibility of testes to infection due to: 1) the high levels of ACE2 in the testicular cells (; ) and 2) the presence of lipid-rich LCs containing a well-developed steroidogenic machinery appropriate for the viral replication, a process that requires significant HDL uptake from the bloodstream.
4.5 Activation of LCs immune response following SARS-CoV-2 infection
The increased immunoexpression of cytokines in the steroidogenically hypofunctional LCs of IG is intriguing, and points to a transition of the steroidogenic profile of these cells to an immune profile triggered by the viral infection. During mumps virus (Wu et al., 2016) and Zika virus (Ma et al., 2016; Uraki et al., 2017) infections, both LCs and Sertoli cells trigger innate immune responses, leading to increased concentrations of inflammatory cytokines, including IL-1β, IL-2, IL-6, and TNF-α, in response to the recognition of viral RNA. This ability is associated with the expression of viral RNA recognition receptors, such as Rigi and Mda5, in these cells, allowing an immune response and a subsequent inflammatory process (Zhu et al., 2013, 2014; Wang et al., 2021). Therefore, the significant increase of Rigi expression associated with the intense immunoexpression of pro-inflammatory cytokines reinforces the idea that LCs may undergo a transition from a steroidogenic profile to an immunological profile, exerting an antiviral immune response (Figure 10). Recent studies demonstrated that increased SREBP induces NLRP3 inflammasome complex activation and production of IL-1β (Soares et al., 2023; ). Therefore, the LC lipid metabolism activation does not seem to be related solely to viral replication but may also be involved in the activation of the LCs immune response to the infection. Future studies are needed to elucidate the viral and cellular mechanisms involved in the LC immune response.
5 Conclusion
The expression of hACE2 and the presence of viral particles in the interstitial cells confirm the susceptibility of the testes to SARS-CoV-2 infection in the K18-hACE2 mice. The infection triggers a testicular immune response through the activation of M1 and M2 macrophages and cytokines production by both macrophages and LCs. The high levels of cytokines and/or viral infection impair steroidogenesis, contributing to enhanced concentration of lipids in LCs. The virus also exploits steroidogenic machinery for lipogenesis in favor of its replication, inducing cholesterol endocytosis and contributing to increased lipids in LCs. These findings support the low serum testosterone and cholesterol levels in men with high risk of death by COVID-19 and highlight possible therapeutic targets to prevent these effects.
Statements
Data availability statement
The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding author.
Ethics statement
This study utilizes a human testicular tissue photomicrograph (Figure 1) obtained from a histological slide provided by IPC Medicina Diagnóstica (Araraquara, SP, Brazil). Ethics committee approval was not required according to local legislation (Brazilian National Health Council Resolution CNS 466/2012) because the material consists solely of a de-identified (anonymous) archival sample, with no possibility of identifying the donor.
Author contributions
SO: Conceptualization, Data curation, Investigation, Validation, Writing – original draft, Writing – review & editing, Formal analysis, Methodology, Software. AS: Data curation, Investigation, Methodology, Writing – review & editing. BH: Data curation, Writing – review & editing, Validation, Visualization. GG: Data curation, Writing – review & editing, Methodology. TC: Methodology, Writing – review & editing, Visualization. PC: Methodology, Visualization, Writing – review & editing, Funding acquisition, Investigation, Validation. ES-C: Funding acquisition, Investigation, Validation, Visualization, Writing – review & editing, Conceptualization, Data curation, Project administration, Supervision, Writing – original draft.
Funding
The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo, Grant/Award Numbers: 2021/07207-6; 2021/09328-5; 2022/10560-2) and CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior; financial code 001).
Acknowledgments
We thank Pedro Sérgio Simões for the technical assistance. The authors also thank Dr. Carlos Alberto de Souza Costa for the use of ChemiDoc™ MP during Western blot analysis.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Correction note
05 January 2025 A correction has been made to this article. Details can be found at: 10.3389/fcimb.2025.1702430.
29 May 2026 A correction has been made to this article. Details can be found at: 10.3389/fcimb.2026.1871852.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Glossary
- 17β-HSD
17β-hydroxysteroid dehydrogenase
- 3β-HSD
3β-Hydroxysteroid dehydrogenase
- ACE2
Angiotensin-Converting Enzyme 2
- BSL3
Biosafety Level 3 Laboratory
- CARDs
Caspase Activation and Recruitment Domain
- COVID-19
severe acute respiratory syndrome
- CG
Control Group
- CYP11A1
Cholesterol side-chain cleavage enzyme
- DGAT-1
Enzyme Diacylglycerol O-Acyltransferase-1
- DMVs
Double-Membrane Vesicles
- EGFR
Epidermal Growth Factor Receptor
- FBS
Fetal Bovine Serum
- hACE2
human Angiotensin-Converting Enzyme 2
- HDL
High Density Lipoprotein
- IG
Infected Group
- INSL3
Insulin Like 3
- IRF3/7
Interferon Regulatory Factor 3 and 7
- LCs
Leydig cells
- LDL
Low Density Lipoprotein
- LDs
Lipid Droplets
- MDA5
Melanoma Differentiation-Associated Protein 5
- MAVS
Mitochondrial Antiviral Signaling Protein
- MIF
Macrophage Migration Inhibitory Factor
- NLRP3
NLR family pyrin domain containing 3
- NOS3
Nitric Oxide Synthase 3
- PFU
Plaque-Forming Units
- PMSF
Phenylmethylsulfonyl Fluoride
- PRRs
Pattern Recognition Receptors
- RIG-I
Retinoic Acid-Inducible 1
- ROs
Replication Organelles
- S1
Spike Protein
- SAC
Spirally Arranged Cisternae
- SCAP
Cleavage-Activating Protein
- SCARB1
Scavenger Receptor Class B type 1
- SER
Smooth Endoplasmic Reticulum
- SF-1
Steroidogenic Factor-1
- SREBP1
Sterol Regulatory Element Binding Transcription Factor 1
- StAR
Steroidogenic Acute Regulatory Protein
- StARD4
Lipid Transfer Protein 4
- TEM
Transmission Electron Microscopy.
References
1
Abu-FarhaM.ThanarajT. A.QaddoumiM. G.HashemA.AbubakerJ.Al-MullaF. (2020). The role of lipid metabolism in COVID-19 virus infection and as a drug target. Int. J. Mol. Sci.21, 3544. doi: 10.3390/ijms21103544
2
AchuaJ. K.ChuK. Y.IbrahimE.KhodamoradiK.DelmaK. S.IakymenkoO. A.et al. (2021). Histopathology and ultrastructural findings of fatal COVID-19 infections on testis. World J. Mens Health39, 65–74. doi: 10.5534/wjmh.200170
3
AltavillaD.RomeoC.SquadritoF.MariniH.MorgiaG.AntonuccioP.et al. (2012). Molecular pathways involved in the early and late damage induced by testis ischemia: evidence for a rational pharmacological modulation. Curr. Med. Chem.19, 1219–1224. doi: 10.2174/092986712799320538
4
Al-ZadjaliJ.Al-LawatiA.Al RiyamiN.Al FarsiK.Al JarradiN.BoudakaA.et al. (2024). Reduced HDL-cholesterol in long COVID-19: A key metabolic risk factor tied to disease severity. Clinics (Sao Paulo)79, 100344. doi: 10.1016/j.clinsp.2024.100344
5
BaoL.DengW.HuangB.GaoH.LiuJ.RenL.et al. (2020). The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. Nature583, 830–833. doi: 10.1038/s41586-020-2312-y
6
Barbosa De Souza RizzoM.Brasilino De CarvalhoM.KimE. J.RendonB. E.NoeJ. T.WiseA. D.et al. (2018). Oral squamous carcinoma cells promote macrophage polarization in an MIF-dependent manner. QJM111, 769–778. doi: 10.1093/qjmed/hcy163
7
BaughnL. B.SharmaN.ElhaikE.SekulicA.BryceA. H.FonsecaR. (2020). Targeting TMPRSS2 in SARS-coV-2 infection. Mayo Clin. Proc.95, 1989–1999. doi: 10.1016/j.mayocp.2020.06.018
8
BeattieM. C.AdekolaL.PapadopoulosV.ChenH.ZirkinB. R. (2015). Leydig cell aging and hypogonadism. Exp. Gerontol.68, 87–91. doi: 10.1016/j.exger.2015.02.014
9
BullockH. A.GoldsmithC. S.MillerS. E. (2021). Best practices for correctly identifying coronavirus by transmission electron microscopy. Kidney Int.99, 824–827. doi: 10.1016/j.kint.2021.01.004
10
CarliniV.NoonanD. M.AbdalalemE.GolettiD.SansoneC.CalabroneL.et al. (2023). The multifaceted nature of IL-10: regulation, role in immunological homeostasis and its relevance to cancer, COVID-19 and post-COVID conditions. Front. Immunol.14. doi: 10.3389/fimmu.2023.1161067
11
CasadoM. E.HuertaL.Marcos-DíazA.OrtizA. I.KraemerF. B.LasunciónM. A.et al. (2021). Hormone-sensitive lipase deficiency affects the expression of SR-BI, LDLr, and ABCA1 receptors/transporters involved in cellular cholesterol uptake and efflux and disturbs fertility in mouse testis. Biochim. Biophys. Acta Mol. Cell Biol. Lipids1866, 159043. doi: 10.1016/j.bbalip.2021.159043
12
ChenY.GuoY.PanY.ZhaoZ. J. (2020). Structure analysis of the receptor binding of 2019-nCoV. Biochem. Biophys. Res. Commun.525, 135–140. doi: 10.1016/j.bbrc.2020.02.071
13
ChenM.LiS.LiuS.ZhangY.CuiX.LvL.et al. (2023). Infection of SARS-CoV-2 causes severe pathological changes in mouse testis. J. Genet. Genomics50, 99–107. doi: 10.1016/j.jgg.2022.11.011
14
ChibssaR. R.KangetheR. T.BerguidoF. J.SettypalliT. B. K.LiuY.GrabherrR.et al. (2021). Innate immune responses to wildtype and attenuated sheeppox virus mediated through RIG-1 sensing in PBMC in-vitro. Front. Immunol.12. doi: 10.3389/fimmu.2021.666543
15
CorteseM.LeeJ. Y.CerikanB.NeufeldtC. J.OorschotV. M. J.KöhrerS.et al. (2020). Integrative imaging reveals SARS-coV-2-induced reshaping of subcellular morphologies. Cell Host Microbe28, 853–866.e5. doi: 10.1016/j.chom.2020.11.003
16
CostaG. M. J.LacerdaS. M. S. N.FigueiredoA. F. A.WnukN. T.BrenerM. R. G.AndradeL. M.et al. (2023). High SARS-CoV-2 tropism and activation of immune cells in the testes of non-vaccinated deceased COVID-19 patients. BMC Biol.21, 36. doi: 10.1186/s12915-022-01497-8
17
CudiciniC.LejeuneH.GomezE.BosmansE.BalletF.SaezJ.et al. (1997). Human Leydig cells and Sertoli cells are producers of interleukins-1 and -6. J. Clin. Endocrinol. Metab.82, 1426–1433. doi: 10.1210/jcem.82.5.3938
18
CutoloM.CampitielloR.GotelliE.SoldanoS. (2022). The role of M1/M2 macrophage polarization in rheumatoid arthritis synovitis. Front. Immunol.13. doi: 10.3389/fimmu.2022.867260
19
DaiP.QiaoF.ChenY.ChanD. Y. L.YimH. C. H.FokK. L.et al. (2023). SARS-CoV-2 and male infertility: from short- to long-term impacts. J. Endocrinol. Invest.46, 1491–1507. doi: 10.1007/s40618-023-02055-x
20
da SilvaA. A. S.de OliveiraS. A.BattistoneM. A.HintonB. T.CerriP. S.Sasso-CerriE.et al. (2024). hACE2 upregulation and participation of macrophages and clear cells in the immune response of epididymis to SARS-CoV-2 in K18-hACE2 mice. Andrology. doi: 10.1111/andr.13755
21
de OliveiraS. A.CerriP. S.Sasso-CerriE. (2021). Impaired macrophages and failure of steroidogenesis and spermatogenesis in rat testes with cytokines deficiency induced by diacerein. Histochem. Cell Biol.156, 561–581. doi: 10.1007/s00418-021-02023-7
22
de SantiF.BeltrameF. L.RodriguesB. M.ScarameleN. F.LopesF. L.CerriP. S.et al. (2022). Venlafaxine-induced adrenergic signaling stimulates Leydig cells steroidogenesis via Nur77 overexpression: A possible role of EGF. Life Sci.289, 120069. doi: 10.1016/j.lfs.2021.120069
23
De SilvaM. S. I.DaytonA. W.RhotenL. R.MallettJ. W.ReeseJ. C.SquiresM. D.et al. (2018). Involvement of adenosine monophosphate activated kinase in interleukin-6 regulation of steroidogenic acute regulatory protein and cholesterol side chain cleavage enzyme in the bovine zona fasciculata and zona reticularis. Steroids134, 53–66. doi: 10.1016/j.steroids.2018.02.009
24
DiasS. S. G.SoaresV. C.FerreiraA. C.SacramentoC. Q.Fintelman-RodriguesN.TemerozoJ. R.et al. (2020). Lipid droplets fuel SARS-CoV-2 replication and production of inflammatory mediators. PloS Pathog.16. doi: 10.1371/journal.ppat.1009127
25
DorobantuC. M.AlbulescuL.HarakC.FengQ.van KampenM.StratingJ. R.et al. (2015). Modulation of the host lipid landscape to promote RNA virus replication: The picornavirus encephalomyocarditis virus converges on the pathway used by hepatitis C virus. PloS Pathog.11, e1005185. doi: 10.1371/journal.ppat.1005185
26
Duarte-NetoA. N.TeixeiraT. A.CaldiniE. G.KanamuraC. T.Gomes-GouvêaM. S.Dos SantosA. B. G.et al. (2022). Testicular pathology in fatal COVID-19: A descriptive autopsy study. Andrology10, 13–23. doi: 10.1111/andr.13073
27
EdenfieldR. C.EasleyC. A.IV (2022). Implications of testicular ACE2 and the renin-angiotensin system for SARS-CoV-2 on testis function. Nat. Rev. Urol.19, 116–127. doi: 10.1038/s41585-021-00542-5
28
FanC.LuW.LiK.DingY.WangJ. (2021). ACE2 expression in kidney and testis may cause kidney and testis infection in COVID-19 patients. Front. Med. (Lausanne)7. doi: 10.3389/fmed.2020.563893
29
FeingoldK. R. (2023). The bidirectional interaction of COVID-19 infections and lipoproteins. Best Pract. Res. Clin. Endocrinol. Metab.37, 101751. doi: 10.1016/j.beem.2023.101751
30
GaoM.HuangX.SongB. L.YangH. (2019). The biogenesis of lipid droplets: Lipids take center stage. Prog. Lipid Res.75, 100989. doi: 10.1016/j.plipres.2019.100989
31
GerendaiI.BanczerowskiP.CsernusV. (2005). Interleukin 1-beta injected into the testis acutely stimulates and later attenuates testicular steroidogenesis of the immature rat. Endocrine.28, 165–170. doi: 10.1385/ENDO:28:2:165
32
GiannakopoulosS.StrangeD. P.JiyaromB.AbdelaalO.BradshawA. W.NerurkarV. R.et al. (2023). In vitro evidence against productive SARS-CoV-2 infection of human testicular cells: Bystander effects of infection mediate testicular injury. PloS Pathog.19. doi: 10.1371/journal.ppat.1011409
33
GrasselliG.ZangrilloA.ZanellaA. (2020). Baseline characteristics and outcomes of 1591 patients infected with SARS-CoV-2 admitted to ICUs of the Lombardy Region, Italy. JAMA323, 1574–1581. doi: 10.1001/jama.2020.5394
34
GualdoniG. S.JacoboP. V.SobarzoC. M.PérezC. V.DurandL. A. H.TheasM. S.et al. (2021). Relevance of angiogenesis in autoimmune testis inflammation. Mol. Hum. Reprod.27. doi: 10.1093/molehr/gaaa073
35
HalesD. B. (1992). Interleukin-1 inhibits Leydig cell steroidogenesis primarily by decreasing 17 alpha-hydroxylase/C17–20 lyase cytochrome P450 expression. Endocrinology131, 2165–2172. doi: 10.1210/endo.131.5.1425417
36
HalesD. B. (2002). Testicular macrophage modulation of Leydig cell steroidogenesis. J. Reprod. Immunol.57, 3–18. doi: 10.1016/S0165-0378(02)00020-7
37
HatanoM.MigitaT.OhishiT.ShimaY.OgawaY.MorohashiK. I.et al. (2016). SF-1 deficiency causes lipid accumulation in Leydig cells via suppression of STAR and CYP11A1. Endocrine54, 484–496. doi: 10.1007/s12020-016-1043-1
38
HikmetF.MéarL.EdvinssonÅ.MickeP.UhlénM.LindskogC. (2020). The protein expression profile of ACE2 in human tissues. Mol. Syst. Biol.16, 7. doi: 10.15252/msb.20209610
39
HopferH.HerzigM. C.GosertR.MenterT.HenchJ.TzankovA.et al. (2021). Hunting coronavirus by transmission electron microscopy – a guide to SARS-CoV-2-associated ultrastructural pathology in COVID-19 tissues. Histopathology78, 358–370. doi: 10.1111/his.14264
40
HorieT.NishinoT.BabaO.KuwabaraY.NakaoT.NishigaM.et al. (2013). MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice. Nat. Commun.4, 2883. doi: 10.1038/ncomms3883
41
HuangX.LiY.FuM.XinH. B. (2018). Polarizing macrophages in vitro. Methods Mol. Biol.1784, 119–126. doi: 10.1007/978-1-4939-7837-3_12
42
HutsonJ. C. (1992). Development of cytoplasmic digitations between Leydig cells and testicular macrophages of the rat. Cell Tissue Res.267, 385–389. doi: 10.1007/BF00302977
43
HutsonJ. C. (2006). Physiologic interactions between macrophages and Leydig cells. Exp. Biol. Med. (Maywood)231, 1–7. doi: 10.1177/153537020623100101
44
KatoH.TakeuchiO.SatoS.YoneyamaM.YamamotoM.MatsuiK.et al. (2006). Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature441, 101–105. doi: 10.1038/nature04734
45
LagaceT. A.RidgwayN. D. (2013). The role of phospholipids in the biological activity and structure of the endoplasmic reticulum. Biochim. Biophys. Acta1833, 2499–2510. doi: 10.1016/j.bbamcr.2013.05.018
46
LanserL.BurkertF. R.ThommesL.EggerA.HoermannG.KaserS.et al. (2021). Testosterone deficiency is a risk factor for severe COVID-19. Front. Endocrinol. (Lausanne)12. doi: 10.3389/fendo.2021.694083
47
LeeJ. H.LeeS. H.LeeE. H.ChoJ. Y.SongD. K.LeeY. J.et al. (2023). SCAP deficiency facilitates obesity and insulin resistance through shifting adipose tissue macrophage polarization. J. Adv. Res.45, 1–13. doi: 10.1016/j.jare.2022.05.013
48
LeisegangK.HenkelR. (2018). The in vitro modulation of steroidogenesis by inflammatory cytokines and insulin in TM3 Leydig cells. Reprod. Biol. Endocrinol.16, 26. doi: 10.1186/s12958-018-0341-2
49
LiL.SottasC. M.ChenH. Y.LiY.CuiH.VillanoJ. S.et al. (2023). SARS-CoV-2 enters human Leydig cells and affects testosterone production. vitro. Cells12, 1198. doi: 10.3390/cells12081198
50
LiC.YeZ.ZhangA. J. X.ChanJ. F. W.SongW.LiuF.et al. (2022). Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection by intranasal or intratesticular route induces testicular damage. Clin. Infect. Dis.75, e974–e990. doi: 10.1093/cid/ciac142
51
LiX.YoungbloodG. L.PayneA. H.HalesD. B. (1995). Tumor necrosis factor-alpha inhibition of 17 alpha-hydroxylase/C17–20 lyase gene (Cyp17) expression. Endocrinology136, 3519–3526. doi: 10.1210/endo.136.8.7628389
52
LiuM. H.LinX. L.XiaoL. L. (2024). SARS-CoV-2 nucleocapsid protein promotes TMAO-induced NLRP3 inflammasome activation by SCAP-SREBP signaling pathway. Tissue Cell86, 102276. doi: 10.1016/j.tice.2023.102276
53
LovelandK. L.KleinB.PueschlD.IndumathyS.BergmannM.LovelandB. E.et al. (2017). Cytokines in male fertility and reproductive pathologies: immunoregulation and beyond. Front. Endocrinol.8. doi: 10.3389/fendo.2017.00307
54
LyJ.CamposR. K.Hager-SotoE. E.CamargosV. N.RossiS. L. (2023). Testicular pathological alterations associated with SARS-CoV-2 infection. Front. Reprod. Health5. doi: 10.3389/frph.2023.1229622
55
LysiakJ. J. (2004). The role of tumor necrosis factor-alpha and interleukin-1 in the mammalian testis and their involvement in testicular torsion and autoimmune orchitis. Reprod. Biol. Endocrinol.2, 9. doi: 10.1186/1477-7827-2-9
56
LysiakJ. J.NguyenQ. A.KirbyJ. L.TurnerT. T. (2003). Ischemia-reperfusion of the murine testis stimulates the expression of proinflammatory cytokines and activation of c-jun N-terminal kinase in a pathway to E-selectin expression. Biol. Reprod.69, 202–210. doi: 10.1095/biolreprod.102.013318
57
MaW.LiS.MaS.JiaL.ZhangF.ZhangY.et al. (2016). Zika virus causes testis damage and leads to male infertility in mice. Cell167, 1511–1524.e10. doi: 10.1016/j.cell.2016.11.016
58
MannaP. R.WangX. J.StoccoD. M. (2003). Involvement of multiple transcription factors in the regulation of steroidogenic acute regulatory protein gene expression. Steroids68, 1125–1134. doi: 10.1016/j.steroids.2003.07.009
59
McCrayP. B.Jr.PeweL.Wohlford-LenaneC.HickeyM.ManzelL.ShiL.et al. (2007). Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus. J. Virol.81, 813–821. doi: 10.1128/JVI.02012-06
60
McIlmoilS.CallG. B.BarneyM.StricklandJ.JuddA. M. (2015). Interleukin-6 inhibits adrenal androgen release from bovine adrenal zona reticularis cells by inhibiting the expression of steroidogenic proteins. Domest. Anim. Endocrinol.53, 108–123. doi: 10.1016/j.domaniend.2015.05.006
61
MillerW. L. (2007). Steroidogenic acute regulatory protein (StAR), a novel mitochondrial cholesterol transporter. Biochim. Biophys. Acta1771, 663–676. doi: 10.1016/j.bbalip.2007.02.012
62
MoreauG. B.BurgessS. L.SturekJ. M.DonlanA. N.PetriW. A.MannB. J. (2020). Evaluation of K18-hACE2 mice as a model of SARS-CoV-2 infection. Am. J. Trop. Med. Hyg.103, 1215–1219. doi: 10.4269/ajtmh.20-0762
63
MoriH.ShimizuD.FukunishiR.ChristensenA. K. (1982). Morphometric analysis of testicular Leydig cells in normal adult mice. Anat. Rec.204, 333–339. doi: 10.1002/ar.1092040406
64
NardacciR.ColavitaF.CastillettiC.LapaD.MatusaliG.MeschiS.et al. (2021). Evidences for lipid involvement in SARS-CoV-2 cytopathogenesis. Cell Death Dis.12, 263. doi: 10.1038/s41419-021-03527-9
65
NassauD. E.BestJ. C.KreschE.GonzalezD. C.KhodamoradiK.RamasamyR. (2022). Impact of the SARS-CoV-2 virus on male reproductive health. BJU Int.129, 143–150. doi: 10.1111/bju.15573
66
NavarraA.AlbaniE.CastellanoS.ArruzzoloL.Levi-SettiP. (2020). Coronavirus disease-19 infection: Implications on male fertility and reproduction. Front. Physiol.11. doi: 10.3389/fphys.2020.574761
67
OhataM. (1979). Electron microscopic study on the testicular interstitial cells in the mouse. Arch. Histol. Jpn.42, 51–79. doi: 10.1679/aohc1950.42.51
68
OrestiG. M.García-LópezJ.AveldañoM. I.Del MazoJ. (2013). Cell-type-specific regulation of genes involved in testicular lipid metabolism: fatty acid-binding proteins, diacylglycerol acyltransferases, and perilipin 2. Reproduction.146, 471–480.
69
Pacheco-FernándezT.Juárez-AvelarI.IllescasO.TerrazasL. I.Hernández-PandoR.Pérez-PlasenciaC.et al. (2019). Macrophage migration inhibitory factor promotes the interaction between the tumor, macrophages, and T cells to regulate the progression of chemically induced colitis-associated colorectal cancer. Mediators Inflamm.2019, 2056085. doi: 10.1155/2019/2056085
70
ParraS.SaballsM.DiNubileM.FeliuM.IftimieS.RevueltaL.et al. (2023). Low HDL-c levels at admission are associated with greater severity and worse clinical outcomes in patients with COVID-19 disease. Atheroscler. Plus52, 1–8. doi: 10.1016/j.athplu.2023.01.002
71
RehwinkelJ.GackM. U. (2020). RIG-I-like receptors: their regulation and roles in RNA sensing. Nat. Rev. Immunol.20, 537–551. doi: 10.1038/s41577-020-0288-3
72
RibeiroM. R.CaladoA. M.AlvesÂ.PereiraR.SousaM.SáR. (2023). Spatial distribution of SARS-CoV-2 receptors and proteases in testicular cells. J. Histochem. Cytochem.71, 169–197. doi: 10.1369/00221554231168916
73
RicciardiS.GuarinoA. M.GiaquintoL.PolishchukE. V.SantoroM.Di TullioG.et al. (2022). The role of NSP6 in the biogenesis of the SARS-CoV-2 replication organelle. Nature606, 761–768. doi: 10.1038/s41586-022-04835-6
74
RichardsonS.HirschJ. S.NarasimhanM.CrawfordJ. M.McGinnT.DavidsonK. W.et al. (2020). Presenting characteristics, comorbidities, and outcomes among 5700 patients hospitalized with COVID-19 in the New York city area. JAMA323, 2052–2059. doi: 10.1001/jama.2020.6775
75
RodriguesP. B.GomesG. F.AngelimM. K. S. C.SouzaG. F.MuraroS. P.Toledo-TeixeiraD. A.et al. (2022). Impact of microbiota depletion by antibiotics on SARS-CoV-2 infection of K18-hACE2 mice. Cells11, 2572. doi: 10.3390/cells11162572
76
SaganS. M.RouleauY.LeggiadroC.SupekovaL.SchultzP. G.SuA. I.et al. (2006). The influence of cholesterol and lipid metabolism on host cell structure and hepatitis C virus replication. Biochem. Cell Biol.84, 67–79. doi: 10.1139/o05-149
77
SaloniaA.PontilloM.CapogrossoP.GregoriS.TassaraM.BoeriL.et al. (2021). Severely low testosterone in males with COVID-19: A case-control study. Andrology9, 1043–1052. doi: 10.1111/andr.12993
78
SamirM.GlisterC.MattarD.LairdM.KnightP. G. (2017). Follicular expression of pro-inflammatory cytokines tumour necrosis factor-α (TNFα), interleukin 6 (IL6) and their receptors in cattle: TNFα, IL6 and macrophages suppress thecal androgen production in vitro. Reproduction154, 35–49. doi: 10.1530/REP-17-0053
79
SaraivaK. L.SilvaV. A.DiasE. S.PeixotoC. A. (2006). Morphological changes in the testis induced by diethylcarbamazine. Reprod. Toxicol.22, 754–759. doi: 10.1016/j.reprotox.2006.07.008
80
SaraivaK. L.SilvaV. A.Jr.TorresD. O.DonatoM. A.PeresN. G.SouzaJ. R.et al. (2008). Changes in mouse Leydig cells ultrastructure and testosterone secretion after diethylcarbamazine administration. Micron39, 580–586. doi: 10.1016/j.micron.2007.06.003
81
Sasso-CerriE.CerriP. S. (2008). Morphological evidences indicate that the interference of cimetidine on the peritubular components is responsible for detachment and apoptosis of Sertoli cells. Reprod. Biol. Endocrinol.6, 18. doi: 10.1186/1477-7827-6-18
82
SemedoS. S. L.da Silva SanfeliceR. A.Tomiotto-PellissierF.SilvaT. F.da Silva BortoletiB. T.de OliveiraG. C.et al. (2022). Biogenic silver nanoparticles (AgNp-Bio) restore testosterone levels and increase TNF-α and IL-6 in Leydig cells infected with Toxoplasma gondii. Exp. Parasitol.241, 108343. doi: 10.1016/j.exppara.2022.108343
83
ShenW. J.AzharS.KraemerF. B. (2016). Lipid droplets and steroidogenic cells. Exp. Cell Res.340, 209–214. doi: 10.1016/j.yexcr.2015.11.024
84
Shimizu-AlbergineM.Van YserlooB.GolkowskiM. G.OngS. E.BeavoJ. A.BornfeldtK. E. (2016). SCAP/SREBP pathway is required for the full steroidogenic response to cyclic AMP. Proc. Natl. Acad. Sci. U.S.A.113, E5685–E5693. doi: 10.1073/pnas.1611424113
85
SoaresV. C.DiasS. S. G.SantosJ. C.Azevedo-QuintanilhaI. G.MoreiraI. B. G.SacramentoC. Q.et al. (2023). Inhibition of the SREBP pathway prevents SARS-CoV-2 replication and inflammasome activation. Life Sci. Alliance6. doi: 10.26508/lsa.202302049
86
SolimanM. M.AldhahraniA.GaberA.AlsanieW. F.ShukryM.MohamedW. A.et al. (2021). Impacts of n-acetyl cysteine on gibberellic acid-induced testicular dysfunction through regulation of inflammatory cytokines, steroid and antioxidant activity. Andrologia53, e14036. doi: 10.1111/and.14036
87
StoyanovaG.JabeenS.Landazuri VinuezaV.Ghosh RoyS.LockshinR. A.ZakeriZ. (2023). Zika virus triggers autophagy to exploit host lipid metabolism and drive viral replication. Cell Commun. Signal.21, 114. doi: 10.1186/s12964-022-01026-8
88
SugawaraT.HoltJ. A.KiriakidouM.StraussJ. F.III (1996). Steroidogenic factor 1-dependent promoter activity of the human steroidogenic acute regulatory protein (StAR) gene. Biochemistry35, 9052–9059. doi: 10.1021/bi960057r
89
TanT.KhooB.MillsE. G.PhylactouM.PatelB.EngP. C.et al. (2020). Association between high serum total cortisol concentrations and mortality from COVID-19. Lancet Diabetes Endocrinol.8, 659–660. doi: 10.1016/S2213-8587(20)30216-3
90
ThoresenD.WangW.GallsD.GuoR.XuL.PyleA. M. (2021). The molecular mechanism of RIG-I activation and signaling. Immunol. Rev.304, 154–168. doi: 10.1111/imr.13022
91
ThorneL. G.ReuschlA. K.Zuliani-AlvarezL.WhelanM. V. X.TurnerJ.NoursadeghiM.et al. (2021). SARS-CoV-2 sensing by RIG-I and MDA5 links epithelial infection to macrophage inflammation. EMBO J.40, e107826. doi: 10.15252/embj.2021107826
92
UntergasserA.CutcutacheI.KoressaarT.YeJ.FairclothB. C.RemmM.et al. (2012). Primer3—new capabilities and interfaces. Nucleic Acids Res.40, e115. doi: 10.1093/nar/gks596
93
UrakiR.HwangJ.JuradoK. A.HouseholderS.YockeyL. J.HastingsA. K.et al. (2017). Zika virus causes testicular atrophy. Sci. Adv.3, 2. doi: 10.1126/sciadv.1602899
94
VerhoevenG.CailleauJ.Van DammeJ.BilliauA. (1988). Interleukin-1 stimulates steroidogenesis in cultured rat Leydig cells. Mol. Cell Endocrinol.57, 51–60. doi: 10.1016/0303-7207(88)90031-7
95
WangM.FijakM.HossainH.MarkmannM.NüsingR. M.LochnitG.et al. (2017). Characterization of the micro-environment of the testis that shapes the phenotype and function of testicular macrophages. J. Immunol.198, 4327–4340. doi: 10.4049/jimmunol.1700162
96
WangQ.WangF.ChenR.LiuW.GaoN.AnJ.et al. (2021). Differential effects of viral nucleic acid sensor signaling pathways on testicular Sertoli and Leydig cells. Endocrinology162, bqab180. doi: 10.1210/endocr/bqab180
97
WangZ.XuX. (2020). scRNA-seq profiling of human testes reveals the presence of the ACE2 receptor, a target for SARS-CoV-2 infection in spermatogonia, Leydig and Sertoli cells. Cells9, 920. doi: 10.3390/cells9040920
98
WarrenD. W.PasupuletiV.LuY.PlatlerB. W.HortonR. (1990). Tumor necrosis factor and interleukin-1 stimulate testosterone secretion in adult male rat Leydig cells in vitro. J. Androl11, 353–360.
99
WuJ.ChenZ. J. (2014). Innate immune sensing and signaling of cytosolic nucleic acids. Annu. Rev. Immunol.32, 461–488. doi: 10.1146/annurev-immunol-032713-120156
100
WuH.ShiL.WangQ.ChengL.ZhaoX.ChenQ.et al. (2016). Mumps virus-induced innate immune responses in mouse Sertoli and Leydig cells. Sci. Rep.6, 19507. doi: 10.1038/srep19507
101
XieJ.TongZ.GuanX.DuB.QiuH. (2020). Clinical characteristics of patients who died of coronavirus disease 2019 in China. JAMA Netw Open3, e208147. doi: 10.1001/jamanetworkopen.2020.5619
102
XiongY.HalesD. B. (1993). The role of tumor necrosis factor-alpha in the regulation of mouse Leydig cell steroidogenesis. Endocrinology132, 2438–2444. doi: 10.1210/endo.132.6.8504748
103
YanB.ChuH.YangD.SzeK. H.LaiP. M.YuanS.et al. (2019). Characterization of the lipidomic profile of human coronavirus-infected cells: Implications for lipid metabolism remodeling upon coronavirus replication. Viruses11, 73. doi: 10.3390/v11010073
104
YenC. L.StoneS. J.KoliwadS.HarrisC.FareseR. V.Jr. (2008). Thematic review series: glycerolipids. DGAT enzymes and triacylglycerol biosynthesis. J. Lipid Res.49, 2283–2301. doi: 10.1194/jlr.R800018-JLR200
105
YuanS.YanB.CaoJ.YeZ. W.LiangR.TangK.et al. (2021). SARS-CoV-2 exploits host DGAT and ADRP for efficient replication. Cell Discov.7, 100. doi: 10.1038/s41421-021-00338-2
106
ZhuW.ChenQ.YanK.LiuZ.LiN.ZhangX.et al. (2013). RIG-I-like receptors mediate innate antiviral response in mouse testis. Mol. Endocrinol.27, 1455–1467. doi: 10.1210/me.2013-1075
107
ZhuW.LiuP.YuL.ChenQ.LiuZ.YanK.et al. (2014). p204-initiated innate antiviral response in mouse Leydig cells. Biol. Reprod.91, 8. doi: 10.1095/biolreprod.114.119396
108
ZhuX.NiuZ.FanW.ChengM.ChenQ.ZhangA. (2022). Alternative polarization of resident macrophages improves hyperglycemia-associated male infertility. iScience25, 104430. doi: 10.1016/j.isci.2022.104430
109
ZhuangM. W.ChengY.ZhangJ.JiangX. M.WangL.DengJ.et al. (2020). Increasing host cellular receptor-angiotensin-converting enzyme 2 expression by coronavirus may facilitate 2019-nCoV (or SARS-CoV-2) infection. J. Med. Virol.92, 2693–2701. doi: 10.1002/jmv.26139
110
ZouP. F.TangJ. C.LiY.FengJ. J.ZhangZ. P.WangY. L. (2021). MAVS splicing variants associated with TRAF3 and TRAF6 in NF-κB and IRF3 signaling pathway in large yellow croaker Larimichthys crocea. Dev. Comp. Immunol.121, 104076. doi: 10.1016/j.dci.2021.104076
Summary
Keywords
COVID-19, testosterone, cholesterol, lipogenesis, nucleocapsid, cytokines, macrophages, electron microscopy
Citation
de Oliveira SA, da Silva AAS, Hinton BT, Gomes GF, Cunha TM, Cerri PS and Sasso-Cerri E (2025) SARS-CoV-2 exploits steroidogenic machinery, triggers lipid metabolism for viral replication and induces immune response in Leydig cells of K18-hACE2 mice. Front. Cell. Infect. Microbiol. 15:1538461. doi: 10.3389/fcimb.2025.1538461
Received
02 December 2024
Accepted
24 April 2025
Published
27 May 2025
Corrected
29 May 2026
Volume
15 - 2025
Edited by
Katarzyna Otulak-Kozieł, Warsaw University of Life Sciences, Poland
Reviewed by
Waldemar Kanczkowski, Technical University Dresden, Germany
Victory Ashonibare, Heinrich Heine University of Düsseldorf, Germany
Updates
Copyright
© 2025 de Oliveira, da Silva, Hinton, Gomes, Cunha, Cerri and Sasso-Cerri.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Estela Sasso-Cerri, estela.sasso@unesp.br
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.