ORIGINAL RESEARCH article

Front. Endocrinol., 09 August 2013

Sec. Molecular and Structural Endocrinology

Volume 4 - 2013 | https://doi.org/10.3389/fendo.2013.00098

IGF-I, IGF-II, and Insulin Stimulate Different Gene Expression Responses through Binding to the IGF-I Receptor

  • SV

    Soetkin Versteyhe 1*

  • BK

    Birgit Klaproth 1

  • RB

    Rehannah Borup 2

  • JP

    Jane Palsgaard 1

  • MJ

    Maja Jensen 1

  • SG

    Steven G. Gray 1,3

  • PD

    Pierre De Meyts 1

  • 1. Receptor Systems Biology Laboratory, Hagedorn Research Institute, Novo Nordisk A/S, Gentofte, Denmark

  • 2. Genomic Medicine, Microarray Center, Copenhagen University Hospital, Copenhagen, Denmark

  • 3. Thoracic Oncology Research Group, Trinity Centre for Health Sciences, Institute of Molecular Medicine, St. James’s Hospital, Dublin, Ireland

Abstract

Insulin and the insulin-like growth factors (IGF)-I and -II are closely related peptides important for regulation of metabolism, growth, differentiation, and development. The IGFs exert their main effects through the IGF-I receptor. Although the insulin receptor is the main physiological receptor for insulin, this peptide hormone can also bind at higher concentrations to the IGF-I receptor and exert effects through it. We used microarray gene expression profiling to investigate the gene expression regulated by IGF-I, IGF-II, and insulin after stimulation of the IGF-I receptor. Fibroblasts from mice, knockout for IGF-II and the IGF-II/cation-independent mannose-6-phosphate receptor, and expressing functional IGF-I but no insulin receptors, were stimulated for 4 h with equipotent saturating concentrations of insulin, IGF-I, and IGF-II. Each ligand specifically regulated a group of transcripts that was not regulated by the other two ligands. Many of the functions and pathways these regulated genes were involved in, were consistent with the known biological effects of these ligands. The differences in gene expression might therefore account for some of the different biological effects of insulin, IGF-I, and IGF-II. This work adds to the evidence that not only the affinity of a ligand determines its biological response, but also its nature, even through the same receptor.

Introduction

Insulin and the closely related insulin-like growth factors (IGF)-I and -II are important for the regulation of metabolism and cell growth, survival, motility, differentiation, and development (16). These ligands bind to closely related receptor tyrosine kinases. The main physiological receptor for insulin is the insulin receptor, while the IGFs mainly exert their effects through the IGF-I receptor (7, 8). The insulin receptor exists under two isoforms, A and B, due to alternative splicing of exon 11 of the insulin receptor gene (9, 10).

Insulin-like growth factor-II in mammals also binds to the IGF-II/cation-independent mannose-6-phosphate receptor, which is thought to act as a scavenger for IGF-II rather than a signaling receptor (11, 12). Its presence on most cells however complicates the study of IGF-II binding and signaling mediated through the IGF-I receptor.

Binding of the ligands to the insulin or IGF-I receptor leads to autophosphorylation of the receptor on tyrosine residues. This creates binding sites for SH2 and PTB domain-containing docking proteins such as IRS-1–4 and Shc, and stimulates the tyrosine kinase activity of the receptor, enabling it to phosphorylate multiple cytoplasmic substrates, which activates signaling cascades, resulting in ligand-specific biological effects (4, 13).

Both the ligands and the receptors are closely related (and therefore the ligands can bind to their non-cognate receptors) and the signaling pathways they activate are largely overlapping (14). Microarray profiling showed that the two receptors are capable of stimulating the same gene expression response (15). Nevertheless, insulin is mainly a metabolic regulator, while the IGFs exert mainly mitogenic effects (growth, proliferation …). The molecular basis of this signaling specificity is still not understood (6, 16).

As mentioned, the three ligands can also bind to their non-cognate receptors, though with lower affinity, and by doing so they can exert different effects in comparison to the cognate ligand. Frasca et al. and Morrione et al., e.g., showed independently that IGF-II is more potent in stimulating proliferation through the insulin receptor A isoform than insulin (17, 18). Frasca et al. also showed that insulin is a more potent metabolic regulator through this isoform than IGF-II (17). Pandini et al. found that insulin and IGF-II induce different gene expression patterns after binding to the A isoform of the insulin receptor (19). Malaguarnera et al. found that proinsulin binds with high affinity the insulin receptor isoform A and predominantly activates the mitogenic pathway (20). Also, insulin analogs with different residence times on the insulin receptor have been shown to have different relative potencies for mitogenic versus metabolic signaling (2123). Previous work from our laboratory has described an insulin mimetic peptide that despite binding to the insulin receptor with an affinity similar to insulin’s is less potent in stimulating thymidine incorporation and induces a different gene expression response in comparison to insulin (24). All in all, it is becoming increasingly clear that various ligands acting through the same receptor may activate different patterns of end-point cellular effects (“differential signaling”).

In this study we measured gene expression by microarray profiling after stimulating mouse fibroblasts expressing the IGF-I receptor, but devoid of insulin and IGF-II/cation-independent mannose-6-phosphate receptors (25) with equipotent concentrations of insulin, IGF-I, and IGF-II. During the analysis the focus was on finding differences, rather than similarities, in gene expression between the three ligands. The results show that insulin, IGF-I, and IGF-II indeed create different gene expression responses when stimulating the IGF-I receptor. We hope that these results and further studies will lead to a better understanding of the signaling specificity and different biological effects of these three ligands.

Materials and Methods

Materials

Fibroblasts from mice knockout for IGF-II and the IGF-II/cation-independent mannose-6-phosphate receptor were a gift from Dr. Kurt von Figura (25). Insulin was from Novo Nordisk A/S, Denmark, and IGF-I and IGF-II from Novozymes GroPep, Thebarton, SA, Australia. 125I-IGF-I was prepared by Novo Nordisk A/S. Unless otherwise specified all chemicals were from Sigma-Aldrich, Denmark.

Cell line and culture conditions

The mouse fibroblasts were routinely cultured in 80 cm2 TC flasks (Nunc, Denmark) in DMEM medium (with Glutamax-1 and 4.5 g/l glucose; Gibco, Invitrogen, Denmark) supplemented with 10% Fetal Bovine Serum (Gibco, Invitrogen, Denmark), 100 U/ml Penicillin, and 100 μg/ml Streptomycin (Gibco, Invitrogen, Denmark). The cells were grown at 37°C in a 5% CO2 humidified atmosphere. They were passaged three times a week by washing in D-PBS (w/o Calcium and Magnesium; Gibco, Invitrogen, Denmark), trypsinization in Trypsin-EDTA (Gibco, Invitrogen, Denmark), and subsequent resuspension and dilution in fresh medium.

The mouse fibroblasts, devoid of IGF-II and the IGF-II/cation-independent mannose-6-phophate receptor, did not bind 125I-insulin, indicating the absence of biologically active insulin receptors (results not shown), but did bind 125I-IGF-I. From the below mentioned homologous competition assay data, we found that approximately 75,000 IGF-I receptor sites/cell are present on this cell line.

Determining the affinities of IGF-I, IGF-II, and insulin for the IGF-I receptor

To determine the apparent affinities of the ligands for the IGF-I receptor on the mouse fibroblast cell line, homologous and heterologous radioligand competition assays were performed in quadruplets. Cells were detached with 10 mM EDTA (Gibco, Invitrogen, Denmark). Three million cells per milliliter were incubated with a constant concentration of 125I-IGF-I (20,000 cpm/ml) and increasing concentrations of cold IGF-I, IGF-II, or insulin for 2.5 h (time needed to reach steady-state binding) at 15°C in Hepes Binding Buffer (100 mM Hepes, 120 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 1 mM EDTA, 10 mM Glucose, 15 mM Na Acetate, and 1% BSA). After centrifugation unbound 125I-IGF-I was removed and cell-bound 125I-IGF-I was counted in a Wallac WIZARD gamma counter (PerkinElmer). Kd values were calculated after fitting the data to a one-site model using a program developed in our laboratory by Ronald M. Shymko and Andreas V. Groth.

Preparation of the cells for the microarray experiments

Mouse fibroblasts were seeded out into 145 cm2 TC dishes (Nunc, Denmark) at two million cells per dish and subsequently allowed to recover for 24 h. In quadruplets, but at the same cell passage and after washing the cells twice with D-PBS (w/o Calcium and Magnesium; Gibco, Invitrogen, Denmark), the cells were serum starved for 24 h and afterward either left unstimulated or stimulated for 4 h with 20 nM IGF-I, 177 nM IGF-II, or 5168 nM insulin. These concentrations compensate for the relative affinities of the ligands for the receptor, measured as described above.

Isolation and purification of total RNA

Total RNA was isolated by using the TRI® reagent method (Molecular Research Gene, USA) and cleaned up using the RNeasy™ Mini Kit (Qiagen) according to the manufacturers’ protocol. RNA quality was verified by 1% agarose gel electrophoresis. Concentration and purity were determined by measuring absorbance at A260 and A280 in a spectrophotometer (Brinkmann Eppendorf BioPhotometer, Germany).

cRNA generation and hybridization to gene chip microarrays

cRNA was produced using the One-cycle Target Labeling Kit (Affymetrix, Santa Clara, CA, USA). One-cycle Target Labeling Kit and procedures followed protocols in the GeneChip Expression Analysis Technical Manual (Affymetrix, Santa Clara, CA, USA). Fragmented biotin-labeled cRNA was hybridized to Affymetrix GeneChip® Mouse Genome 430 2.0 Arrays according to manufacturer’s protocol. The arrays were incubated at 45°C for 16 h under rotation (60 rpm), washed in the GeneChip® Fluidics Station (Affymetrix) and scanned using the GeneChip® Scanner 3000.

Data analysis

The quality of the arrays was verified by quality control in the R package1 from Bioconductor2. The probe level data (CEL files) were transformed into expression values using R and the GC-RMA package from Bioconductor (see text footnote 2) (26). Briefly, the background was subtracted, the data were normalized by the quantile normalization method and the expression values of a probe set were summarized into one expression value.

For data analysis, the expression values were imported into the software package DNA-Chip Analyzer (dChip) (version 2008), freeware developed by Li and Wong (27)3. When generating original lists of transcripts, a fold change and p-value cut-off of respectively 1.2 and 0.05 were chosen. The lower confidence bound of fold changes was used for filtering and the threshold for absolute difference between two group means was set to 35. Using these cut-offs gave empirical median false discovery rates (FDR) of maximum 2% after running 100 permutations in dChip (FDRs were 0% for all but the lists of genes regulated by insulin, IGF-I, or IGF-II in comparison to the control). dChip recommends a median FDR of ¡5 or 10%. Composing a list of transcripts regulated by insulin, IGF-I, and IGF-II together or separately was done by selecting transcripts that fulfilled the above-mentioned criteria for the ligands in comparison to the control. In order to generate lists containing transcripts only regulated by one of the ligands, transcripts were selected that fulfilled the criteria for one of the ligands in comparison to the control and in comparison to the two other ligands. Transcripts that also fulfilled the criteria for one of the other ligands in comparison to the control were excluded. The resulting transcripts, uniquely regulated by one of the ligands, were afterward filtered for a fold change of 1.5 in comparison to the control, in order to focus the below mentioned functional analysis on the transcripts with the highest biological relevance. In order to study differences between one ligand and the two other ligands as a group, transcripts were selected that fulfilled the criteria for the two ligands in comparison to the control and to the other ligand. The resulting transcripts were afterward filtered for a fold change of 1.5 in comparison to the control, in order to focus the below mentioned functional analysis on the transcripts with the highest biological relevance.

Identification of gene function themes and canonical pathways was done using the web-based software Ingenuity Pathways Analysis (IPA)4. IPA takes the gene IDs in the dataset file and maps them to genes in the Ingenuity Pathways Knowledge Base (IPKB). The functional and canonical pathway analyses identified the molecular and cellular functions and canonical pathways that were most significant to the data set. This significance value is a measure for how likely it is that genes from the dataset file under investigation participate in that function. In this method, the p-value is calculated by comparing the number of user-specified genes of interest that participate in a given function or pathway, relative to the total number of occurrences of these genes in all functional/pathway annotations stored in the IPKB. Ingenuity uses a right-tailed Fisher’s Exact Test in order to calculate a p-value. In the right-tailed Fisher’s Exact Test, only over-represented functional/pathway annotations, annotations which have more Functions/Canonical Pathways Analysis Genes than expected by chance (“right-tailed” annotations), are used.

Preparation of total RNA for qRT-PCR

To validate the microarray data two-step RT-PCR was performed on a subset of genes. To perform the validation on biological replicates, new (in comparison to the RNA used for the arrays) total RNA samples were prepared at three different cell passages.

qRT-PCR

The total RNA was reverse transcribed into single-stranded cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science) according to the manufacturer’s protocol. The cDNA was transcribed using FastStart TaqMan Probe Master (Rox) (Roche Applied Science). Probes were purchased from Universal ProbeLibrary (Roche). Probes were selected and primer sequences designed using the ProbeFinder software (Universal ProbeLibrary, Roche). The primers were purchased from DNA-technologies, Denmark. Primers and probes used are listed in Table 1. Per qRT-PCR assay the cDNA samples were run in quadruplets with 18S as the internal control gene, in 384-well optical plates on an ABI 7900HT Prism sequence detection system (Applied Biosystems). Each 15 μl TaqMan reaction contained 1.5 μl cDNA, 7.5 μl 2× FastStart TaqMan Probe Master (Rox), 0.15 μl Universal Probe (10 μM), 0.15 μl left primer (20 μM), 0.15 μl right primer (20 μM), and 5.55 μl PCR-grade water. PCR parameters were 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. For each gene and for each biological replicate TaqMan PCR assays were performed in triplicates. The data were analyzed using Sequence Detector Software (Applied Biosystems), where after the fold changes were calculated by use of the ΔΔCt method (28). To compare the qRT-PCR data with the microarray results, negative microarray fold changes were converted into values between 0 and 1. When multiple probe sets for one gene were regulated on the microarrays, the average fold change was calculated. Significant differences in the qRT-PCR data were calculated by a two-tailed t-test.

Table 1

TranscriptAccession nr.Universal probe no.PrimerSequence 5′–3′
18S77leftgattgatagctctttctcgattcc
Rightgacaaatcgctccaccaact
Ccnd1 (cyclin D1)NM_00763167Leftgagattgtgccatccatgc
Rightctcttcgcacttctgctcct
Areg (amphiregulin)NM_00970473Leftgacaagaaaatgggactgtgc
Rightggcttggcaatgattcaact
Egr2 (early growth response 2)X0674660Leftctacccggtggaagacctc
NM_010118Rightaatgttgatcatgccatctcc
HB-EGF (heparin-binding EGF-like growth factor)L0726455Leftcgtgggacttctcatgtttagg
NM_010415Rightcgcccaacttcactttctct
Dusp6 (dual specificity phosphatase 6)NM_02626866Lefttggtggagagtcggtcct
Righttggaacttactgaagccacctt
Jun-B (Jun-B oncogene)NM_0084163Leftaccacggagggagagaaaag
Rightagttggcagctgtgcgtaa

Primers and probes used for qRT-PCR.

Results

Affinities of IGF-I, IGF-II, and insulin for the IGF-I receptor

In order to stimulate the IGF-I receptor on mouse fibroblasts with concentrations that are adjusted for the relative affinities of IGF-I, IGF-II, and insulin for the receptor, the apparent affinities of the three ligands were measured by allowing the cold ligands to compete with 125I-IGF-I for binding to the IGF-I receptor (Figure 1). IGF-I had a Kd value of 1.49 ± 0.14 nM, IGF-II a Kd value of 13.11 ± 0.69 nM, and insulin of 383 ± 27 nM. These results are in accordance with the known relative affinities of the ligands for the IGF-I receptor (29). Taking these relative affinities into account, it was decided to stimulate the cells for 4 h with 20 nM IGF-I, 177 nM IGF-II, or 5168 nM insulin, concentrations then are near saturation of the receptor with either ligand.

Figure 1

Global gene regulation patterns

A total of 698 transcripts were regulated by both insulin and the IGFs (fold changes and p-values for these transcripts are in Table S1 in Supplementary Material). Table 2 shows the number of transcripts regulated by each ligand in comparison to the control and the number of transcripts commonly regulated between ligands. Fold changes and p-values for these transcripts can be found in Table S2 in Supplementary Material (IGF-I), Table S3 in Supplementary Material (IGF-II), and Table S4 in Supplementary Material (insulin). All the transcripts regulated in common between ligands were either up-regulated by all regulating ligands or down-regulated by all regulating ligands. Even though the three ligands stimulate similar responses, the overlap is partial and we identified transcripts selectively regulated by each ligand.

Table 2

Transcripts regulated in comparison to controlFraction of transcripts also regulated by IGF-IFraction of transcripts also regulated by IGF-IIFraction of transcripts also regulated by insulin
IGF-I27151213754
IGF-II17791213956
Insulin1215754956

Global gene regulation patterns.

The number of transcripts regulated by each of the three ligands in comparison to the control and the number of transcripts commonly regulated between ligands (in comparison to the control) are shown. Cut-offs for fold change and p-value are 1.2 and 0.05 respectively.

Transcripts selectively regulated by IGF-I, IGF-II, or insulin

Transcripts selectively regulated by IGF-I

A total of 75 transcripts were only regulated by IGF-I (Table 3; fold change cut-off 1.5). Fold changes and p-values for insulin and IGF-II can be found in Table S5 in Supplementary Material.

Table 3

TranscriptProbe set (Affymetrix)Accession nr.Fold changep-Value
Eif5: eukaryotic translation initiation factor 51415723_atBQ1769891.540.000187
Srp54a /// Srp54b /// Srp54c: signal recognition particle 54a /// signal recognition particle 54b /// signal recognition particle 54C1416153_atNM_0118991.550.003558
Pafah1b1: platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit1417086_atBE6883821.690.005799
Dnaja2: DnaJ (Hsp40) homolog, subfamily A, member 21417182_atC775091.670.000129
Orc2l: origin recognition complex, subunit 2-like (S. cerevisiae)1418226_atBB8309761.770.000088
Ctcf: CCCTC-binding factor1418330_atBB8368881.530.026056
AI837181: expressed sequence AI8371811418775_atNM_134149−1.860.007512
Il17rc: interleukin 17 receptor C1419671_a_atNM_134159−1.800.006468
Supt16h: suppressor of Ty 16 homolog (S. cerevisiae)1419741_atAW5367051.520.002900
Nap1l1: nucleosome assembly protein 1-like 11420477_atBG0640311.510.000989
Shoc2: soc-2 (suppressor of clear) homolog (C. elegans)1423129_atBQ0326851.510.000692
Lin7c: lin-7 homolog C (C. elegans)1423322_atBQ1766121.680.000844
Stk17b: serine/threonine kinase 17b (apoptosis-inducing)1423452_atAV1731391.640.000103
Usp1: ubiquitin specific peptidase 11423675_atBC0181791.550.008911
Nop14: NOP14 nucleolar protein homolog (yeast)1423991_atBC0249981.750.001692
Uso1: USO1 homolog, vesicle docking protein (yeast)1424274_atBC0160691.770.002483
Flad1: RFad1, flavin adenine dinucleotide synthetase, homolog (yeast)1424421_atBC006806−1.590.004350
Rbm26: RNA binding motif protein 261426803_atBM1204711.710.031929
Ythdf3: YTH domain family 31426841_atBB1832081.680.014072
Rbbp8: retinoblastoma binding protein 81427061_atBB1670671.560.000050
Zc3h15: zinc finger CCCH-type containing 151427876_atBB7030701.650.000917
Zmpste24: zinc metallopeptidase, STE24 homolog (S. cerevisiae)1427923_atBM2337931.520.005861
Spin4: spindlin family, member 41427985_atBC0277962.170.001115
Fip1l1: FIP1 like 1 (S. cerevisiae)1428280_atBM1998741.590.022198
2810026P18Rik: RIKEN cDNA 2810026P18 gene1428529_atAK0128251.570.016748
Uba6: ubiquitin-like modifier activating enzyme 61428945_atBB4173601.730.001773
Cep57: centrosomal protein 571428968_atAW4576821.580.006762
Nat13: N-acetyltransferase 131428970_atAV1138781.820.000018
1300003B13Rik: RIKEN cDNA 1300003B13 gene1429690_atAK0048701.560.012148
9030419F21Rik: RIKEN cDNA 9030419F21 gene1433101_atAK018519−1.700.026402
Ddx52: DEAD (Asp-Glu-Ala-Asp) box polypeptide 521434608_atBB1324741.710.001952
Ankle2: ankyrin repeat and LEM domain containing 21434721_atAV3788491.500.009946
Wapal: wings apart-like homolog (Drosophila)1434835_atBM2305231.590.006908
Tsr2: TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)1435170_atBQ1771871.890.021023
Ube2n: ubiquitin-conjugating enzyme E2N1435384_atBE9806851.790.000704
Trpm4: transient receptor potential cation channel, subfamily M, member 41435549_atBI685685−1.590.007237
Scyl2: SCY1-like 2 (S. cerevisiae)1436313_atBM2498021.910.003117
Mmgt1: membrane magnesium transporter 11436705_atBB2622181.890.000040
Exoc5: exocyst complex component 51436817_atAV0259131.700.003981
B230380D07Rik: RIKEN cDNA B230380D07 gene1436841_atAV2293361.840.040661
Arl13b: ADP-ribosylation factor-like 13B1437021_atAV2259591.590.000559
Eif1ay: eukaryotic translation initiation factor 1A, Y-linked1437071_atBB4715761.550.024542
Slc18a2: solute carrier family 18 (vesicular monoamine), member 21437079_atAV3346382.710.002010
Rnps1: ribonucleic acid binding protein S11437359_atBI793607−1.550.017189
Acvr2a: activin receptor IIA1437382_atBG0661071.710.005407
Mm.138561.11438307_atAV3177321.540.008071
Fars2: phenylalanine-tRNA synthetase 2 (mitochondrial)1439406_x_atBB530332−1.560.015768
Sgol1: shugoshin-like 1 (S. pombe)1439510_atBB4105371.560.000354
Mm.44035.11440222_atBB530180−1.870.004195
Mm.33045.11440272_atBB2324731.580.001142
Sbno2: strawberry notch homolog 2 (Drosophila), mRNA (cDNA clone IMAGE:3376209)1441840_x_atBB533975−2.240.002180
Mm.37220.11444785_atAI503808−1.720.011949
… Predicted gene/similar to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) …1447999_x_atAI840508−1.530.005202
Rab1: RAB1, member RAS oncogene family1448210_atAW1084051.650.000205
Lrrfip1: leucine rich repeat (in FLII) interacting protein 11448487_atNM_0085151.600.002779
Pafah1b1: platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit1448578_atBE6883821.660.001433
Siah1a: seven in absentia 1A1449733_s_atAA9820641.660.006169
Kpna3: karyopherin (importin) alpha 31450386_atBM2138281.530.006954
Twsg1: twisted gastrulation homolog 1 (Drosophila)1450388_s_atBC0048501.540.003421
Stk17b: serine/threonine kinase 17b (apoptosis-inducing)1450997_atAV1731392.040.003338
Yipf3: Yip1 domain family, member 31451284_atBC019384−1.640.026951
LOC100044383 /// Pnpt1: similar to polynucleotide phosphorylase-like protein /// polyribonucleotide nucleotidyltransferase 11452676_a_atBB7778151.670.000248
6820431F20Rik: RIKEN cDNA 6820431F20 gene1452997_atBE6923991.850.009694
Gas2l3: growth arrest-specific 2-like 31453416_atBE1992112.050.004200
Usp15: ubiquitin specific peptidase 151454036_a_atAK0148911.570.028362
Arfip1: ADP-ribosylation factor interacting protein 11454916_s_atAV0874171.590.000091
Alg10b: asparagine-linked glycosylation 10 homolog B (yeast, alpha-1,2-glucosyltransferase)1454917_atBB7952061.630.007541
Mm.24436.11455206_atBQ1752761.510.014053
Ccdc127: coiled-coil domain containing 1271455248_atAW5427861.710.000473
Map3k7: mitogen-activated protein kinase kinase kinase 71455441_atAW5473741.770.003661
Mm.178349.11456547_atBM119402−2.020.026517
Lyrm5: LYR motif containing 5 (Lyrm5), mRNA1459793_s_atAV3019441.720.009359
Dnaja1: DnaJ (Hsp40) homolog, subfamily A, member 11460179_atBF1410761.750.000232
Sfrs2ip: splicing factor, arginine/serine-rich 2, interacting protein1460445_atAK0120921.630.000533
AI848100: expressed sequence AI8481001460573_atBM2406841.510.000521

Transcripts selectively regulated by IGF-I.

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for IGF-I versus the control and versus insulin and IGF-II were selected. Transcripts also regulated by insulin or IGF-II versus the control were excluded. The transcripts were then filtered for a fold change of 1.5 in comparison to the control.

According to IPA the top five molecular and cellular functions these transcripts are involved in are molecular transport, protein trafficking, post-translational modification, protein folding, and cell morphology.

Transcripts selectively regulated by IGF-II

Eight transcripts were only regulated by IGF-II (see Table 4; fold change cut-off 1.5; for fold changes and p-values for insulin and IGF-I: see Table S6 in Supplementary Material). Two of these transcripts were TNF receptor-associated factor 1 (Traf1) and TRAF and TNF receptor-associated protein (Ttrap), which are functionally related proteins.

Table 4

TranscriptProbe set (Affymetrix)Accession nr.Fold changep-Value
Jun oncogene1417409_atNM_0105911.720.002886
LOC100046232 /// Nfil3: similar to NFIL3/E4BP4 transcription factor /// nuclear factor, interleukin 3, regulated1418932_atAY0617601.550.007144
expressed sequence AI4676061433465_a_atBB2343371.990.004292
MOB1, Mps one binder kinase activator-like 2A (yeast)1434388_atBB0238681.500.006665
LOC632433: ADP-ribosylation factor-like 4C /// similar to ADP-ribosylation factor-like protein 71436512_atBI9644001.750.005263
LOC634417: fos-like antigen 2 /// similar to fos-like antigen 21437247_atBM2451701.780.007075
TNF receptor-associated factor 1 (Traf1), mRNA1445452_atBB2182451.770.022057
Traf and TNF receptor-associated protein1448706_atNM_019551−1.680.000103

Transcripts selectively regulated by IGF-II.

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for IGF-II versus the control and versus insulin and IGF-I were selected. Transcripts also regulated by insulin or IGF-I versus the control were excluded. The transcripts were then filtered for a fold change of 1.5 in comparison to the control.

Transcripts selectively regulated by insulin

Four transcripts were only regulated by insulin (see Table 5; fold change cut-off 1.5; for fold changes and p-values for IGF-I and IGF-II: see Table S7 in Supplementary Material).

Table 5

TranscriptProbe set (Affymetrix)Accession nr.Fold changep-Value
Solute carrier family 39 (zinc transporter), member 101433751_atBM250411−2.010.001528
Mm.168098.11444326_atBB4144841.550.030559
Kruppel-like factor 61447448_s_atC86813−2.350.009036
Kruppel-like factor 61433508_atAV025472−1.590.011606

Transcripts selectively regulated by insulin.

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for insulin versus the control and versus IGF-I and IGF-II were selected. Transcripts also regulated by IGF-I or IGF-II versus the control were excluded. The transcripts were then filtered for a fold change of 1.5 in comparison to the control.

Gene regulation patterns of ligand pairs

Transcripts selectively or more potently regulated by the IGFs than by insulin

Sixty five transcripts fulfilled the set criteria for IGF-I and IGF-II in comparison to the control and to insulin. The IGFs regulated 46 transcripts that were not regulated by insulin in comparison to the control (Table 6). Interestingly, the 19 transcripts that were also regulated by insulin were always more regulated by the IGFs than by insulin.

Table 6

TranscriptProbe set (Affymetrix)Accession nr.FC IGF-Ip-Value IGF-IFC IGF-IIp-Value IGF-IIFC insulinp-Value insulin
Dusp6: dual specificity phosphatase 61415834_atNM_0262682.960.0000374.450.0001141.660.024401
Jun-B: Jun-B oncogene1415899_atNM_0084161.970.0004703.030.0001851.220.107818
Klf10: Kruppel-like factor 101416029_atNM_0136922.280.0060072.580.0004661.340.004550
Errfi1: ERBB receptor feedback inhibitor 11416129_atNM_1337532.480.0000093.300.0007971.500.002918
Nfe2l2: nuclear factor, erythroid derived 2, like 21416543_atNM_0109021.770.0000451.590.0000111.100.286909
Egr1: early growth response 11417065_atNM_0079132.060.0000052.510.0001521.370.002267
Ptgs2: prostaglandin-endoperoxide synthase 21417262_atM949675.010.0023215.830.0014151.880.001026
Ptgs2: prostaglandin-endoperoxide synthase 21417263_atM949675.120.0040355.860.0035441.820.010523
Klf4: Kruppel-like factor 4 (gut)1417394_atBG0694132.930.0002772.910.0019101.340.019087
Klf4: Kruppel-like factor 4 (gut)1417395_atBG0694132.380.0001362.360.0015091.100.330387
Ccnd1: cyclin D11417420_atNM_0076312.190.0008122.490.0006051.530.008594
Ddit3: DNA-damage inducible transcript 31417516_atNM_0078373.900.0000223.520.0074831.950.003623
Bhlhe40: basic helix-loop-helix family, member e401418025_atNM_0114982.420.0000263.460.0005761.660.005081
Rbpj: recombination signal binding protein for immunoglobulin kappa J region1418114_atNM_0090351.640.0015031.640.042760−1.010.869918
HB-EGF: heparin-binding EGF-like growth factor1418349_atL072642.930.0003894.110.0038611.670.016481
HB-EGF: heparin-binding EGF-like growth factor1418350_atL072642.370.0008793.430.0028781.390.003493
Fzd2: frizzled homolog 2 (Drosophila)1418533_s_atBB371406−2.730.002491−2.720.001879−1.740.008244
Snai2: snail homolog 2 (Drosophila)1418673_atNM_0114152.550.0038332.430.0164381.450.039762
Arc: activity regulated cytoskeletal-associated protein1418687_atNM_0187903.460.0047665.510.0146181.720.065388
Phlda1: pleckstrin homology-like domain, family A, member 11418835_atNM_0093442.500.0000163.420.0001371.450.006783
Ereg: epiregulin1419431_atNM_0079503.810.0039894.980.0072241.590.013385
Errfi1: ERBB receptor feedback inhibitor 11419816_s_atAI7887552.180.0003032.820.0030841.430.013860
Vegfa: vascular endothelial growth factor A1420909_atNM_0095053.570.0030033.600.0010702.140.049047
Areg: amphiregulin1421134_atNM_00970418.390.00444332.850.0013666.460.018404
Hmga2: high mobility group AT-hook 21422851_atX583802.170.0127652.900.0152821.200.178787
Fos: FBJ osteosarcoma oncogene1423100_atAV0266172.790.0003013.580.0009881.430.011280
Spred1: sprouty protein with EVH-1 domain 1, related sequence1423160_atBQ0442901.650.0020151.790.0035871.180.246347
Spred1: sprouty protein with EVH-1 domain 1, related sequence1423161_s_atBQ0442902.040.0036841.950.0044571.240.055176
Socs5: suppressor of cytokine signaling 51423350_atAA5107131.740.0002382.150.0016241.250.041765
Eif1a: eukaryotic translation initiation factor 1A1424344_s_atBM2005912.330.0047171.790.0235391.120.358396
Myc: myelocytomatosis oncogene1424942_a_atBC0067282.570.0015223.410.0014571.570.004404
Ppm1a: protein phosphatase 1A, magnesium dependent, alpha isoform1425537_atAF2596721.910.0211881.700.0229081.020.912487
Egr2: early growth response 21427682_a_atX067462.390.0005713.210.001597−1.030.747696
Egr2: early growth response 21427683_atX067462.350.0000023.190.000841−1.160.214812
Cdc42ep2: CDC42 effector protein (Rho GTPase binding) 21428750_atBF453885−2.770.000119−2.530.000292−1.300.080566
Dusp4: dual specificity phosphatase 41428834_atAK0125303.660.0057285.330.0033731.530.118230
Zbtb2: zinc finger and BTB domain containing 21434901_atBB4849751.710.0089941.680.0049701.190.019503
Btaf1: BTAF1 RNA polymerase II, B-TFIID transcription factor-associated (Mot1 homolog, S. cerevisiae)1435249_atBG9175042.280.0015431.990.0035861.340.009186
Prkg2: protein kinase, cGMP-dependent, type II1435460_atBB3631882.410.0003172.390.0106221.260.091109
Tmcc3: transmembrane and coiled-coil domains 31435554_atBB7718882.940.0005702.850.0002561.800.009428
1810011O10Rik: RIKEN cDNA 1810011O10 gene1435595_atAV0163742.140.0016402.010.0025081.010.959922
Egr3: early growth response 31436329_atAV3466073.820.0000135.320.0050821.230.105988
Marveld1: MARVEL (membrane-associating) domain containing 11436830_atBB324084−1.910.000054−1.680.007970−1.070.296806
Mex3b: mex3 homolog B (C. elegans)1437152_atBG0728372.660.0007213.020.0184071.210.436275
Bmp2k: BMP2 inducible kinase1437419_atBB3294392.350.0033442.020.0000291.390.033634
Zfp36l2: zinc finger protein 36, C3H type-like 21437626_atBB0317912.150.0003012.530.0110931.430.036717
C130039O16Rik: RIKEN cDNA C130039O16 gene1444107_atBB0913571.600.0104861.690.022667−1.020.894938
Snai2: snail homolog 2 (Drosophila)1447643_x_atBB0404433.220.0106882.430.0032491.480.071908
Pogk: pogo transposable element with KRAB domain1447864_s_atAV3777122.200.0162232.040.0034671.310.014693
Myd116: myeloid differentiation primary response gene 1161448325_atNM_0086542.000.0001792.010.0067341.240.070585
Jun: Jun oncogene1448694_atNM_0105911.780.0087931.900.0119241.040.807786
Atf3: activating transcription factor 31449363_atBC0199462.880.0013912.900.0044511.920.005831
Ces1: carboxylesterase 11449486_atNM_021456−2.010.018317−1.960.023919−1.160.351288
Hmga2: high mobility group AT-hook 21450780_s_atX583802.740.0062983.290.0101651.430.035048
Hmga2: high mobility group AT-hook 21450781_atX583802.360.0182093.220.0076111.310.019092
Gtpbp4: GTP binding protein 41450873_atAI9878343.100.0002362.750.0065831.870.002062
Pvr: poliovirus receptor1451160_s_atBB0491382.210.0112382.130.0024681.470.001190
Arl4c /// LOC632433: ADP-ribosylation factor-like 4C /// similar to ADP-ribosylation factor-like protein 71454788_atBQ1763061.700.0055221.570.0220031.000.976940
Zbtb11: zinc finger and BTB domain containing 111454826_atBM1951152.040.0012401.780.0153611.110.277271
Foxn2: forkhead box N21454831_atAV2210132.850.0005162.850.0042671.710.037944
Tmcc3: transmembrane and coiled-coil domains 31454889_x_atBB7119901.990.0001201.890.0032921.290.001608
Spty2d1: SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)1455130_atBM2425242.060.0003392.040.0004951.340.043771
Plcxd2: phosphatidylinositol-specific phospholipase C, X domain containing 21455324_atBQ1761764.030.0009713.500.0057662.210.007254
LOC631639 /// Lonrf1: similar to CG32369-PB, isoform B /// LON peptidase N-terminal domain and ring finger 11455665_atBB7056894.560.0032394.170.0020872.170.008852
Nfkbie: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon1458299_s_atBB8204411.710.0009891.940.0028731.240.053832

Transcripts selectively or more potently regulated by the IGFs than by insulin.

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for IGF-I and IGF-II versus the control and versus insulin were selected. The transcripts were then filtered for a fold change of 1.5 in comparison to the control. Transcripts that also fulfilled the criteria for insulin versus the control are in italic. FC, fold change.

The top five molecular and cellular functions in IPA for these genes were cellular development, cellular growth and proliferation, cell cycle, gene expression, and cell death and survival. Two of the top five canonical pathways represented by these genes were ErbB signaling and neuregulin signaling. The regulated transcripts in these pathways were amphiregulin, epiregulin, heparin-binding EGF-like growth factor, FBJ osteosarcoma oncogene, and Jun oncogene for ErbB signaling and amphiregulin, epiregulin, heparin-binding EGF-like growth factor, ERBB receptor feedback inhibitor 1, and myelocytomatosis oncogene for neuregulin signaling.

Selective gene regulation by insulin and IGF-II

Twenty transcripts fulfilled the criteria for insulin and IGF-II in comparison to the control and to IGF-I (Table 7). Fourteen of these were not influenced by IGF-I in comparison to the control, while they were either down-regulated or up-regulated by insulin and IGF-II.

Table 7

TranscriptProbe set (Affymetrix)Accession nr.FC insulinp-Value insulinFC IGF-IIp-Value IGF-IIFC IGF-Ip-Value IGF-I
Dusp6: dual specificity phosphatase 61415834_atNM_0262681.660.0244014.450.0001142.960.000037
Nusap1: nucleolar and spindle associated protein 11416309_atBC009096−1.610.000141−1.610.000022−1.140.097812
Ndc80: NDC80 homolog, kinetochore complex component (S. cerevisiae)1417445_atNM_023294−1.730.000121−1.610.000253−1.160.056240
Ghr: growth hormone receptor1417962_s_atNM_010284−1.670.008693−1.690.008944−1.150.197168
Bhlhe40: basic helix-loop-helix family, member e401418025_atNM_0114981.660.0050813.460.0005762.420.000026
Nfyb: nuclear transcription factor-Y beta1419267_atAV2504961.530.0079961.600.0058832.430.005169
Areg: amphiregulin1421134_atNM_0097046.460.01840432.850.00136618.390.004443
PQlc2: PQ loop repeat containing 21425632_a_atBC0192162.310.0010272.120.0010761.400.029326
Cebpb: CCAAT/enhancer binding protein (C/EBP), beta1427844_a_atAB0122781.740.0185531.800.0055861.130.445063
Sema3c: sema domain, immunoglobulin domain (Ig), short basic domain, secreted (semaphorin) 3C1429348_atAK004119−1.700.006766−1.720.0088021.030.733222
Cyld: cylindromatosis (turban tumor syndrome)1429617_atBM119209−1.610.005787−1.500.003897−1.030.807135
Bop1: block of proliferation 11430491_atAV1283501.780.0135561.930.0060391.040.820081
Rhobtb3: Rho-related BTB domain containing 31433647_s_atBM942043−1.620.027000−1.640.022981−1.020.890963
Sc5d: sterol-C5-desaturase (fungal ERG3, delta-5-desaturase) homolog (S. cerevisae)1434520_atAU0677032.180.0066262.250.0017253.340.000004
Foxp1: forkhead box P11435222_atBM220880−2.100.010890−1.940.017867−1.440.055486
Kif11: kinesin family member 111435306_a_atBM234447−1.920.003119−1.760.006149−1.200.115116
Ppm2c: protein phosphatase 2C, magnesium dependent, catalytic subunit1438201_atAV290622−2.180.000445−1.540.0281171.050.650024
Matr3: Matrin 3, mRNA (cDNA clone MGC:28206 IMAGE:3989914)1441272_atBI2491882.630.0046432.780.0006141.720.006058
Kif11: kinesin family member 111452314_atBB827235−2.020.003923−1.540.0173061.110.406989
Kif11: kinesin family member 111452315_atBB827235−1.850.000158−1.830.000706−1.130.347961

Selective gene regulation by insulin and IGF-II.

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for insulin and IGF-II versus the control and versus IGF-I were selected. The transcripts were then filtered for a fold change of 1.5 in comparison to the control. Transcripts that also fulfilled the criteria for IGF-I versus the control are in italic. FC, fold change.

The top five molecular and cellular functions in IPA for the 14 genes specifically regulated by insulin and IGF-II were cell cycle, cellular assembly and organization, DNA replication, recombination and repair, cellular function and maintenance, and cell morphology.

Gene regulation by insulin and IGF-I

Eleven transcripts fulfilled the criteria for insulin and IGF-I in comparison to the control and to IGF-II (Table 8). In contrast to the selective gene regulation by the IGFs and by insulin and IGF-II, 10 of these 11 transcripts were also, and more strongly, influenced by IGF-II.

Table 8

TranscriptProbe set (Affymetrix)Accession nr.FC insulinp-Value insulinFC IGF-Ip-Value IGF-IFC IGF-IIp-Value IGF-II
Dusp6: dual specificity phosphatase 61415834_atNM_0262681.660.0244012.960.0000374.450.000114
Slc40a1: solute carrier family 40 (iron-regulated transporter), member 11417061_atAF226613−2.630.000644−2.990.000973−4.480.000804
Fosl1: fos-like antigen 11417487_atU342453.850.0026714.540.0002917.870.003065
Fosl1: fos-like antigen 11417488_atU342454.480.0012785.310.0011608.690.001387
Bhlhe40: basic helix-loop-helix family, member e401418025_atNM_0114981.660.0050812.420.0000263.460.000576
Rgs2: regulator of G-protein signaling 21419248_atAF2156681.690.0031441.990.0339291.040.849605
Areg: amphiregulin1421134_atNM_0097046.460.01840418.390.00444332.850.001366
LOC100047324 /// Sesn1: similar to Sesn1 protein /// sestrin 11433711_s_atBG076140−1.630.016249−1.710.017257−2.640.002200
Plk3: polo-like kinase 3 (Drosophila)1434496_atBM9478552.740.0025072.210.0077194.790.000021
Mm.52043.11437199_atBB4427842.050.0357792.270.0226004.810.000445
D8Ertd82e: DNA segment, Chr 8, ERATO Doi 82, expressed1442434_atBM1958292.170.0085972.550.0047594.470.001872

Gene regulation by insulin and IGF-I.

Transcripts that fulfilled the criteria of 1.2 and 0.05 for fold change and p-value respectively for insulin and IGF-I versus the control and versus IGF-II were selected. The transcripts were then filtered for a fold change of 1.5 in comparison to the control. Transcripts that also fulfilled the criteria for IGF-II versus the control are in italic. FC, fold change.

Validation of the microarray data by qRT-PCR

To validate the microarray data qRT-PCR was performed for six transcripts on the total RNA of three independent biological replicates. These RNA samples are independent of the RNA used to generate the microarray data. Fold changes were calculated in comparison to the control and plotted in Figure 2. For the IGFs, the regulation trends from the microarray experiments (Table 6) are confirmed by qRT-PCR for all six genes: the IGFs regulate these genes more potently than insulin. For insulin, gene regulation (Table 6) was confirmed for four out of six genes (Areg, Egr2, HB-EGF, and Jun-B). In addition, for Ccnd1 the fold change was 1.51 on the array and 1.46 by qRT-PCR, two values that lay very close and are only just separated by the 1.5 fold change cut-off. In conclusion, the qRT-PCR data validate very well the microarray results.

Figure 2

Discussion

We compared the gene expression responses stimulated by insulin, IGF-I, and IGF-II through the IGF-I receptor using Affymetrix gene expression profiling. In order to eliminate the influence of the affinity of the ligands stimulating the receptor, we stimulated the IGF-I receptor on a mouse fibroblast cell line with concentrations of insulin, IGF-I, and IGF-II that compensated for the relative affinities of the ligands for the receptor on this cell line. Our analyses revealed that these three ligands stimulate overlapping but specific gene expression responses.

Some of the regulated transcripts that appeared in our analyses were also found by Mulligan et al. who studied the gene expression pattern after stimulating a chimeric receptor containing the intracellular domain of the IGF-I receptor (30), and Dupont et al. who studied gene expression after stimulation of the IGF-I receptor with IGF-I (31). As in our study, Mulligan et al., e.g., found the up-regulation of heparin-binding EGF-like growth factor and Dupont et al. found the up-regulation of early growth response 1 and Jun oncogene. The fact that transcripts regulated after stimulation of the IGF-I receptor with IGF-I found in our study and, e.g., the one by Dupont et al. only partially overlap, is most likely due to the differences in experimental set-up. We used a different cell line, concentrations of ligands, stimulation time, microarray platform and normalization, and analysis methods and criteria.

Boucher et al. recently showed that IGF-I and insulin, at equal concentrations, regulate the expression of the same genes through the IGF-I receptor (15). Insulin does that with a smaller magnitude of response than IGF-I. We show here that when compensating for the different affinities of the ligands, each ligand does specifically influence the expression of certain genes through the IGF-I receptor.

Each ligand specifically regulated a group of transcripts that was not regulated by the other two ligands. When stimulating the IGF-I receptor with IGF-II for example, two of the eight specifically regulated genes were Traf1 and Ttrap. Traf1 was up-regulated by IGF-II and is an inhibitor of apoptosis, which may be due to increased activation of nuclear factor-kappa B (NF-κB), an anti-apoptotic transcription factor (3234). Ttrap was down-regulated by IGF-II and inhibits the transcriptional activation of NF-κB (35). These results are consistent with the known anti-apoptotic activity of IGF-II through the IGF-I receptor.

In order to identify common gene regulation patterns between ligands, we studied the gene expression induced by two ligands in comparison to the control and to the third ligand. Interestingly, a group of 65 transcripts was identified to be selectively or more potently regulated by the IGFs than by insulin. ErbB signaling and neuregulin signaling were significant canonical pathways over-represented in the data set; regulated transcripts in common between the two pathways were amphiregulin, epiregulin, and heparin-binding EGF-like growth factor (HB-EGF). These were up-regulated more potently by the IGFs than by insulin. Pandini et al. showed that amphiregulin, HB-EGF, and epiregulin were similarly up-regulated by insulin and IGF-II through the insulin receptor isoform A in mouse fibroblasts (19). Mulligan et al. showed that HB-EGF transcript expression was up-regulated more potently after signaling through the IGF-I receptor than through the insulin receptor in fibroblasts (30). Amphiregulin, HB-EGF, and epiregulin are all EGF receptor (also named ErbB-1 or HER1) ligands (36). HB-EGF acts both as a regulated autocrine/paracrine and a juxtacrine growth factor (36, 37). Amphiregulin has been suggested to have both growth inhibitory and stimulatory effects (38). Epiregulin is a growth promoter in primary rat hepatocytes (39, 40) and an autocrine growth factor in human keratinocytes (41). HB-EGF and amphiregulin also bind and activate ErbB-3 and HB-EGF binds and activates ErbB-4 (42), just like the neuregulins, which bind ErbB-3 and ErbB-4. HB-EGF induces chemotaxis after stimulation of ErbB-4 (43).

As for the IGFs, we identified 14 transcripts selectively regulated by insulin and IGF-II. Using the same analysis criteria, this was however not the case when looking at insulin and IGF-I as a group. Ten of the 11 transcripts that were regulated by insulin and IGF-I in comparison to the control and IGF-II were also regulated by IGF-II. So the IGFs on one hand and insulin and IGF-II on the other hand seem to provoke more similar gene expression patterns than insulin and IGF-I. This is in accordance with the numbers presented in Table 2. Of all the transcripts regulated by insulin in comparison to the control, a larger fraction was also regulated by IGF-II than by IGF-I, even though IGF-I overall regulated more transcripts than IGF-II.

Although some of the transcripts identified in this study were involved in metabolic functions, the overall biological patterns were of a non-metabolic nature. This is not surprising, considering the tissue origin of the cell line used. From this study, no general conclusions could thus be drawn on whether certain ligands created a more metabolic or mitogenic response in comparison to the other ligands.

Many of the functions, pathways, and genes mentioned above are consistent with the known effects of insulin, IGF-I, and IGF-II. One could thus speculate that these differences in gene expression might account for some of the different biological effects of these three ligands. It should be mentioned that these gene expression patterns were measured after stimulating the receptor with supraphysiological concentrations of ligands. Therefore studying the concentration dependence of these gene expression profiles, together with performing time series of gene expression, could provide a more subtle picture.

Since the influences of affinity of the three ligands were largely accounted for in this study, it is likely that the differences in gene expression are due to intrinsic properties of each ligand. Different suggestions have been made to explain the mechanism responsible for this signaling specificity. Both differences in ligand binding kinetics and internalization properties have been correlated with different responses after stimulating the insulin receptor with different ligands (2123, 4446). More studies are needed in order to clarify at which level the cellular signal of different ligands stimulating the same receptor diverges.

Conclusion

We studied the gene expression patterns after stimulating the IGF-I receptor with equipotent concentrations of IGF-I, IGF-II, and insulin by microarray gene expression profiling and found significant differences in responses between the three ligands. Each ligand specifically regulated a group of transcripts that was not regulated by the other two ligands. Also, insulin and IGF-I seemed to stimulate the least overlapping response. The different gene expression profiles for the three ligands might explain some of their different biological effects. These results also add to the accumulating evidence that different ligands can bind to the same receptor and stimulate different cellular responses and that the nature of a ligand bound to a receptor, and not just its concentration and affinity, is determinant for the downstream cellular response. Further studies should help bringing a mechanistic understanding to the different functional consequences of different ligands activating the same receptor.

Supplementary Material

The Supplementary Material for this article can be found online at http://www.frontiersin.org/Molecular_and_Structural_Endocrinology/10.3389/fendo.2013.00098/abstract

Supplementary Table S1

Transcripts regulated by insulin and the IGFs.

Supplementary Table S2

Transcripts regulated by IGF-I.

Supplementary Table S3

Transcripts regulated by IGF-II.

Supplementary Table S4

Transcripts regulated by insulin.

Supplementary Table S5

Transcripts selectively regulated by IGF-I.

Supplementary Table S6

Transcripts selectively regulated by IGF-II.

Supplementary Table S7

Transcripts selectively regulated by insulin.

Statements

Acknowledgments

We thank Susanne Smed and Elisabeth Schiefloe for help with scanning of the microarrays. The Hagedorn Research Institute and the Receptor Systems Biology Laboratory were independent basic research components of Novo Nordisk A/S. Soetkin Versteyhe, Jane Palsgaard, and Maja Jensen were the recipient of an Industrial Ph.D. scholarship from the Danish Ministry of Science, Technology and Innovation. Steven Gray was the recipient of a BIO + IT postdoctoral fellowship from the Oresund IT Academy.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1

    CohenP. Overview of the IGF-I system. Horm Res (2006) 65(Suppl 1):38.10.1159/000090640

  • 2

    MonzaviRCohenP. IGFs and IGFBPs: Role in health and disease. Best Pract Res Clin Endocrinol Metab (2002) 16:43347.10.1053/beem.2002.0212

  • 3

    SaltielARKahnCR. Insulin signaling and the regulation of glucose and lipid metabolism. Nature (2001) 414:799806.10.1038/414799a

  • 4

    TaniguchiCMEmanuelliBKahnCR. Critical nodes in signaling pathways: insights into insulin action. Nat Rev Mol Cell Biol (2006) 7:8596.10.1038/nrm1837

  • 5

    SiddleK. Signalling by insulin and IGF receptors: supporting acts and new players. J Mol Endocrinol (2011) 47:R110.10.1530/JME-11-0022

  • 6

    SiddleK. Molecular basis of signalling specificity of insulin and IGF receptors: neglected corners and recent advances. Front Endocrinol (Lausanne) (2012) 3:34.10.3389/fendo.2012.00034

  • 7

    De MeytsP. Insulin and its receptor: structure, function and evolution. Bioessays (2004) 26:135162.10.1002/bies.20151

  • 8

    De MeytsPWallachBChristoffersenCTUrsø B, GrønskovKLatusLJet alThe insulin-like growth factor-I receptor. Structure, ligand-binding mechanism and signal transduction. Horm Res (1994) 42:15269.10.1159/000184188

  • 9

    MollerDEYokotaACaroJFFlierJS. Tissue-specific expression of two alternatively spliced insulin receptor mRNAs in man. Mol Endocrinol (1989) 3:12639.10.1210/mend-3-8-1263

  • 10

    SestiGTullioAND’AlfonsoRNapolitanoMLMariniMABorboniPet alTissue-specific expression of two alternatively spliced isoforms of the human insulin receptor protein. Acta Diabetol (1994) 31:5965.10.1007/BF00570536

  • 11

    SchmidtBKiecke-SiemsenCWaheedABraulkeTvon FiguraK. Localization of the insulin-like growth factor II binding site to amino acids 1508-1566 in repeat 11 of the mannose-6-phosphate/insulin-like growth factor II receptor. J Biol Chem (1995) 270:1497582.10.1074/jbc.270.25.14975

  • 12

    BrownJJonesEYForbesBE. Keeping IGF-II under control: lessons from the IGF-II-IGF2R crystal structure. Trends Biochem Sci (2009) 34:6129.10.1016/j.tibs.2009.07.003

  • 13

    LaviolaLNatalicchioAGiorginoF. The IGF-I signaling pathway. Curr Pharm Des (2007) 13:6639.10.2174/138161207780249146

  • 14

    DupontJLeRoithD. Insulin and insulin-like growth factor I receptors: similarities and differences in signal transduction. Horm Res (2001) 55(Suppl 2):226.10.1159/000063469

  • 15

    BoucherJTsengYHKahnCR. Insulin and insulin-like growth factor-1 receptors act as ligand-specific amplitude modulators of a common pathway regulating gene transcription. J Biol Chem (2010) 285:1723545.10.1074/jbc.M110.118620

  • 16

    KimJJAcciliD. Signaling through IGF-I and insulin receptors: where is the specificity?Growth Horm IGF Res (2002) 12:8490.10.1054/ghir.2002.0265

  • 17

    FrascaFPandiniGScaliaPSciaccaLMineoRCostantinoAet alInsulin receptor isoform A, a newly recognized, high-affinity insulin-like growth factor II receptor in fetal and cancer cells. Mol Cell Biol (1999) 19:327888.

  • 18

    MorrioneAValentinisBXuSQYumetGLouviAEfstratiadisAet alInsulin-like growth factor II stimulates cell proliferation through the insulin receptor. Proc Natl Acad Sci U S A (1997) 94:377782.10.1073/pnas.94.8.3777

  • 19

    PandiniGMedicoEConteESciaccaLVigneriRBelfioreA. Differential gene expression induced by insulin and insulin-like growth factor-II through the insulin receptor isoform A. J Biol Chem (2003) 278:4217889.10.1074/jbc.M304980200

  • 20

    MalaguarneraRSaccoAVociCPandiniGVigneriRBelfioreA. Proinsulin binds with high affinity the insulin receptor isoform A and predominantly activates the mitogenic pathway. Endocrinology (2012) 153:215263.10.1210/en.2011-1843

  • 21

    HansenBFDanielsenGMDrejerKSørensenARWibergFCKleinHHet alSustained signaling from the insulin receptor after stimulation with insulin analogues exhibiting increased mitogenic potency. Biochem J (1996) 315(Pt 1):2719.

  • 22

    ShymkoRMDe MeytsPThomasR. Logical analysis of timing-dependent receptor signaling specificity: application to the insulin receptor metabolic and mitogenic signaling pathways. Biochem J (1997) 326(Pt 2):4639.

  • 23

    ShymkoRMDumontEDe MeytsPDumontJE. Timing-dependence of insulin-receptor mitogenic versus metabolic signaling: a plausible model based on coincidence of hormone and effector binding. Biochem J (1999) 339(Pt 3):67583.10.1042/0264-6021:3390675

  • 24

    JensenMPalsgaardJBorupRDe MeytsPSchäfferL. Activation of the insulin receptor (IR) by insulin and a synthetic peptide has different effects on gene expression in IR-transfected L6 myoblasts. Biochem J (2008) 412:43545.10.1042/BJ20080279

  • 25

    DittmerFUlbrichEJHafnerASchmahlWMeisterTPohlmannRet alAlternative mechanisms for trafficking of lysosomal enzymes in mannose-6-phosphate receptor-deficient mice are cell-type-specific. J Cell Sci (1999) 112:15917.

  • 26

    IrizarryRAHobbsBCollinFBeazer-BarclayYDAntonellisKJScherfUet alExploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics (2003) 4:24964.10.1093/biostatistics/4.2.249

  • 27

    LiCWongWH. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci U S A (2001) 98:316.10.1073/pnas.98.1.31

  • 28

    LivakKJSchmittgenTD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods (2001) 25:4028.10.1006/meth.2001.1262

  • 29

    DenleyABonythonERBookerGWCosgroveLJForbesBEWardCWet alStructural determinants for high-affinity binding of insulin-like growth factor II to insulin receptor (IR)-A, the exon 11 minus isoform of the IR. Mol Endocrinol (2004) 18:250212.10.1210/me.2004-0183

  • 30

    MulliganCRochfordJDenyerGStephensRYeoGFreemanTet alMicroarray analysis of insulin and insulin-like growth factor-1 (IGF-1) receptor signaling reveals the selective up-regulation of the mitogen heparin-binding EGF-like growth factor by IGF-1. J Biol Chem (2002) 277:424807.10.1074/jbc.M206206200

  • 31

    DupontJKhanJQuBHMetzlerPHelmanLLeRoithD. Insulin and IGF-1 induce different patterns of gene expression in mouse fibroblast NIH-3T3 cells: identification by cDNA microarray analysis. Endocrinology (2001) 142:496975.10.1210/en.142.11.4969

  • 32

    KarinMLinA. NF-κB at the crossroads of life and death. Nat Immunol (2002) 3:2217.10.1038/ni0302-221

  • 33

    GuptaS. Molecular signaling in death receptor and mitochondrial pathways of apoptosis (Review). Int J Oncol (2003) 22:1520.

  • 34

    ArchRHGedrichRWThompsonCB. Tumor necrosis factor receptor-associated factors (TRAFs) – a family of adapter proteins that regulates life and death. Genes Dev (1998) 12:282130.10.1101/gad.12.18.2821

  • 35

    PypeSDeclercqWIbrahimiAMichielsCVan RietschotenJGDewulfNet alTTRAP, a novel protein that associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor-associated factors (TRAFs), and that inhibits nuclear factor-κ B activation. J Biol Chem (2000) 275:1858693.10.1074/jbc.M000531200

  • 36

    HarrisRCChungECoffeyRJ. EGF receptor ligands. Exp Cell Res (2003) 284:213.10.1016/S0014-4827(02)00105-2

  • 37

    RaabGKlagsbrunM. Heparin-binding EGF-like growth factor. Biochim Biophys Acta (1997) 1333:F17999.

  • 38

    ShoyabMMcDonaldVLBradleyJGTodaroGJ. Amphiregulin: a bifunctional growth-modulating glycoprotein produced by the phorbol 12-myristate 13-acetate-treated human breast adenocarcinoma cell line MCF-7. Proc Natl Acad Sci U S A (1988) 85:652832.10.1073/pnas.85.17.6528

  • 39

    KomurasakiTToyodaHUchidaDNemotoN. Mechanism of growth promoting activity of epiregulin in primary cultures of rat hepatocytes. Growth Factors (2002) 20:619.10.1080/08977190290024192

  • 40

    ToyodaHKomurasakiTUchidaDTakayamaYIsobeTOkuyamaTet alEpiregulin. A novel epidermal growth factor with mitogenic activity for rat primary hepatocytes. J Biol Chem (1995) 270:7495500.

  • 41

    ShirakataYKomurasakiTToyodaHHanakawaYYamasakiKTokumaruSet alEpiregulin, a novel member of the epidermal growth factor family, is an autocrine growth factor in normal human keratinocytes. J Biol Chem (2000) 275:574853.10.1074/jbc.275.8.5748

  • 42

    BeerliRRHynesNE. Epidermal growth factor-related peptides activate distinct subsets of ErbB receptors and differ in their biological activities. J Biol Chem (1996) 271:60716.10.1074/jbc.271.11.6071

  • 43

    EleniusKPaulSAllisonGSunJKlagsbrunM. Activation of HER4 by heparin-binding EGF-like growth factor stimulates chemotaxis but not proliferation. EMBO J (1997) 16:126878.10.1093/emboj/16.6.1268

  • 44

    DrejerK. The bioactivity of insulin analogues from in vitro receptor binding to in vivo glucose uptake. Diabetes Metab Rev (1992) 8:25985.10.1002/dmr.5610080305

  • 45

    JensenMHansenBDe MeytsPSchäfferLUrsøB. Activation of the insulin receptor by insulin and a synthetic peptide leads to divergent metabolic and mitogenic signaling and responses. J Biol Chem (2007) 282:3517986.10.1074/jbc.M704599200

  • 46

    MorcavalloAGenuaMPalummoAKletvikovaEJiracekJBrzozowskiAMet alInsulin and insulin-like growth factor II differentially regulate endocytic sorting and stability of insulin receptor isoform A. J Biol Chem (2012) 287:1142236.10.1074/jbc.M111.252478

Summary

Keywords

IGF-I receptor, microarray gene expression, insulin, IGF, differential signaling

Citation

Versteyhe S, Klaproth B, Borup R, Palsgaard J, Jensen M, Gray SG and De Meyts P (2013) IGF-I, IGF-II, and Insulin Stimulate Different Gene Expression Responses through Binding to the IGF-I Receptor. Front. Endocrinol. 4:98. doi: 10.3389/fendo.2013.00098

Received

28 February 2013

Accepted

26 July 2013

Published

09 August 2013

Volume

4 - 2013

Edited by

Kenneth Siddle, University of Cambridge, UK

Reviewed by

Ramasamy Paulmurugan, Stanford University, USA; Andrew Chantry, University of East Anglia, UK

Copyright

*Correspondence: Soetkin Versteyhe, Faculty of Health Sciences, The Novo Nordisk Foundation Center for Basic Metabolic Research, Integrative Physiology, University of Copenhagen, Blegdamsvej 3B, 2200 København N, Denmark e-mail:

†Present address: Birgit Klaproth and Maja Jensen, Insulin Biology, Novo Nordisk A/S, Måløv, Denmark; Jane Palsgaard, Novo Nordisk Foundation Center for Basic Metabolic Research, University of Copenhagen, Copenhagen, Denmark; Pierre De Meyts, Department of Diabetes Biology and Hagedorn Research Institute, Gentofte, Denmark.

This article was submitted to Frontiers in Molecular and Structural Endocrinology, a specialty of Frontiers in Endocrinology.

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics