Abstract
Relaxin family peptide (RXFP) receptors 1 and 2 are unique G-protein coupled receptors in that they contain an N-terminal low-density lipoprotein type A (LDLa) module which is necessary for receptor activation. The current hypothesis suggests that upon ligand binding the LDLa module interacts with the transmembrane (TM) domain of a homodimer partner receptor to induce the active receptor conformations. We recently demonstrated that three residues in the N-terminus of the RXFP1 LDLa module are potentially involved in hydrophobic interactions with the receptor to drive activation. RXFP2 shares two out of three of the residues implicated, suggesting that the two LDLa modules could be interchanged without adversely affecting activity. However, in 2007 it was shown that a chimera consisting of the RXFP1 receptor with its LDLa swapped for that of RXFP2 did not signal. We noticed this construct also contained the RXFP2 region linking the LDLa to the leucine-rich repeats. We therefore constructed chimeric RXFP1 and RXFP2 receptors with their LDLa modules swapped immediately C-terminally to the final cysteine residue of the module, retaining the native linker. In addition, we exchanged the TM domains of the chimeras to explore if matching the LDLa module with the TM domain of its native receptor altered activity. All of the chimeras were expressed at the surface of HEK293T cells with ligand binding profiles similar to the wild-type receptors. Importantly, as predicted, ligand binding was able to induce cAMP-based signaling. Chimeras of RXFP1 with the LDLa of RXFP2 demonstrated reduced H2 relaxin potency with the pairing of the RXFP2 TM with the RXFP2 LDLa necessary for full ligand efficacy. In contrast the ligand-mediated potencies and efficacies on the RXFP2 chimeras were similar suggesting the RXFP1 LDLa module has similar efficacy on the RXFP2 TM domain. Our studies demonstrate the LDLa modules of RXFP1 and RXFP2 modulate receptor activation via a similar mechanism.
Introduction
Relaxin family peptide receptor (RXFP) 1 and RXFP2 are class A G-protein coupled receptors (GPCR). They are therefore members of the largest gene family in humans (), and GPCRs are currently the target of more directed drugs than any other gene family (). While RXFP1 and RXFP2 both possess the representative 7 transmembrane (TM) spanning α-helices, they also contain a large extracellular domain, consisting of 10 leucine-rich repeats (LRR) tethered to a single low-density lipoprotein type A (LDLa) module () by an uncharacterized linker. The LRRs are the primary binding site for the cognate ligands, relaxin (RXFP1) and insulin-like peptide 3 (INSL3) (RXFP2), while the LDLa module is essential for signaling (). As the receptors have been shown to form constitutive homodimers (, ) it is hypothesized that the LDLa module acts as a secondary ligand, possibly interacting with the extracellular loops of the TM region of a homodimer partner receptor to induce the conformational change necessary for signaling (). RXFP1 and RXFP2 are the only known mammalian GPCRs to contain an LDLa module and thus the potential role of this module in signal activation is unique. The module itself requires the formation of three disulfide bonds between six conserved cysteine residues, as well as the presence of a single bound calcium ion to maintain its active, globular structure (). Replacing the native LDLa module of RXFP1 with the structurally similar but functionally distinct LB2 module from the low-density lipoprotein receptor (LDLR) gives rise to a chimera that can bind ligand like the wild-type (WT), but cannot signal (, ). The RXFP1-LB2 chimera was used to identify key residues needed for signaling in a gain-of function study complemented with equivalent loss-of-function mutations and a detailed structural analysis (). In this way a prospective binding surface was identified involving Leu7, Tyr9, and Lys17, which are proposed to contribute to the activation of RXFP1 using hydrophobic contacts.
A similar mechanism of action of the LDLa module by the two receptors is implied by the degree of sequence similarity they share. The LDLa modules of RXFP1 and RXFP2 share 60% sequence similarity (Figure 1), each possessing features common to other LDLa modules characterized from the LDLR including the six cysteines that form disulfide bonds, and the motif AspxxxAspxxAspxxAspGlu (where x is any residue) that binds a calcium ion. Many LDLa modules characterized from the LDLR utilize this motif to not only ligate the calcium ion but contribute to protein–protein interactions (), while residues important to RXFP1 function have been mapped to the N-terminal region of the LDLa (). Two residues key to the function of RXFP1, Tyr9, and Lys17, are conserved in the RXFP2 LDLa module and it is reasonable to assume they function in a similar manner to induce signal activation. Importantly, it has been shown that chimeras, named RXFP1/2 and RXFP2/1, in which the entire ectodomain of the receptors are swapped are still able to signal, albeit with lowered activity compared to WT (). This implies that the LDLa module of RXFP2 can compensate for the module of RXFP1 and vice versa. It would seem reasonable to assume then that simply swapping the LDLa modules between RXFP1 and RXFP2 would also yield chimeras capable of signaling. However, in a study by Kern and colleagues in 2007 where they replaced the RXFP1 LDLa module with that of RXFP2, they reported that the chimera did not signal, concluding that the cAMP signaling function of RXFP1 was only possible with its native LDLa module ().
Figure 1
The present study aims to further investigate this seeming contradiction, and establish why an ectodomain-swapped chimera of RXFP1 with RXFP2 can signal, while an equivalent LDLa-swapped chimera cannot. Upon scrutiny of the constructs made by Kern et al., it would appear that the point chosen to swap the LDLa modules was 27 residues C-terminally to the final cysteine (Cys40) necessary for LDLa structural integrity for RXFP1. Importantly, the equivalent region of RXFP2 which was replaced in the chimera is seven amino acids shorter (Figure 1), meaning that the resulting chimera had a shorter stretch of amino acids linking the LDLa module to the LRRs than WT RXFP1. We therefore designed chimeric constructs of both RXFP1 and RXFP2 that had their LDLa modules swapped immediately C-terminally to the aforementioned cysteine similar to our RXFP1-LB2 chimera (
Figure 2

Schematic representation of the RXFP1 and RXFP2 receptors compared to the RXFP211, RXFP122, RXFP212, and RXFP121 chimeric receptors. The domains of receptors are labeled on the RXFP1 receptor. RXFP1 domains are in blue while RXFP2 domains are in red.
Materials and Methods
Hormones and cell lines
Recombinant human gene-2 relaxin (H2 relaxin) peptide was kindly provided by Corthera and human INSL3 was chemically synthesized as previously described (
Receptor constructs
RXFP1, RXFP2, and chimeric constructs were cloned into a pcDNA3.1™/Zeo+ AmpR mammalian expression vector (Invitrogen, Carlsbad, CA, USA) which contained an N-terminal FLAG tag and a bovine prolactin signal sequence (
Table 1
| Construct component | Template DNA | Primer (5′–3′DNA sequence) |
|---|---|---|
| RXFP2 LDLa | RXFP2 LDLa module | Sense: CATCATGGATCCGCCACCATGGACAGCAAAG |
| Antisense: CAGAGACCATCCATTGTTGTCTCCACAGTTCTCTTCGTCCGCCCC | ||
| RXFP1 LDLa | RXFP1 LDLa module | Sense: CATCATGGATCCGCCACCATGGACAGCAAAG |
| Antisense: CGCCCATCCACTAGTGTCACCACAGTTGTCCTCATCGGCCTG | ||
| RXFP211 LRR and TM | RXFP1 | Sense: GGGGCGGACGAAGAGAACTGTGGAGACAACAATGGATGGTCTCTG |
| Antisense: GAGAGCTCGAGTCATGAATAGGAATTGAGTCTCGTTG | ||
| RXFP212 LRR and TM | RXFP1/2 | Sense: GGGGCGGACGAAGAGAACTGTGGAGACAACAATGGATGGTCTCTG |
| Antisense: CATCATCATCTCGAGCTAGGAAACTGGTTTCATTATACTGTC | ||
| RXFP122 LRR and TM | RXFP2 | Sense: CAGGCCGATGAGGACAACTGTGGTGACACTAGTGGATGGGCG |
| Antisense: CATCATCATCTCGAGCTAGGAAACTGGTTTCATTATACTGTC | ||
| RXFP121 LRR and TM | RXFP2/1 | Sense: CAGGCCGATGAGGACAACTGTGGTGACACTAGTGGATGGGCG |
| Antisense: GAGAGCTCGAGTCATGAATAGGAATTGAGTCTCGTTG |
Primers used in overlap cloning.
Receptor expression on HEK 293T cells
Transient transfections were performed using lipofectAMINE™ 2000 (Invitrogen) according to the manufacturer’s instructions. For competition binding assays chimeric receptors were selected for semi-stable expression and compared with cells stably expressing RXFP1 or RXFP2 (
Cell surface expression assays
The presence of the chimeric receptors at the surface of cells was assessed in triplicate, exploiting the FLAG epitope on their N-termini using the method described previously (
Ligand binding assays
Competition binding assays were performed on whole cells as described previously, using Europium labeled INSL3 (Eu-INSL3) (
cAMP activity assays
Cells were assayed for cAMP signaling by co-transfection of receptors with a pCRE β-galactosidase (β-gal) reporter construct as previously described (
Results
Characterization of RXFP211 and RXFP212
Cell surface expression assays on the chimeric constructs showed that all receptors were expressed at the cell membrane, since their fluorescence profiles were consistently equal to or greater than that displayed by the WT receptors (Figure 3). Both RXFP211 and RXFP212 were expressed more highly than WT RXFP1, which is consistent with findings by Kern et al. for their LDLa-swapped chimera (
Figure 3

Cell surface expression of chimeric receptors compared to the RXFP1 and RXFP2 wild-type (WT) receptors. Data are expressed as mean ± SEM of triplicate determinations from at least three independent experiments. **p < 0.01 compared to RXFP1.
Table 2
| Receptor | Cell surface expression | Eu-H2 relaxin competition binding (pIC50) | Eu-INSL3 competition binding (pIC50) | INSL3 stimulation | H2 relaxin stimulation | ||
|---|---|---|---|---|---|---|---|
| pEC50 | Emax (%Forskolin) | pEC50 | Emax (%Forskolin) | ||||
| % RXFP1 | |||||||
| RXFP1 | 100 ± 3.23 (8) | 8.77 ± 0.10 (7) | ND | ND | ND | 10.89 ± 0.07 (4) | 102.4 ± 3.3 (3) |
| RXFP211 | 141.2 ± 11.3 (7)** | 8.64 ± 0.15 (8) | ND | ND | ND | 10.28 ± 0.15 (3) | 64.5 ± 3.4 (3)* |
| RXFP212 | 109.7 ± 14.7 (5) | 8.43 ± 0.17 (4) | ND | ND | ND | 9.19 ± 0.03 (3)** | 99.9 ± 5.3 (3) |
| % RXFP2 | |||||||
| RXFP2 | 100 ± 3.5 (4) | ND | 8.79 ± 0.06 (6) | 10.26 ± 0.42 (3) | 115.1 ± 9.2 (3) | 9.13 ± 0.06 (3) | 102.6 ± 16.5 (3) |
| RXFP122 | 94.5 ± 10.7 (4) | ND | 8.35 ± 0.08 (6)## | 9.67 ± 0.20 (5) | 93.9 ± 3.6 (5) | 7.95 ± 0.10 (6)## | 109.8 ± 5.0 (6) |
| RXFP121 | 91.0 ± 9.8 (5) | ND | 8.43 ± 0.17 (3)# | 10.40 ± 0.34 (5) | 93.7 ± 14.6 (5) | 8.22 ± 0.17 (4)# | 101.4 ± 8.8 (4) |
Pooled binding affinity (pIC50), cell surface expression and cAMP activity (pEC50 and Emax) data for chimeric receptors in comparison to RXFP1 and RXFP2.
*p < 0.05; **p < 0.01 vs. RXFP1; #p < 0.05; ##p < 0.01 vs. RXFP2; ND – not determined.
The construct RXFP211 is made up of the LDLa module from RXFP2 and the LRRs and TM domain of RXFP1. RXFP212 contains the same domains except that the TM domain is from RXFP2 (Figure 2). As high affinity ligand binding is driven by the LRRs, binding was assessed in comparison to RXFP1 using a competition binding assay with Eu-H2 relaxin. As expected binding was unaltered in comparison to WT as the LRR sequence was equivalent to the native receptor in each of the constructs (Figure 4A).
Figure 4

Activity of RXFP1 chimeric receptors compared to RXFP1. (A) Competition binding using Eu-labeled H2 relaxin. (B) H2 relaxin-induced cAMP responses. cAMP activity is expressed as the percentage of the 5 μM Forskolin-stimulated response for each receptor. Note the data for the RXFP211 receptor has been normalized for cell surface expression (see text for details). Data are expressed as mean ± SEM of triplicate determinations from at least three independent experiments.
The two LDLa-swapped receptors were tested for cAMP production using a reporter gene assay. As the RXFP211 chimera had significantly different cell surface expression to RXFP1 the results have been normalized to cell surface expression for this construct only. While both chimeras were able to induce cAMP activity in response to H2 relaxin, the potency was reduced, with the pEC50 of H2 relaxin on RXFP211 being 10.28 ± 0.15, and that of H2 relaxin on RXFP212 9.19 ± 0.03, the latter of which is significantly different (p < 0.01) from WT RXFP1 (pEC50 10.89 ± 0.03) (Figure 4B; Table 2). Importantly the efficacy of H2 relaxin-induced cAMP responses at RXFP211 was significantly reduced compared to RXFP1 with a maximum Forskolin response of 64.02 ± 3.4% compared with 102.4 ± 3.3% (p < 0.05). The replacement of the RXFP1 TM domain with that of RXFP2 in RXFP212 restored the H2 relaxin stimulated efficacy to 99.9 ± 5.3% Forskolin response (Figure 4B; Table 2).
Characterization of RXFP122 and RXFP121
RXFP122 has the TM and LRR domains from RXFP2 and the LDLa module from RXFP1. RXFP121 has the LDLa module and the TM region from RXFP1 and the LRRs from RXFP2 (Figure 2). Cell surface expression for these two constructs was not significantly different from WT RXFP2 levels (Figure 3; Table 2). Binding assays also showed similar patterns of binding to RXFP2, although pIC50 values for INSL3 binding were found to be significantly different from RXFP2 (p < 0.05 for RXFP121 and p < 0.01 for RXFP122) (Figure 5A; Table 2). Given that the constructs had the LRR region from RXFP2, we tested them for signaling with both INSL3 and H2 relaxin, as these ligands are both known to activate RXFP2 (
Figure 5

Activity of RXFP2 chimeric receptors compared to RXFP2. (A) Competition binding using Eu-labeled INSL3. (B) INSL3-induced cAMP responses. (C) H2 relaxin-induced cAMP responses. cAMP activity is expressed as the percentage of the 5 μM Forskolin-stimulated response for each receptor. Data are expressed as mean ± SEM of triplicate determinations from at least three independent experiments.
Discussion
The activation mechanisms of RXFP1 and RXFP2 represent a unique paradigm in GPCR functioning, since these are the only two mammalian GPCRs that possess an LDLa module. When found in the LDLR and related receptors, these modules are typically involved in protein–protein interactions, and are thus involved in a variety of interactions both with peptides and other molecules (
While Kern et al. only made the RXFP1 chimera with the LDLa module of RXFP2 attached, we sought to characterize both this and the equivalent RXFP2 construct with the LDLa from RXFP1. We hypothesized that such chimeras would be informative in relation to common and distinct mechanisms of activation by the LDLa module. Additionally, we explored the concept that the LDLa is exerting its effect by interacting with the TM domain of the receptor in a specific manner by creating LDLa chimeras with matched TM domains in RXFP121 and RXFP212. The chimeric receptors were all expressed at the cell surface indicating they were folded correctly and able to be trafficked to the cell surface. The RXFP211 chimera had significantly higher cell surface expression as previously demonstrated for the chimera produced by Kern et al. (
As anticipated the chimeric receptors did show differences in ligand-mediated cAMP activity compared to the WT receptors. This was most obvious for the RXFP1 chimeras where H2 relaxin demonstrated both decreased potency as well as decreased % maximum Forskolin activity on RXFP211. The shift in pEC50 was similar to what we have previously demonstrated when the key RXFP1 LDLa residue Leu7 is mutated to Lysine as it is in the RXFP2 LDLa module (
It should also be pointed out that it is highly unlikely that changes in potency or efficacy in the receptor chimeras is related to decreased efficiency of homodimerization of the receptors. Our previous studies on dimerization of RXFP1 (
Taken together, this study has shown that the LDLa modules of RXFP1 and RXFP2, which are unique among GPCRs, behave in a comparable fashion to one another, and that their mechanism of action must therefore be closely related. Additionally it is clear that the length of the linker region between the LRRs and the LDLa module is important for RXFP1 function. This information can be used to further elucidate a model of activation, as we gradually clarify the myriad of different elements that come into play upon binding and activation of these complex receptors. Given that relaxin has been implicated in various pathologies including cancer (
Statements
Acknowledgments
The authors thank Sharon Layfield and Tania Ferraro for technical assistance and Corthera for provision of recombinant H2 relaxin. This research was supported by National Health and Medical Research Council of Australia project grants 628427 and 1043750 (Ross A. D. Bathgate and Paul R. Gooley) and by the Victorian Government Operational Infrastructure Support Program. Ross A. D. Bathgate and John D. Wade are recipients of NHMRC (Australia) Research Fellowships, Daniel J. Scott is a recipient of an NHMRC CJ Martin Fellowship, Roy C. K. Kong is the recipient of a University of Melbourne International Research Scholarship and University of Melbourne International Fee Remission Scholarship and Emma J. Petrie is the recipient of a Melbourne Research Fellowship (Career Interruptions).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
References
1
StevensRCCherezovVKatritchVAbagyanRKuhnPRosenHet alThe GPCR Network: a large-scale collaboration to determine human GPCR structure and function. Nat Rev Drug Discov (2013) 12:25–34.10.1038/nrd3859
2
OveringtonJPAl-LazikaniBHopkinsAL. How many drug targets are there?Nat Rev Drug Discov (2006) 5:993–6.10.1038/nrd2199
3
HsuSYNakabayashiKNishiSKumagaiJKudoMSherwoodODet alActivation of orphan receptors by the hormone relaxin. Science (2002) 295:671–4.10.1126/science.1065654
4
ScottDJLayfieldSYanYSudoSHsuehAJTregearGWet alCharacterization of novel splice variants of LGR7 and LGR8 reveals that receptor signaling is mediated by their unique low density lipoprotein class A modules. J Biol Chem (2006) 281:34942–54.10.1074/jbc.M602728200
5
SvendsenAMZaleskoAKønigJVreclMHedingAKristensenJBet alNegative cooperativity in H2 relaxin binding to a dimeric relaxin family peptide receptor 1. Mol Cell Endocrinol (2008) 296:10–7.10.1016/j.mce.2008.07.014
6
SvendsenAMVreclMKnudsenLHedingAWadeJDBathgateRADet alDimerization and negative cooperativity in the relaxin family peptide receptors. Ann N Y Acad Sci (2009) 1160:54–9.10.1111/j.1749-6632.2009.03835.x
7
BathgateRADHallsMLVan Der WesthuizenETCallanderGEKocanMSummersRJ. Relaxin family peptides and their receptors. Physiol Rev (2013) 93:405–80.10.1152/physrev.00001.2012
8
HopkinsEJLayfieldSFerraroTBathgateRAGooleyPR. The NMR solution structure of the relaxin (RXFP1) receptor lipoprotein receptor class A module and identification of key residues in the N-terminal region of the module that mediate receptor activation. J Biol Chem (2007) 282:4172–84.10.1074/jbc.M609526200
9
KongRCPetrieEJMohantyBLingJLeeJCGooleyPRet alThe relaxin receptor (RXFP1) utilises hydrophobic moieties on a signalling surface of its N-terminal low density lipoprotein class A module to mediate receptor activation. J Biol Chem (2013) 288:28138–51.10.1074/jbc.M113.499640
10
FisherCBeglovaNBlacklowSC. Structure of an LDLR-RAP complex reveals a general mode for ligand recognition by lipoprotein receptors. Mol Cell (2006) 22:277–83.10.1016/j.molcel.2006.02.021
11
HallsMLBondCPSudoSKumagaiJFerraroTLayfieldSet alMultiple binding sites revealed by interaction of relaxin family peptides with native and chimeric relaxin family peptide receptors 1 and 2 (LGR7 and LGR8). J Pharmacol Exp Ther (2005) 313:677–87.10.1124/jpet.104.080655
12
KernAAgoulnikAIBryant-GreenwoodGD. The low-density lipoprotein class A module of the relaxin receptor (leucine-rich repeat containing G-protein coupled receptor 7): its role in signaling and trafficking to the cell membrane. Endocrinology (2007) 148:1181–94.10.1210/en.2006-1086
13
RosengrenKJLinFBathgateRATregearGWDalyNLWadeJDet alSolution structure and novel insights into the determinants of the receptor specificity of human relaxin-3. J Biol Chem (2006) 281:5845–51.10.1074/jbc.M511210200
14
SudoSKumagaiJNishiSLayfieldSFerraroTBathgateRAet alH3 relaxin is a specific ligand for LGR7 and activates the receptor by interacting with both the ectodomain and the exoloop 2. J Biol Chem (2003) 278:7855–62.10.1074/jbc.M212457200
15
YanYScottDJWilkinsonTNJiJTregearGWBathgateRA. Identification of the N-linked glycosylation sites of the human relaxin receptor and effect of glycosylation on receptor function. Biochemistry (2008) 47:6953–68.10.1021/bi800535b
16
ShabanpoorFHughesRABathgateRADZhangSScanlonDBLinFet alSolid-phase synthesis of Europium-labeled human INSL3 as a novel probe for the study of ligand-receptor interactions. Bioconjug Chem (2008) 19:1456–63.10.1021/bc800127p
17
ShabanpoorFBathgateRABelgiAChanLJNairVBWadeJDet alSite-specific conjugation of a lanthanide chelator and its effects on the chemical synthesis and receptor binding affinity of human relaxin-2 hormone. Biochem Biophys Res Commun (2012) 420:253–6.10.1016/j.bbrc.2012.02.141
18
ChenWBShieldsTSStorkPJSConeRD. A colorimetric assay for measuring activation of Gs- and Gq-coupled signaling pathways. Anal Biochem (1995) 226:349–54.10.1006/abio.1995.1235
19
BlacklowSC. Versatility in ligand recognition by LDL receptor family proteins: advances and frontiers. Curr Opin Struct Biol (2007) 17:419–26.10.1016/j.sbi.2007.08.017
20
YasuiNNogiTTakagiJ. Structural basis for specific recognition of Reelin by its receptors. Structure (2010) 18:320–31.10.1016/j.str.2010.01.010
21
ScottDJRosengrenKJBathgateRA. The different ligand-binding modes of relaxin family peptide receptors RXFP1 and RXFP2. Mol Endocrinol (2012) 26:1896–906.10.1210/me.2012-1188
22
HossainMARosengrenKJHaugaard-JonssonLMZhangSLayfieldSFerraroTet alThe A-chain of human relaxin family peptides has distinct roles in the binding and activation of the different relaxin family peptide receptors. J Biol Chem (2008) 283:17287–97.10.1074/jbc.M801911200
23
WilkinsonTNSpeedTPTregearGWBathgateRA. Coevolution of the relaxin-like peptides and their receptors. Ann N Y Acad Sci (2005) 1041:534–9.10.1196/annals.1282.080
24
WilkinsonTNBathgateRA. The evolution of the relaxin peptide family and their receptors. Adv Exp Med Biol (2007) 612:1–13.10.1007/978-0-387-74672-2_1
25
NairVBSamuelCSSeparovicFHossainMAWadeJD. Human relaxin-2: historical perspectives and role in cancer biology. Amino Acids (2012) 43:1131–40.10.1007/s00726-012-1375-y
26
TeerlinkJRCotterGDavisonBAFelkerGMFilippatosGGreenbergBHet alSerelaxin, recombinant human relaxin-2, for treatment of acute heart failure (RELAX-AHF): a randomised, placebo-controlled trial. Lancet (2013) 381:29–39.10.1016/S0140-6736(12)61855-8
Summary
Keywords
GPCR, signaling, relaxin, INSL3, RXFP1, RXFP2, insulin-like peptides
Citation
Bruell S, Kong RCK, Petrie EJ, Hoare B, Wade JD, Scott DJ, Gooley PR and Bathgate RAD (2013) Chimeric RXFP1 and RXFP2 Receptors Highlight the Similar Mechanism of Activation Utilizing Their N-Terminal Low-Density Lipoprotein Class A Modules. Front. Endocrinol. 4:171. doi: 10.3389/fendo.2013.00171
Received
26 September 2013
Accepted
25 October 2013
Published
11 November 2013
Volume
4 - 2013
Edited by
Briony Forbes, The University of Adelaide, Australia
Reviewed by
Brian C. Wilson, Acadia University, Canada; Mohammed Akli Ayoub, King Saud University, Saudi Arabia
Copyright
© 2013 Bruell, Kong, Petrie, Hoare, Wade, Scott, Gooley and Bathgate.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Ross A. D. Bathgate, Florey Institute of Neuroscience and Mental Health, The University of Melbourne, Parkville, VIC 3010, Australia e-mail: bathgate@florey.edu.au
†Shoni Bruell and Roy C. K. Kong have contributed equally to this work.
This article was submitted to Molecular and Structural Endocrinology, a section of the journal Frontiers in Endocrinology.
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.