Abstract
The growth and differentiation factor Myostatin (MSTN, also known as GDF8) negatively regulates skeletal muscle development and growth in vertebrates. Most fish genomes contain two or more mstn genes, which are expressed in muscle and other tissues. Yet, in the genome of Nile tilapia (Oreochromis niloticus), which is one of the world's most important aquaculture fish species, only one mstn gene has previously been identified. Here, we identify a second mstn gene in Nile tilapia. We show that it clusters phylogenetically with other piscine mstn2 genes and that it shares chromosomal synteny with the human and zebrafish orthologs. We further show that mstn2 is not expressed in red or white muscles of Nile tilapia, but rather that its main site of expression is the brain. To determine which physiological functions are correlated with mstn expression, adult Nile tilapia were exposed to various environmental conditions and their effect on mstn1 and mstn2 expression in the brain and muscles was measured using real-time PCR. We found that the centrally- and muscle-expressed mstn genes differ in their responsiveness to diverse challenges, suggesting differential gene- and tissue-specific regulation of their expression. Metabolic and stress marker analyses showed that the altered mstn expression is not regulated by classical stress response. Taken together, our findings expand the understanding of the MSTN system in Nile tilapia and provide evolutionary insight into its function.
Introduction
Myostatin [MSTN, also known as growth and differentiation factor 8 (GDF8)] is a growth and differentiation factor of the TGF-β superfamily that inhibits skeletal muscle development and growth (). MSTN is synthesized as a precursor protein, which gives rise to latency-associated peptide and mature MSTN peptide (). The mammalian Mstn gene is mainly expressed in myogenic precursor cells of the myotome during somitogenesis and in muscle tissues of adult animals (, –). MSTN can act as a paracrine, autocrine, or endocrine substance (). The mstn gene is highly conserved across vertebrate species, supporting its important function in regulating muscular development and growth (, –).
While mammalian genomes contain only one Mstn gene, most ray-finned fish possess at least two mstn paralogs (i.e., mstn1 and mstn2) and, in some species, up to four mstn genes can be identified (, ). Piscine mstns are differentially expressed in different muscle types and, unlike their mammalian orthologs, they are also expressed in the brain and other peripheral tissues (–). This tissue distribution suggests that mstns may also be involved in processes such as muscle regeneration, growth, and development of neurons in the brain, osmoregulation, homeostatic tissue growth, and reproduction (, , –). Nevertheless, mstn gene knockout in several fish species resulted in increased muscle mass, thus showing the evolutionarily conserved function of mstn as a key regulator of muscle growth (–).
mstn expression is differentially regulated according to species, phase of growth, tissue, nutritional state, stress level, temperature, and activity level (–). For example, overcrowding reduced mstn mRNA expression in zebrafish (Danio rerio) (), whereas exposure of juvenile channel catfish (Ictalurus punctatus) to cold temperature for 28 days increased mstn mRNA expression in muscle tissues (). mstn expression is increased in muscles of juvenile European sea bass (Dicentrarchus labrax) following prolonged fasting and returns to normal levels after refeeding (). Thirty days fasting of Asian sea bass (Lates calcarifer) fry led to increased expression of mstn1 in the muscle and liver and decreased expression in the gills and brain. However, mstn2 expression increased in the gills and liver and remained constant in muscle and brain after long-term fasting (). Five weeks fasting of juvenile armorhead catfish (Cranoglanis bouderius) led to a gradual decrease in mstn expression in muscle, brain and liver, which returned to baseline levels after 2 weeks of refeeding. mstnb expression increased in the initial fasting period but decreased later on through the prolonged fast (). In Mozambique tilapia (Oreochromis mossambicus) larvae, starvation reduced mstn1 mRNA levels, accompanied by cortisol elevation. However, fasting of adult male Mozambique tilapia and rainbow trout (Oncorhynchus mykiss) had no significant effect on mstn expression in skeletal muscles (, ). This variability in piscine mstn responsiveness emphasizes the need to characterize the piscine MSTN system also in non-muscular tissues under various environmental conditions.
Nile tilapia (Oreochromis niloticus) is one of the most widely cultured fish species in extensive and highly intensive aquaculture systems and its genome has been fully sequenced (–). It was previously demonstrated that starvation affects mstn expression in white muscles of juvenile Nile tilapia (). However, thus far only one tilapia mstn gene has been identified. Here, we report the identification of a non-muscular mstn2 gene in Nile tilapia and show that it shares phylogeny and chromosomal synteny with Mstn genes from invertebrates to mammals. Furthermore, we show that tilapia mstn1 and mstn2 differ in their responsiveness to environmental challenges in a tissue-specific manner. Lastly, we show that these effects are mediated by the homeostatic response of the animal to the changing environment and not due to stress response.
Materials and Methods
Animals and Treatments
The experiments were approved by the Agricultural Research Organization Committee for Ethics in Using Experimental Animals (approval number: 775/18 IL). Adult Nile tilapia (59.36 ± 2.1 g) were raised in cylindrical 250-liter tanks (n = 7–8 fish/treatment) for 5 weeks. Temperature was maintained at 24–26°C. Ammonia and nitrite levels were monitored. Fish were fed twice daily ad libitum with commercial tilapia feeds (Zemach Feed Mills™, Israel). Fish were acclimated to the experimental tanks for 1–2 weeks and then subjected for 3 weeks to one of the following treatments: 1. net chasing (10 min/twice daily); 2. 50% seawater (20 ppt; salinity was increased by 0.5% every 48 h during the first 7 days), 3. no feeding; 4. increased water temperature (34°C). Control group underwent no treatment. Each experiment was performed twice in succession and accumulated data from both procedures are presented (n = 9–15 fish/treatment). Tissue distribution analysis of mstn1 and mstn2 expression was performed using n = 3 fish/group/tissue with adult males displaying running milt and weighing 81.87 ± 6.6 g, adult females with fully developed ovaries and weighing 27.13 ± 7.2 g, juvenile males weighing 10.56 ± 1.8 g and juvenile females weighing 16.97 ± 4.4 g.
Identification of mstn Genes in Nile Tilapia
Database sequence searches for mstn genes in Nile tilapia were performed using the Basic Local Alignment Search tool (BLAST) package (NCBI, https://blast.ncbi.nlm.nih.gov/Blast.cgi) (). Genomic synteny of mstn was manually analyzed using the UCSC genome browser (https://genome.ucsc.edu/) (). Nucleotide sequences of the open reading frame of mstn genes from various organisms were aligned by MUSCLE and phylogenetic analysis was performed using MEGA version 7 ().
Cloning
Nile tilapia total RNA was extracted from brain and muscle tissues using Trizol reagent (Life Technologies Corporation, Carlsbad, USA) according to the manufacturer's protocol and treated with Invitrogen TURBO DNA-free™ kit (Thermo Fisher Scientific, Vilnius, Lithuania) according to the manufacturer's protocol. cDNA was reverse-transcribed from 1 μg total RNA using High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Specific primer pairs (Table 1) were used to amplify the full tilapia (ti) mstn2 open reading frame and part of the timstn1 reading frame. PCR products, amplified with DreamTaq Green PCR Master Mix (Thermo Fisher Scientific), were analyzed on 1% agarose (LifeGene, Modi'in, Israel) containing Redsafe™ stain (Intron Biotechnology, Korea) in 1× TAE (Tris-acetate acid-EDTA) buffer (Biological industries, Kibbutz Beit-Haemek, Israel). PCR products of the predicted amplicon size were extracted from the gel, cloned into pGEM-T easy vector (Promega, Wisconsin, U.S.A.) and sequenced using T7 and SP6 primers at Hy Laboratories Ltd. (Rehovot, Israel).
Table 1
| Primer | Position | 5′ to 3′ sequence | Efficiency (%) | R2 | Application |
|---|---|---|---|---|---|
| tiMSTN1_RT_744F | 744 | GGGTCTGCAACCGTTCAT | 103.456 | 0.993 | RT & cloning |
| tiMSTN1_RT_863R | 863 | CAAAGTCCTCGAAGTCCACAG | RT | ||
| tiMSTN1_1408R | 1,408 | TCTATTGCACCGTGTTCTGC | Cloning | ||
| tiMSTN2_cloning_1F | 1 | GCGTCACTGCGCTCACTT | Cloning | ||
| tiMSTN2_cloning_1152R | 1,152 | TAGACATTTCATCCTCAAGGATGC | Cloning | ||
| tiMSTN2_RT_234F | 234 | CAACATCAGCCGCGATATGA | Cloning | ||
| tiMSTN2_RT_362R | 362 | CGATTGGATTGTGCGTTGTTG | Cloning | ||
| tiMSTN2_RT_526F | 526 | GTTCGCTCCCTGAAGATTGA | 92.317 | 0.994 | RT |
| tiMSTN2_RT_640R | 640 | TTCTATGCCGTAGTGGGTTTC | RT | ||
| tiEF1α_F640 | 640 | GGAGACCAGTGACAAGATGAG | 97.023 | 0.987 | RT |
| tiEF1α_R798 | 798 | GTTCCGATACCGCCAATCT | RT | ||
| ti18S_897R | 897 | CGACCATAAACGATGCCAACTAG | 98.427 | 0.999 | RT |
| ti18S_660F | 660 | GCACCACCACCCACAGAATC | RT |
Primers used for cloning and real-time PCR (RT).
Tissue and Blood Sample Collection
Blood samples were collected from the lateral vein using 1 mL heparinized syringes (200 IU/mL) attached to 25G needles. Plasma was separated from blood cells and platelets by centrifugation at 4°C/3.2 g for 20 min. Fish were subsequently harvested by decapitation and dissected to collect red muscle, white muscle, forebrain, midbrain, and hindbrain. As in other fish, hypothalamic nuclei of Nile tilapia are localized in the diencephalic compartment (). Therefore, to analyze central mstn expression, the midbrain section containing the diencephalon and optic tectum was dissected from the hindbrain compartments (cerebellum and brain stem) and from the telencephalon and olfactory bulbs. Each brain region was placed in a separate tube. Tissue samples were snap-frozen in liquid nitrogen and stored at −80°C until further analysis. Plasma was stored at −20°C until analysis for triglycerides, total protein and cortisol was performed.
RNA Extraction and cDNA Synthesis
Tilapia total RNA was extracted using Trizol reagent (Life Technologies Corporation, Carlsbad, USA), according to the manufacturer's protocol. RNA quantity and purity were measured using a microplate spectrophotometer Epoch™ (BioTek instruments Inc. Winooski, USA). RNA integrity was assessed by running 1–1.5 μg of total RNA on 1% agarose (LifeGene, Modi'in, Israel) containing Redsafe™ stain (Intron Biotechnology, Korea) in 1× TAE (Tris-acetate acid-EDTA) buffer (Biological Industries, Kibbutz Beit-Haemek, Israel). Possible genomic DNA contamination was eliminated by treatment with Invitrogen TURBO DNA-free™ kit (Thermo Fisher Scientific, Vilnius, Lithuania) according to the manufacturer's protocol. DNase-free total RNA (0.5 μg) was reverse-transcribed using High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania) according to the manufacturer's protocol. cDNA was stored at −20°C until quantitation by real-time PCR.
Real-Time PCR Analysis
Expression levels of timstn1 in red and white muscle and timstn1 and timstn2 in the brain were analyzed by quantitative PCR using a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Inc. Foster City, CA, USA). Elongation factor 1 alpha (ef1α) and 18S served as reference genes (). Each reaction consisted of 5 μL SYBR® green dye (Thermo Fisher Scientific, Vilnius, Lithuania), 0.75 μL of 3 μM forward and reverse primers of either timstn1, timstn2, 18s, or ef1α (Table 1), 0.5 μL of ultra-pure water (UPW) and 3 μL of cDNA template (diluted 1:20 in UPW for brain and white muscle and 1:10 for red muscle). Analysis was performed in duplicates. Controls without the cDNA were used to test for non-specific amplification. Specificity of the primers was validated by Sanger sequencing and melt curve analysis was used to confirm amplification of a single product. Amplification was performed under the following conditions; 95.0°C for 20 s, 40 cycles at 95.0°C for 3 s, and 60.0°C for 30 s, followed by one cycle at 95.0°C for 15 s and 60.0°C for 1 min, 95.0°C for 15 s for the generation of the melting curve. Fluorescence signals of the target, reference genes and control group were analyzed using StepOne software Version 2.3. Tissue distribution analysis had no clear baseline; therefore, relative quantification in various tissues was performed using 2−ΔC'T method (). Relative quantification of within-tissue expression was determined using the 2−ΔΔCT method ().
Quantification of Metabolites and Cortisol in Plasma
Plasma metabolites (triglycerides and total protein) were quantified by a photometric method using Cobasâ„¢ C111 Chemistry Analyzer (Roche Diagnostics International Ltd. Rotkruez, Switzerland). The system was calibrated using tetramethylammonium chloride (C.f.a.s Calibrator; Roche diagnostics GmbH, Mannheim Germany). Analytic controls (PreciControl ClinChem Multi 1 and 2; Roche diagnostics GmbH, Mannheim Germany) consisting of lyophilized human sera were used for quality control. Triglycerides were quantified using the TRIGL kit (Roche diagnostics GmbH, Mannheim, Germany) and total protein concentration was measured using the TP2 Kit (Roche diagnostics GmbH) according to the manufacturer's protocols. Steroid extraction for cortisol analysis was performed according to Aizen et al. () and cortisol concentrations were measured using a cortisol-specific ELISA according to the protocol published by Yeh et al. ().
Statistical Analyses
Statistical analyses were performed using GraphPad Prism 7.01 software (GraphPad, San Diego, USA). Data are presented as mean ± SD. Significance of differential gene expression and metabolic parameters was determined by one-way ANOVA followed by Dunnett's multiple comparisons post-test.
Results
Identification of a Second mstn Gene in the Genome of Nile Tilapia
Nile tilapia mstn genes were sought using the previously identified Mozambique tilapia mstn mRNA sequence (AF197193) (). A standard BLASTn search against the NR database of Nile tilapia yielded two predicted mstn mRNAs (XM_003458832 and XM_003446535), with the first hit matching the previously cloned mstn gene of Nile tilapia (KT987208). A wide-range phylogenetic analysis of the Mstn open reading frame (ORF) from invertebrates and lower vertebrates to mammals showed that the analyzed mstn sequences cluster into five main clades: 1. invertebrates mstn; 2. reptile and avian mstn; 3. mammalian Mstn; 4 piscine mstn1; 5. piscine mstn2. The previously identified tilapia mstn (timstn1) clustered with other piscine mstn1 ORFs, whereas the newly identified timstn clustered with mstn2 ORFs of various fish (Figure 1) and was therefore designated timstn2.
Figure 1
Although our analysis may have been biased by the increased number of piscine species, the results strongly support an early evolutionary event of mstn gene duplication in fish genomes. To further test this hypothesis, we analyzed the syntenic conservation between the timstns neighboring genes and zebrafish mstns genomic regions using the human MSTN gene as a reference. This analysis demonstrated high syntenic conservation between the chromosomal regions of human MSTN and zebrafish mstn1 (a.k.a. mstnb; NM_131019). Furthermore, syntenic conservation to the chromosomal region of the human MSTN gene was also found for both of the timstns and for zebrafish mstn2 (a.k.a. mstna; NM_001004122). The MFSD6 was identified in chromosomal region of the human MSTN, timstn2, zebrafish mstn1, and mstn2, whereas Nab1 gene was conserved in timstn2 and both of the zebrafish mstn genes (Figure 2A). These findings suggest that the mammalian Mstn gene shares a common ancestral gene with the piscine mstn genes and that both of the piscine mstn genes retained at least part of their chromosomal synteny during speciation events.
Figure 2

Conservation of tilapia mstn2. (A) Chromosomal synteny of Nile tilapia mstn1 and mstn2. Genes adjacent to mstn in the Nile tilapia, zebrafish and human genomes were manually identified using both USCS and ensembl genome browsers (https://genome.ucsc.edu/ and https://www.ensembl.org/index.html, respectively). The genes are named according to their annotation in the human genome. While Nab1 and MFSD6a genes were found to be syntenic in both piscine mstn genomic regions, most of the human MSTN neighboring genes were syntenic only to mstn1 or mstn2. (B) Pairwise alignment of tilapia Mstn1 and Mstn2 amino acid sequences illustrates the high similarity of the tilapia Mstn proteins. Red asterisk indicates conserved cysteine residues, which are important for Mstn peptide activity. The conserved proteolytic RXRR motif is indicated by a red rectangle.
While the Nile tilapia mstn1 gene has already been cloned, the timstn2 prediction was based on computational annotation. Although partial cloning of timstn1 was successful, our efforts to clone timstn2 from cDNA libraries of tilapia muscles failed. Nonetheless, the full ORF of timstn2 was cloned from brain cDNA library (accession no: MN708486), suggesting a differential role for timstn2. At the protein level, tiMstn1 and the newly cloned tiMstn2 shared 69% identity and 82% similarity, with higher homology in the C-termini of the peptide (Figure 2B; Table 2). Homology rate analysis showed that tiMstn peptide sequences share 63–86% homology and 78–92% similarity with MSTN peptides of other vertebrates, whereas tiMstn2 shared 60–76% homology and 74–86% similarity (Table 2). Moreover, both of the translated tiMstns possessed the characteristic MSTN cysteine residues and proteolytic RXRR site (Figure 2B) (
Table 2
| Protein | Nile tilapia 1 | Nile tilapia 2 | Human | Mouse | Cow | Salmon 1a | Salmon 1b | Salmon 2a | Medaka | Zebrafish 1(b) | Zebrafish 2(a) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Nile tilapia 1 | 69 | 66 | 65 | 63 | 83 | 82 | 66 | 86 | 80 | 64 | |
| Nile tilapia 2 | 82 | 60 | 63 | 63 | 67 | 66 | 76 | 68 | 71 | 67 | |
| Human | 80 | 74 | 96 | 94 | 66 | 66 | 59 | 64 | 68 | 64 | |
| Mouse | 79 | 76 | 98 | 93 | 65 | 65 | 59 | 63 | 67 | 63 | |
| Cow | 78 | 76 | 96 | 95 | 64 | 64 | 58 | 62 | 66 | 63 | |
| Salmon 1a | 90 | 77 | 78 | 78 | 77 | 93 | 66 | 83 | 86 | 65 | |
| Salmon 1b | 91 | 76 | 79 | 79 | 77 | 95 | 68 | 80 | 85 | 66 | |
| Salmon 2a | 80 | 86 | 74 | 73 | 73 | 77 | 79 | 64 | 66 | 64 | |
| Medaka | 92 | 79 | 77 | 76 | 75 | 88 | 88 | 77 | 80 | 64 | |
| Zebrafish 1(b) | 90 | 82 | 82 | 81 | 76 | 90 | 91 | 78 | 87 | 70 | |
| Zebrafish 2(a) | 78 | 80 | 77 | 77 | 80 | 78 | 78 | 80 | 77 | 82 |
Comparison of the homology of myostatin (MSTN) protein sequences in Nile tilapia with other species.
Table comparing of human, mice, cattle, salmon, Medaka, and zebrafish. Percentage of identity (in bold) and of similarity are shown of protein sequences of Nile tilapia (Oreochromis niloticus) myostatin1 (accession number XP_003458880); Nile tilapia myostatin2 (MN708486); human (Homo sapiens) growth/differentiation factor 8 preproprotein (NP_005250); mouse (Mus musculus) growth/differentiation factor 8 preproprotein (NP_034964); cattle (Bos taurus) growth/differentiation factor 8 precursor (NP_001001525); salmon (Salmo salar) myostatin 1a (ABN72586); salmon myostatin 1b precursor (NP_001117106); salmon myostatin 2a (ABN72587); medaka (Oryzias latipes) growth/differentiation factor 8 precursor (NP_001188428); zebrafish (Danio rerio) myostatin a precursor (NP_001004122); and zebrafish growth/differentiation factor 8 preproprotein (NP_571094). Salmon myostatin 2a is a pseudogene, hence it is not translated into a protein. Regions of local similarity between the protein sequences above were identified using BLAST.
Tilapia mstn Genes Differ in Their Tissue Distribution
Piscine mstn genes are expressed in multiple tissues (
Figure 3

Localization of timstn1 and timstn2 mRNA in various tissues of Nile tilapia using real-time PCR. Expression levels of timstn1 and timstn2 were determined by real-time PCR in juvenile male (A), juvenile females (B), adult males (C), and adult females (D). The data are presented as mean ± SD.
Environmental Conditions Influence the Expression of mstn1 and mstn2 in the Brain and Muscles of Nile Tilapia
Fluctuations in environmental conditions are known to induce hypothalamic activity as part of the homeostatic response to the changes (
Figure 4

Environmental challenges affect the expression of timstn1 and timstn2 in Nile tilapia brain. Expression levels of timstn1(A–C) and timstn2(D–F) were determined by real-time PCR. Expression was analyzed in the fish forebrain (A,D), midbrain (B,E), and hindbrain (C,F). The data are presented as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; #p = 0.053.
Considering its highly conserved role in regulating muscle growth in various fish, we next examined how environmental challenges affect mstn expression in the Nile tilapia muscles. Having found that timstn2 is not expressed in the fish muscles (Figure 3), only timstn1 expression was analyzed. In white muscle tissue, timstn1 expression significantly increased in response to starvation, while other treatments did not affect its expression (Figure 5A). Similar results were seen in red muscle tissue, where only starvation elicited a significant increase in timstn1 expression. Interestingly, heat treatment led to a significant reduction of timstn1 expression in the red muscle (Figure 5B).
Figure 5

Environmental challenges affect the expression of timstn1 in Nile tilapia muscle tissues. Expression levels of timstn1 mRNA in the white muscle (A) and red muscle (B) were determined by real-time PCR. The data are presented as mean ± SD. *p < 0.05; ****p < 0.0001.
The Effect of Environmental Challenges on Protein and Triglyceride Metabolism
Stress induces a rise in cortisol that, in turn, influences metabolism of carbohydrates, lipids and proteins (
Figure 6

Metabolic parameters in plasma of Nile tilapia remained unchanged in response to various environmental conditions. Total protein (A) and triglyceride (B) levels were determined by photometric measurement. Plasma cortisol levels (C) were analyzed using a specific ELISA. The data are presented as mean ± SD. #p = 0.098.
Discussion
The majority of fish genomes contain multiple copies of mstn that are expressed in various tissues including the muscles, brain, gonads, liver and others. Moreover, within a given species, paralogous mstn genes may differ in their tissue distribution (
Phylogenetic analysis of mstn ORFs showed that piscine mstn genes form two clusters, one that contains mstn1 ORFs, including that of Nile tilapia, and another containing mstn2 ORFs, including the newly identified Nile tilapia mstn2. As demonstrated for other fish, the mstn gene duplication in tilapia is probably a result of a genome duplication event that occurred in a common ancestor during fish evolution (
Although piscine mstn genes were suggested to have pleiotropic functions, several works have demonstrated their importance as regulators of muscle mass in fish (
Several studies have demonstrated that exposing fish to environmental challenges, such as food shortage or temperature changes, lead to alterations in mstn expression. Yet, the responsiveness of mstn seems to vary between species and challenges (
In the muscle, MSTN was shown to suppress satellite cell proliferation from fish to mammals (
Environmental stressors stimulate the secretion of stress hormones such as cortisol. Once in circulation, cortisol initiates a secondary response, which involves metabolic changes with aim to restore homeostasis (
In summary, in this study we have identified a second mstn gene in the Nile tilapia genome and designated it timstn2. We have shown that timstn1 and timstn2 differ in their tissue distribution and between sexes, as well as in their responsiveness to environmental challenges. Furthermore, timstn1 expression in the fish brain was not correlated to its expression in the muscles, suggesting that the regulation of mstn genes expression in Nile tilapia is gene- and tissue-specific. As various environmental challenges affected the expression of both timstn genes, we suggest that the MSTN system is involved in the regulation of Nile tilapia response to external conditions.
Statements
Data availability statement
The datasets generated for this study can be found in the GenBank MN708486.
Ethics statement
The animal study was reviewed and approved by Agricultural Research Organization (ARO) Committee for Ethics in Using Experimental Animals, Approval number: 775/18 IL.
Author contributions
JB designed research. AS-H, GA, KT, and TN performed research. JB, AS-H, and GA analyzed data. JB and AS-H wrote the paper.
Funding
This research was funded by grant 20-04-0046 from the Chief Scientist of the Ministry of Agriculture andRural Development.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
References
1.
McPherronACLawlerAMLeeS-J. Regulation of skeletal muscle mass in mice by a new TGF-p superfamily member. Nature. (1997) 387:83–90. 10.1038/387083a0
2.
SharmaMMcFarlaneCKambadurRKukretiHBonalaSSrinivasanS. Myostatin: expanding horizons. IUBMB Life. (2015) 67:589–600. 10.1002/iub.1392
3.
AmthorHOttoAMachariaRMcKinnellIPatelK. Myostatin imposes reversible quiescence on embryonic muscle precursors. Dev Dyn. (2006) 235:672–80. 10.1002/dvdy.20680
4.
McPherronACLeeSJ. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci USA. (1997) 94:12457–61. 10.1073/pnas.94.23.12457
5.
RodgersBDGarikipatiDK. Clinical, agricultural, and evolutionary biology of myostatin: a comparative review. Endocr Rev. (2008) 29:513–34. 10.1210/er.2008-0003
6.
ElliottBRenshawDGettingSMackenzieR. The central role of myostatin in skeletal muscle and whole body homeostasis. Acta Physiol. (2012) 205:324–40. 10.1111/j.1748-1716.2012.02423.x
7.
KangJ-DKimSZhuH-YJinLGuoQLiX-Cet al. Generation of cloned adult muscular pigs with myostatin gene mutation by genetic engineering. RSC Adv. (2017) 7:12541–9. 10.1039/C6RA28579A
8.
LeeJ-HMomaniJKimYMKangC-KChoiJ-HBaekH-Jet al. Effective RNA-silencing strategy of Lv-MSTN/GDF11 gene and its effects on the growth in shrimp, Litopenaeus vannamei. Comp Biochem Physiol B Biochem Mol Biol. (2015) 179:9–16. 10.1016/j.cbpb.2014.09.005
9.
LvQYuanLDengJChenMWangYZengJet al. Efficient generation of myostatin gene mutated rabbit by CRISPR/Cas9. Sci Rep. (2016) 6:25029. 10.1038/srep25029
10.
XuC. Analysis of myostatin gene structure, expression and function in zebrafish. J Exp Biol. (2003) 206:4067–79. 10.1242/jeb.00635
11.
XuTSGuLHZhangXHYeBGLiuXLHouSS. Characterization of myostatin gene (MSTN) of Pekin duck and the association of its polymorphism with breast muscle traits. Genet Mol Res. (2013) 12:3166–77. 10.4238/2013.February.28.18
12.
KerrTRoalsonEHRodgersBD. Phylogenetic analysis of the myostatin gene sub-family and the differential expression of a novel member in zebrafish. Evol Dev. (2005) 7:390–400. 10.1111/j.1525-142X.2005.05044.x
13.
RodgersBDRoalsonEHWeberGMRobertsSBGoetzFW. A proposed nomenclature consensus for the myostatin gene family. Am J Physiol Endocrinol Metab. (2007) 292:E371–E2. 10.1152/ajpendo.00395.2006
14.
AmaliAALinCJ-FChenY-HWangW-LGongH-YLeeC-Yet al. Up-regulation of muscle-specific transcription factors during embryonic somitogenesis of zebrafish (Danio rerio) by knock-down of myostatin-1. Dev Dyn. (2004) 229:847–56. 10.1002/dvdy.10454
15.
RodgersBD. Isolation and characterization of myostatin complementary deoxyribonucleic acid clones from two commercially important fish: Oreochromis mossambicus and Morone chrysops. Endocrinology. (2001) 142:1412–8. 10.1210/endo.142.4.8097
16.
GabillardJCBigaPRRescanPYSeiliezI. Revisiting the paradigm of myostatin in vertebrates: insights from fishes. Gen Comp Endocrinol. (2013) 194:45–54. 10.1016/j.ygcen.2013.08.012
17.
De SantisCJerryDR. Differential tissue-regulation of myostatin genes in the teleost fish Lates calcarifer in response to fasting. Evidence for functional differentiation. Mol Cell Endocrinol. (2011) 335:158–65. 10.1016/j.mce.2011.01.011
18.
MaccatrozzoLBargelloniLCardazzoBRizzoGPatarnelloT. A novel second myostatin gene is present in teleost fish. FEBS Lett. (2001) 509:36–40. 10.1016/S0014-579303124-6
19.
RobertsSBGoetzFW. Differential skeletal muscle expression of myostatin across teleost species, and the isolation of multiple myostatin isoforms. FEBS Lett. (2001) 491:212–6. 10.1016/S0014-579302196-2
20.
ChisadaS-iOkamotoHTaniguchiYKimoriYToyodaASakakiYet al. Myostatin-deficient medaka exhibit a double-muscling phenotype with hyperplasia and hypertrophy, which occur sequentially during post-hatch development. Dev Biol. (2011) 359:82–94. 10.1016/j.ydbio.2011.08.027
21.
WangCChenY-LBianW-PXieS-LQiG-LLiuLet al. Deletion of mstna and mstnb impairs the immune system and affects growth performance in zebrafish. Fish Shellfish Immunol. (2018) 72:572–80. 10.1016/j.fsi.2017.11.040
22.
ZhongZNiuPWangMHuangGXuSSunYet al. Targeted disruption of sp7 and myostatin with CRISPR-Cas9 results in severe bone defects and more muscular cells in common carp. Sci Rep. (2016) 6:22953. 10.1038/srep22953
23.
KishimotoKWashioYYoshiuraYToyodaAUenoTFukuyamaHet al. Production of a breed of red sea bream Pagrus major with an increase of skeletal muscle mass and reduced body length by genome editing with CRISPR/Cas9. Aquaculture. (2018) 495:415–27. 10.1016/j.aquaculture.2018.05.055
24.
WeberTEBosworthBG. Effects of 28 day exposure to cold temperature or feed restriction on growth, body composition, and expression of genes related to muscle growth and metabolism in channel catfish. Aquaculture. (2005) 246:483–92. 10.1016/j.aquaculture.2005.02.032
25.
NeboCPortellaMCCaraniFRde AlmeidaFLAPadovaniCRCarvalhoRFet al. Short periods of fasting followed by refeeding change the expression of muscle growth-related genes in juvenile Nile tilapia (Oreochromis niloticus). Comp Biochem Physiol B Biochem Mol Biol. (2013) 164:268–74. 10.1016/j.cbpb.2013.02.003
26.
LimaECSPovhJAOtonelRAALeonhardtJHAlfieriAAHeadleySAet al. Morphology and muscle gene expression in GIFT and Supreme Nile tilapia varieties reared in two cultivation systems. Genet Mol Res. (2017) 16:gmr16019407. 10.4238/gmr16019407
27.
ChauvignéFGabillardJCWeilCRescanPY. Effect of refeeding on IGFI, IGFII, IGF receptors, FGF2, FGF6, and myostatin mRNA expression in rainbow trout myotomal muscle. Gen Comp Endocrinol. (2003) 132:209–15. 10.1016/S0016-648000081-9
28.
VianelloSBrazzoduroLDalla ValleLBelvederePColomboL. Myostatin expression during development and chronic stress in zebrafish (Danio rerio). J Endocrinol. (2003) 176:47–59. 10.1677/joe.0.1760047
29.
TerovaGBernardiniGBinelliGGornatiRSarogliaM. cDNA encoding sequences for myostatin and FGF6 in sea bass (Dicentrarchus labrax, L.) and the effect of fasting and refeeding on their abundance levels. Domest Anim Endocrinol. (2006) 30:304–19. 10.1016/j.domaniend.2005.08.003
30.
XieSZhouAFengYWangZFanLZhangYet al. Effects of fasting and re-feeding on mstn and mstnb genes expressions in Cranoglanis bouderius. Gene. (2019) 682:1–12. 10.1016/j.gene.2018.09.050
31.
RodgersBDWeberGMKelleyKMLevineMA. Prolonged fasting and cortisol reduce myostatin mRNA levels in tilapia larvae; short-term fasting elevates. Am J Physiol Regul Integr Comp Physiol. (2003) 284:R1277–86. 10.1152/ajpregu.00644.2002
32.
BostockJMcAndrewBRichardsRJaunceyKTelferTLorenzenKet al. Aquaculture: global status and trends. Philoso Trans R Soc B Biol Sci. (2010) 365:2897–912. 10.1098/rstb.2010.0170
33.
GuyonRRakotomangaMAzzouziNCoutanceauJPBonilloCD'CottaHet al. A high-resolution map of the Nile tilapia genome: a resource for studying cichlids and other percomorphs. BMC Genomics. (2012) 13:222. 10.1186/1471-2164-13-222
34.
SolerLConteMAKatagiriTHoweAELeeBYAmemiyaCet al. Comparative physical maps derived from BAC end sequences of tilapia (Oreochromis niloticus). BMC Genomics. (2010) 11:636. 10.1186/1471-2164-11-636
35.
AltschulSFMaddenTLSchafferAAZhangJZhangZMillerWet al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. (1997) 25:3389–402. 10.1093/nar/25.17.3389
36.
KentWJSugnetCWFureyTSRoskinKMPringleTHZahlerAMet al. The human genome browser at UCSC. Genome Res. (2002) 12:996–1006. 10.1101/gr.229102
37.
KumarSStecherGTamuraK. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. (2016) 33:1870–4. 10.1093/molbev/msw054
38.
SimoesJMTelesMCOliveiraRFVan der LindenAVerhoyeM. A three-dimensional stereotaxic MRI brain atlas of the cichlid fish Oreochromis mossambicus. PLoS ONE. (2012) 7:e44086. 10.1371/journal.pone.0044086
39.
YangCGWangXLTianJLiuWWuFJiangMet al. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus). Gene. (2013) 527:183–92. 10.1016/j.gene.2013.06.013
40.
LivakKJSchmittgenTD. Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT method. Methods. (2001) 25:402–8. 10.1006/meth.2001.1262
41.
SchmittgenTDLivakKJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc. (2008) 3:1101–8. 10.1038/nprot.2008.73
42.
AizenJKasutoHGolanMZakayHLevavi-SivanB. Tilapia follicle-stimulating hormone (FSH): immunochemistry, stimulation by gonadotropin-releasing hormone, and effect of biologically active recombinant FSH on steroid secretion. Biol Reprod. (2007) 76:692–700. 10.1095/biolreprod.106.055822
43.
YehCMGlockMRyuS. An optimized whole-body cortisol quantification method for assessing stress levels in larval zebrafish. PLoS ONE. (2013) 8:e79406. 10.1371/journal.pone.0079406
44.
TamuraKNeiM. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. (1993) 10:512–26. 10.1093/oxfordjournals.molbev.a040023
45.
FelsensteinJ. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. (1985) 39:783–91. 10.1111/j.1558-5646.1985.tb00420.x
46.
WanZYXiaJHLinGWangLLinVCYueGH. Genome-wide methylation analysis identified sexually dimorphic methylated regions in hybrid tilapia. Sci Rep. (2016) 6:35903. 10.1038/srep35903
47.
BhattaSIwaiTMiuraCHiguchiMShimizu-YamaguchiSFukadaHet al. Gonads directly regulate growth in teleosts. Proc Natl Acad Sci USA. (2012) 109:11408–12. 10.1073/pnas.1118704109
48.
BiranJBlechmanJWircerELevkowitzG. Development and function of the zebrafish neuroendocrine system. In: Ludwig M, Levkowitz G, editors. Model Animals in Neuroendocrinology: From Worm to Mouse to Man. Hoboken, NJ: Wiley-Blackwell (2018). p. 101–31.
49.
EbbessonLOEBraithwaiteVA. Environmental effects on fish neural plasticity and cognition. J Fish Biol. (2012) 81:2151–74. 10.1111/j.1095-8649.2012.03486.x
50.
ZupancGKH. Neurogenesis and neuronal regeneration in the adult fish brain. J Comp Physiol A. (2006) 192:649. 10.1007/s00359-006-0104-y
51.
MommsenTPVijayanMMMoonTW. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev Fish Biol Fisher. (1999) 9:211–68. 10.1023/A:1008924418720
52.
GaltNJMcCormickSDFroehlichJMBigaPR. A comparative examination of cortisol effects on muscle myostatin and HSP90 gene expression in salmonids. Gen Comp Endocrinol. (2016) 237:19–26. 10.1016/j.ygcen.2016.07.019
53.
TaylorJS. Genome duplication, a trait shared by 22,000 species of ray-finned fish. Genome Res. (2003) 13:382–90. 10.1101/gr.640303
54.
SunYYuXTongJ. Polymorphisms in myostatin gene and associations with growth traits in the common carp (Cyprinus carpio L.). Int J Mol Sci. (2012) 13:14956–61. 10.3390/ijms131114956
55.
YangYPengKLiuXZhaoDDuanJHuWet al. Effects of sex steroids on expression of myostatin in rare minnow, Gobiocypris rarus. Aquaculture. (2012) 350–3:1–7. 10.1016/j.aquaculture.2012.04.031
56.
GarikipatiDKRodgersBD. Myostatin inhibits myosatellite cell proliferation and consequently activates differentiation: evidence for endocrine-regulated transcript processing. J Endocrinol. (2012) 215:177–87. 10.1530/JOE-12-0260
57.
McCroskerySThomasMMaxwellLSharmaMKambadurR. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol. (2003) 162:1135–47. 10.1083/jcb.200207056
58.
BertottoDPoltronieriCNegratoERichardJPascoliFSimontacchiCet al. Whole body cortisol and expression of HSP70, IGF-I and MSTN in early development of sea bass subjected to heat shock. Gene Comp Endocrinol. (2011) 174:44–50. 10.1016/j.ygcen.2011.08.003
59.
RodriguezJVernusBChelhICassar-MalekIGabillardJCHadj SassiAet al. Myostatin and the skeletal muscle atrophy and hypertrophy signaling pathways. Cell Mol Life Sci. (2014) 71:4361–71. 10.1007/s00018-014-1689-x
Summary
Keywords
homeostasis, myostatin (MSTN), nile tilapia (Oreochromis nilocticus), environmental challenges, gene duplication
Citation
Segev-Hadar A, Alupo G, Tal K, Nitzan T and Biran J (2020) Identification and Characterization of a Non-muscular Myostatin in the Nile Tilapia. Front. Endocrinol. 11:94. doi: 10.3389/fendo.2020.00094
Received
02 December 2019
Accepted
14 February 2020
Published
28 February 2020
Volume
11 - 2020
Edited by
Krystyna Pierzchala-Koziec, University of Agriculture in Krakow, Poland
Reviewed by
Honoo Satake, Suntory Foundation for Life Sciences, Japan; Lei Zhou, Guangxi University, China
Updates

Check for updates
Copyright
© 2020 Segev-Hadar, Alupo, Tal, Nitzan and Biran.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Jakob Biran jakob@volcani.agri.gov.il
This article was submitted to Cellular Endocrinology, a section of the journal Frontiers in Endocrinology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.