ORIGINAL RESEARCH article

Front. Endocrinol., 22 February 2021

Sec. Thyroid Endocrinology

Volume 11 - 2020 | https://doi.org/10.3389/fendo.2020.545339

High Diagnostic Yield of Targeted Next-Generation Sequencing in a Cohort of Patients With Congenital Hypothyroidism Due to Dyshormonogenesis

  • 1. INSERM U1016, Cochin Institute, Faculté de Médecine, Université Paris Descartes, Sorbonne Paris Cité, Paris, France

  • 2. IMAGINE Institute affiliate, Paris, France

  • 3. Pediatric Endocrinology, Gynecology and Diabetology Unit, Hôpital Universitaire Necker-Enfants Malades, AP-HP, Paris, France

  • 4. Laboratory of Human Molecular Genetics, Medicine School, University of Sfax, Sfax, Tunisia

  • 5. Pediatric Immunology, Department of Biomedicine, University of Basel, Basel, Switzerland

  • 6. Pediatric Endocrinology, University Children’s Hospital Basel, University of Basel, Basel, Switzerland

  • 7. INSERM U1163, IMAGINE Institute, Translational Genetics, Université Paris Descartes, Sorbonne Paris Cité, Paris, France

  • 8. Genomics Platform, INSERM UMR 1163, Paris Descartes Sorbonne Paris Cite University, Imagine Institute, Paris, France

  • 9. Bioinformatics Platform, Paris Descartes University, IMAGINE Institute, Paris, France

  • 10. Endocrinology Department, CHU Hedi Chaker, Sfax, Tunisia

  • 11. Pediatrics Department, CHU Nantes, Nantes, France

  • 12. Pediatrics Department, CHU Rennes, Rennes, France

  • 13. Pediatrics Department, CHU La Timone, Marseille, France

  • 14. CHU de Bordeaux, Pediatric Endocrinology, Bordeaux, France

  • 15. Pediatrics Department, CHU Hedi Chaker, Sfax, Tunisia

  • 16. Medical Genetics Department, CHU Hedi Chaker, Sfax, Tunisia

  • 17. Centre de Référence des Maladies Endocriniennes Rares de la Croissance et du Développement, Necker-Enfants Malades University Hospital, Paris, France

  • 18. Centre Régional de Dépistage Néonatal (CRDN) Ile de France, Paris, France

Article metrics

View details

23

Citations

3,9k

Views

1,9k

Downloads

Abstract

Objective:

To elucidate the molecular cause in a well-characterized cohort of patients with Congenital Hypothyroidism (CH) and Dyshormonogenesis (DH) by using targeted next-generation sequencing (TNGS).

Study design:

We studied 19 well-characterized patients diagnosed with CH and DH by targeted NGS including genes involved in thyroid hormone production. The pathogenicity of novel mutations was assessed based on in silico prediction tool results, functional studies when possible, variant location in important protein domains, and a review of the recent literature.

Results:

TNGS with variant prioritization and detailed assessment identified likely disease-causing mutations in 10 patients (53%). Monogenic defects most often involved TG, followed by DUOXA2, DUOX2, and NIS and were usually homozygous or compound heterozygous. Our review shows the importance of the detailed phenotypic description of patients and accurate analysis of variants to provide a molecular diagnosis.

Conclusions:

In a clinically well-characterized cohort, TNGS had a diagnostic yield of 53%, in accordance with previous studies using a similar strategy. TG mutations were the most common genetic defect. TNGS identified gene mutations causing DH, thereby providing a rapid and cost-effective genetic diagnosis in patients with CH due to DH.

Introduction

Congenital hypothyroidism (CH) is the most common neonatal endocrine disorder, with an incidence of 1/2,500–3,500 newborns (1, 2). Among patients with CH, 65% have thyroid dysgenesis (TD), with a large phenotypic spectrum encompassing athyreosis, thyroid ectopy, hypoplasia of an orthotopic gland, and hemithyroid (3). In the remaining 35% of patients, CH is due to dyshormonogenesis (DH) with a thyroid gland in situ (GIS) with or without goiter. DH may lead to goiter formation due to thyroid tissue overstimulation by increased TSH levels. Most cases of DH are due to mutations in TG, TPO, SLC5A5/NIS, SLC26A4/PDS, IYD/DEHAL1, DUOX2, DUOXA2, DUOX1, DUOXA1, and SLC26A7, which are involved in thyroid hormone production and usually inherited on an autosomal recessive basis (46).

The proportion of patients with CH due to DH who receive a molecular diagnosis varies widely across studies, from 20 to 60% (713). Factors contributing to this variability include differences in patient phenotypes, clinical characterization of the patients (imaging techniques, as thyroid ultrasound and scintigraphy, perchlorate test, thyroglobulin measurement), geographic origin, and mainly variant classification.

The objective of this study was to assess the diagnostic yield of targeted Next Generation Sequencing (TNGS) in a cohort of 19 well-characterized patients with CH due to DH. We also report the results of an extensive literature review of studies describing genetic findings in patients with CH, with special attention to those having DH.

Materials and Methods

Patients

Nineteen patients with permanent primary CH, referred by various centers in France, Tunisia (n = 2), and the United States of America (USA) (n = 1) were included in the study. Diagnosis of primary CH was based on systematic newborn screening in France and increased venous TSH at control blood sample. Cut-off in blood spot for newborn screening is 15 mIU/L in France and 20 mIU/L in New York (USA); no newborn screening is available in Tunisia. CH was diagnosed at birth for all patients except the patient from USA and the Tunisian patients diagnosed during the first months or year of life, respectively, due to clinical symptoms suggesting hypothyroidism and confirmed by high TSH levels and low free T4 levels (FT4), according to laboratory reference values. Inclusion criteria of 19 patients were CH with GIS and at least one of the following: clinical goiter (≥2SD), available thyroid scintigraphy providing an evaluation of thyroid position and radionuclide uptake, and a perchlorate discharge test performed. This study was approved by French Biomedecine Agency. Written, informed consent was obtained from the individuals and minors’ legal guardian for the publication of any potentially identifiable images or data included in this article.

Detection of Mutations

We designed a TNGS panel (HypothySeq NGS) of 78 genes including genes known to be associated with CH (thyroid dysgenesis; dyshormonogenesis; thyroid hormone transport protein defects; and inborn errors in thyroid hormone membrane transport, metabolism, or action) and candidate genes that have been identified in animal models (mouse and zebrafish knock-out models) or by microarray assays but not yet validated in humans. Sensitivity (false-negative rate) of the panel was assessed in positive controls with known thyroid disease-causing mutations, including mutations in dyshormonogenesis genes, and specificity (false-positive rate) in healthy individuals previously screened using whole exome sequencing for another research project.

TNGS on HiSeq 2500 system (Illumina, San Diego, CA) and bioinformatics analyses were already described (14). Mean coverage for each gene is reported Table 1.

Table 1

Reference transcriptAverage
coverage
TGNM_003235614
TPONM_000547694
DUOX2NM_014080586
DUOXA2NM_207581516
NIS/SLC5A5NM_000453577
PDS/SLC26A4NM_000441720
DEHAL1/IYDNM_001164694,
NM_203395
580

Reference transcript and average coverage of genes responsible for CH and DH.

Prioritizing Strategy for Filtering Pathogenic Variants

Variants (including frameshift mutations, missense and nonsense mutations, and splicing-site mutations) identified in known dyshormonogenesis genes were considered for the analysis. If available, functional data and segregation analysis results were taken into consideration.

Inheritance is recessive for TPO, TG, DUOX2, DUOXA2, SLC5A5, and SLC26A4 and dominant for PAX8. Genome variations were defined using PolyDiag in-house software for TNGS, which filters out irrelevant and common polymorphisms based on frequencies extracted from the following public databases: US National Center for Biotechnology Information database of single nucleotide polymorphisms (SNP) (dbSNP), 1000 Genomes, Exome Variant Server and Exome Aggregation Consortium (ExAC). Consequences of mutations on protein function were predicted using three algorithms: Polyphen2, SIFT, and Mutation Taster. Mutations were ranked based on the impact of each variant predicted by combined annotation-dependent depletion (CADD) then compared using the mutation significance cut-off, which is a gene-level specific cutoff for CADD scores.

For deletions or insertions in exons, information on the variants was sought in similar published studies. Sanger sequencing was performed to validate and segregate the identified variants (3500xL Genetic Analyzer, Thermo Fisher Scientific, Waltham, MA). Primer sequences are shown in Table 2.

Table 2

GeneExonPrimer ForwardPrimer Reverse
PAX83GGCTCTGGCTAAATCCCTGTCTAATCCCTGCCTGATTGTTCAGCAT
PAX87TGCAGGAAGGTCGGCTTGTTGACAGCCAGCCAAGCTCTTCA
SLC5A59_10GATGGTGTGGACGGTCTCTCTAATGGGAAAGAGGGAAAGG
TG5GAGTGCATATGCTGCTCGACTCAAGGTGAGTGTGGGCTG
TG6TTCCTTTTCACTAGGCGTGGGCAGGCAGTCACTCTAGCTG
TG7AACTTTGAAACCCAAGAGGCAGGTCAGGGCTTCCTTTCTG
TG9CTCTGTGCCAGAAGATGTGGCTGTACTGCATTGGGTCAGG
TG22TAGGAGTCAGGGGATTCCAGAGCCCTTGAGACTACTCCCC
TG26TCCAACTCTGCCATGTTTTGCAGCTCCATGTTGTGTGTCC

Primers sequences to verify variants by PCR and Sanger sequencing.

Results

Clinical Description of the Study Cohort

We studied 19 index cases of CH due to dyshormonogenesis (Table 3). Among them, 16 were born in France [two of them (patients #4 and #18) born in France to consanguineous parents, and of Moroccan and Turkish origin, respectively] and were diagnosed with primary CH at birth by routine neonatal screening (TSH cutoff, 15 mIU/L) followed by a venous-blood TSH assay. CH was diagnosed at day 75 of age in one patient (#19) born in the USA and at 2 months and 5 months of age in two patients (#14 and #15 respectively) born in Tunisia. These three patients underwent evaluation for clinical symptoms suggesting hypothyroidism and were found to have high TSH levels and low FT4 levels. Of the 19 patients, eight had a family history of CH and five were born to consanguineous parents, including one with an affected sibling (#1). A goiter was evident at diagnosis in nine patients including two (#3 and #16) diagnosed with goiter in utero. Fetal goiter was diagnosed during one of the routine fetal sonograms performed in France during pregnancy at 13, 22, and 32 gestational weeks. In our cases, the diagnosis was made on the second ultrasound, around 22 gestational week and treated with intraamniotic levothyroxine injections, mean dose between 200 and 400 micrograms/injection. The response to levothyroxine treatment was assessed by decrease in thyroid size in fetal ultrasound and/or normalization of fetal thyroid hormones. According to the European Society for Paediatric Endocrinology guidelines (15) the FT4 level at diagnosis indicated severe CH in nine patients (FT4<5 pmol/L) and moderate CH in 1 patient (FT4, 10–15 pmol/L). Thyroglobulin was not assayed routinely. A perchlorate discharge test was performed in 14 patients, of whom 11 had a positive result >10%.

Table 3

Patient Country of originConsanguineous parents Age / Sex Age at diagnosisTSH at diagnosis (mIU/L)free T4 atThyroglobulinGoiter at diagnosis Cervical Ultrasound Thyroid Scintigraphy Perchlorate test Associated features Familial cases
1FranceNo19 y / MD94703.5NANoNANormal position - elevated uptake11%CH in a brother with similar clinical features
2FranceNo30 y / MD1949NA1.5YesNormal position - RL 46x25 mm - LL 45x30 mmNormal position - elevated uptakeN
3FranceNo6 y / MD191438.4NAYes. In uteroNANormal position, normal uptake10.4%Subclinical non-autommune hypothyroidism in mother and grand-mother
4MoroccoYes9 y / FD19100NA2,512Ye, mildNormal position - RL 18x9 mm - LL 20x10 mmNormal position - elevated uptake84%
5FranceNo19 y / MD146573NANoNANormal position - elevated uptake50%
6TunisiaYes11 y / MD4637undetectableNAYesNormal positionNormal position, normal uptakeN
7FranceNo6 y / FD84436.11.2NoNormal position - RL 21x10 mm - LL 17x10 mmNormal position13%
8FranceNo24 y / FD31106.2NANoNormal positionNormal position - elevated uptake42%
9FranceNo22 y / MD3high (NA)NANAYes, mildNormal positionNANA2 brothers with CH and similar clinical presentation
10FranceNo17 y / FD13580< 1.8NAYesNormal position RL 30x6 mm - LL 30x3.5 mmNo Iodine uptake
11FranceNo3 y / MD1030014NANoNANormal position - normal uptake50%Unilateral cryptorchidism - no renal anomaliesCH and gland in situ (mother) - urinary tract duplication (father)
12FranceNo7 y / FD953.8NA431NoNormal position - length: RL 21 mm - LL 21 mmNormal position - normal uptake25%
13FranceNo8 y / FD9111.5< 5NANoNormal position - RL 7.7x5 mm - LL 8.1x5.9 mmNormal position57%CH in the twin sister
14TunisiaYes32 y / M2 M90235NoNormal positionNo Iodine uptakeNACH (brother. similar clinical presentation) - CH (uncle)
15TunisiaYes24 y / F5 M> 60< 0.5NANoNormal positionNo Iodine uptakeNA
16FranceNo15 y / MD11804.9NAYe, in uteroNormal positionNormal position26%
17FranceNo26 y / MD337.62071YesNormal position - RL 6x4x11 mm - LL 4x5x10 mmNormal position - normal uptakeNCH in the sister
18TurkeyYes9 y / FD35913.52,110YesNormal position - RL 40x20x10 mm - LL 40x19.5x11 mmNormal position27%
19United StatesNo5 y / FD757551.2NANoNormal positionNormal position - reduced uptakeNAPrematurity. No intrauterine growthCH in the twin sister
Normal valuesAgeTSH (mIU/L)T4 (pmol/L)
2 – 7 D1.1 – 15.611.6 – 36.0
8– 15 D0.87 – 7.89.5 – 28.9
16– 30 D0.82 – 6.99.3 – 23.5
1 month – 1y0.80- 6.058.3 – 18.6
Normal valuesTG20-70ng/mL

Clinical description of cohort of patients with CH due to DH.

NA, not available; N, normal; D, days; M, months; y, years; M, male; F, female; RL, right lobe; LL, left lobe. Normal perchlorate discharge test is considered when the discharge is less than 10%.

Genetic Results and Diagnostic Yield

TGNS allowed the molecular diagnosis in the majority of patients (10/19) screened, providing a diagnostic yield of 53% (Table 4, Figures 13). We identified of 14 novel variants on 24. Twelve/24 variants were causative in function of the context (genetic model, specificity of variants). TG was the most common site of mutations, followed by DUOXA2 for causative variants (Figure 1). Figure 2 shows the familial pedigrees and Figure 3 the location of DH-causing mutations.

Table 4

Patient Gene cDNA change Amino acid change Exon Homozygous (ho)/Heterozygous (he)Variant type Protein DomainVariant name - ExAC frequence/dbSNP or MAF and allele frequency in gnomADIn silico predictionInheritanceReference/ho or het/Functional studyCausative
SIFTPolyphen-2Mutation TasterCADD score
1TGc.638+1 G>A1_ex.5Hesplice donor regionType 1 repeat8_133885467_G_A- 025.9carrier motherAlzahrani et al. (16) / ho / noYes
TGc.886 C>Tp.R277X7Hepremature stop codonType 1 repeatrs121912648 - 0.0003625 - gnomAD 0.000353537carrier fatherVan de graaf et al. (17) / ho / noYes
2TGc.6701 C>Ap.A2215D38HomissenseACHE-like domainrs370991693 - 0.00004141 - gnomAD 0.00004245DeleteriousDamagingDisease causing32NACaputo et al. (18), Pardo et al. 2009 (19)/ het compound and ho/ deficient TG secretion, retention in cellsYes
DUOX2c.601_602insGp.G202Tfs996HeframeshiftN-terminal peroxidase-like domainrs565500345 - 0.001 - gnomAD 0.00009553-1NAPfarr et al. (20)-het compound/ NoNo
3TGc.2132_2133insGp.A693Gfs249HeframeshiftType 1 repeat8_133899750_A_AG- 0-1NoYes
TGc.4588 C>Tp.R1511X22Hepremature stopType 1 repeatrs121912646 - 0.00006591 -gnomAD 0.0000919538carrier fatherTargovnik et al. (21), ho/ NoYes
SLC26A4c.199 A>Cp.T67P3Hemissense7_107303775_A_C - 0DeleteriousBenignPolymorphism8.8NoNo
DUOX2c.598 G>Ap.G200R6HemissenseN-terminal peroxidaselike domainrs2467827 - 0.003 -gnomAD 0.0009541ToleratedPossibly damagingDisease causing11.2NoNo
4DUOX2c.3155 G>Ap.C1052Y24missensers76343591 - 0.004218 -gnomAD 0.001294DeleteriousPossibly damagingPolymorphism24.7NATonacchera et al. (22)/ het compound / partial defect in H2O2 productionYes
TGc.5299_5301 del.GATp.D1748del27Heno frameshiftType 3 repeatrs112749206 - 0.011 -gnomAD 0.004399NABrust et al. (23)/ het compound / NoNo
TGc.5370 A>Gp.I1771M27HemissenseType 3 repeatrs73710715 - 0.011 -gnomAD 0.004414BenignToleratedPolymorphism0NANoNo
5TGc.648_649insGp.A198Gfs146HeframeshiftType 1 repeat8_133894118_T_TG - 0-1carrier motherNoYes
TGc.4588 C>Tp.R1511X22Hepremature stop codonType 1 repeatrs121912646 - 0.00006591 -gnomAD 0.0000919538carrier fatherTargovnik et al. (21)/ ho /NoYes
6TGc.7859 G>Ap.G2601D45HemissenseACHE-like domainrs978923522 - 0ToleratedBenignPolymorphism9.9NANoNo
7TGc.886C>Tp.R277X7Hepremature stop codonType 1 repeatrs121912648 - 0.0003625 -gnomAD 0.000353537carrier fatherVan de graaf et al. (17)/ ho / NoYes
TGc.5182T>Cp.C1709R26HemissenseType 3 repeatrs37600169 - 0.00002471DeleteriousDamagingDisease causing25.2carrier motherNoYes
8DUOXA2c.205+2T>C2_ex2Heessential splicingII transmembrane domainrs201506037 - 0.00038 -gnomAD 0.000458325.2NANoYes
DUOXA2c.463C>Gp.L155V4Hecodingextracellular domainrs201808443 - 0.00040 -gnomAD 0.0004595DeleteriousDamagingDisease causing24.7NANoYes
TGc.2233_2234insTp.L727Afs*310HeframeshiftType 1 repeateva_exac_8_133900286_C_CT - 0-1NANo?
TGc.3452delTp.V1132Afs*3116HeframeshiftType 1 repeatrs766130576 - 0.00003NANo?
9TPOc.866 T>Cp.F289S8HemissenseHeme peroxidase2_1480904_T_C - 0DeleteriousDamagingDisease causing25.2NoNo
10TPOc.1768+1insGTCTGCCAG1_ex10Hesplice donor regionHeme peroxidase2_1491764_G_GGTCTGC CAG - 0-1NoNo
11PAX8c.101 T>Ap. I34N3HemissensePaired box protein2_114004421_A_T_0.00008331DeleteriousDamagingDisease causing28.2carrier motherLanzerath et al. (24)/ thyroid hypoplasia / het compound / NoYes
12PAX8c.397C>Tp.R133W5HemissensePaired box protein2_114000348_G_A - 0DeleteriousDamagingDisease causing35NAVincenzi et al. (25) / het / Yes but not deleterious on TGNo
13PAX8c.658 C>Tp.R220X7Hepremature stop codon2_113999247_G_A - 037carrier motherFu et al. (26) / het hypoplasia / NoNo
14SLC5A5c.1183 G>Ap.G395R10HomissenseX transmembrane domainrs121909180 - 0.00006595 -gnomAD 0.00004597DeleteriousDamagingDisease causing33carrier mother, father NAKosugi et al. (27)/ ho / no iodide uptakeYes
15SLC5A5c.1183 G>Ap.G395R10HomissenseX transmembrane domainrs121909180 - 0.00006595 -gnomAD 0.00004597DeleteriousDamagingDisease causing33carrier father and motherKosugi et al. (27)/ ho / no iodide uptakeYes

Molecular and protein descriptions regarding variants found in patients with CH due to DH.

NA, Not available.

? No definitive molecular diagnosis.

For TG, the amino acid positions are numbered after subtracting the 19-amino acid signal peptide.

Figure 1

Figure 2

Figure 3

TG Variants

Seven novel variants have been identified by TNGS in our study cohort, located mainly in the type 1 repeat protein domain and the acetylcholinesterase (ACHE)-like domain.

Two siblings (patient #1 and his brother) were compound heterozygous for two previously described TG mutations: an insertion in a splice site (c.638+1 G>A) leading to exon 5 skipping and a missense mutation (c.886C>T, pR277X) producing a premature stop codon (16, 17). Familial segregation and Sanger sequencing confirmed that one variant was transmitted by the mother and the other one by the father (Table 4). Another known homozygous TG mutation (c.6701C>A, p.A2215D) in the ACHE-like domain, associated with deficient TG secretion due to TG retention within the endoplasmic reticulum (18, 19) was identified in patient #2. Unfortunately, no parental DNA was available. Patient #3 was compound heterozygous for two TG mutations including the previously described c.4588 C>T mutation (inherited from the father) that produces a premature stop codon (p.R1511X) with skipping of the exon 22 domain (34). Exon 22 skipping may result in protein structure alterations responsible for protein retention within the cell. This nonsense mutation occurs in a CpG dinucleotide sequence and may be caused by deamination of a methylated cytosine resulting in a thymine (21). The other TG mutation was a novel variant, c.2132_2133 insG, in exon 9, responsible for a frameshift in the Type-1 domain. This c.2132_2133 insG mutation explains therefore along with the p.R1511X, the clinical phenotype of the patient. Patient #5 also had two TG mutations. One (c.4588 C>T, p.R1511X) was a previously described mutation (34) for which no functional studies are available, inherited from the father, and responsible for a stop codon. The other, inherited from the mother, was a novel G insertion in exon 6 leading to a frameshift in the Type 1 TG domain and to a premature stop codon. The previously reported c.886 C>T mutation (p.R277X), also found in patient #1, was identified in patient #7 along with a novel missense mutation that replaces a cysteine with an arginine (c.5182 T>C, p.C1709R), located in the type 3 repeat domain of TG, and responsible for absence of a disulfide bond that may alter the conformation of TG. A novel TG monoallelic variant (c.7859G>A, p.G2601D) located in the ACHE-like domain was found in another patient (patient #6); its pathogenicity cannot be ascertained in silico.

DUOX2 and DUOXA2 Variants

TGNS identified one case (patient #4) with a probably causative biallelic DUOX2 mutation leading to partial deficiency in H2O2 production (22). Interestingly this patient had also two heterozygous TG variants located in the same type-3 protein domain, of which one—a 3-bp (GAT) deletion at amino acid position 1,767—has been reported previously (23) and the other is novel (c.5370A>G, p.I1771M); suggesting that accumulation of pathogenic variants may lead to CH.

In our study cohort, patients #2 and #3 besides TG mutations, carried a monoallelic DUOX2 variant not located in DUOX2 functional domains or hot-spot mutations. The DUOX2 variant of patient #2 has been previously described in patients with DH, without any functional study (20).

The accumulation of variants in different DH genes applies on other cases, as in patient #8 heterozygous for four novel variants in TG and DUOXA2. The two TG variants, c.2233_2234insT and c.3452delT, were in the type 1 repeat domain. One DUOXA2 variant, c.205+2 T>C, was in an essential splice site. In silico predictions predictive algorithms show an abolishment of natural splice donor site, suggesting a splicing effect of the variation. The other DUOXA2 mutation, c.463 C>G, p.L155V, was a missense variant in the larger extracellular domain. The patient had a GIS and a positive perchlorate discharge test. Although the two DUOXA2 mutations may explain the organification defect, a pathogenic effect of the two TG mutations cannot be ruled out, particularly as no TG assay was performed at diagnosis.

TPO Variants

We did not identify any biallelic mutations but only two novel monoallelic variants. Monoallelic TPO mutations have been reported to cause DH with showed monoallelic expression (35). The first TPO variant c.866 T>C, p.F289S, is in exon 8, encoding for the catalytic domain (patient #9). In silico prediction tools suggested a deleterious or disease-causing effect. Monoallelic expression of the TPO mutation in patient #9 cannot be ruled out, as no thyroid tissue study was performed. Familial segregation for patient #9 showed that mother carried this TPO variant despite a normal thyroid function. The second variant (patient #10) is an insertion (c.1768+1insGTCTGCCAG), after exon 10. This variation does not affect the main splice donor site, but because of the duplicated sequence it creates a putative new splice donor site, which is the same as the previous site. Its pathogenicity remains questionable, as ideally functional data would be helpful.

PAX8 Variants

PAX8 mutations have been chiefly described in patients with CH and thyroid dysgenesis, some of whom also have renal and urinary malformations (36). However, mutations in the PAX8 binding domain have been found in patients with CH and DH characterized by defective iodide organification and positive perchlorate discharge test or partial iodide transport defect, with normal-sized thyroid gland (37, 38). Three previously reported variants have been identified in three cases of cohort; two of them in the DNA binding domain. One case (patient #11), with GIS and a positive perchlorate discharge test, was heterozygous for a mutation located in the binding domain of PAX8 (c.101T>A, p.I34N). This mutation has been reported previously in a patient with CH and thyroid gland hypoplasia (24), who was also heterozygous for another PAX8 mutation (p.V35I), in the DNA binding domain. Although no functional data are available, given its location in the binding domain, the p.I34N mutation probably impairs transactivation of TG or TPO. Moreover, this variant was inherited from the mother, who also had CH and GIS. Patient #12 was heterozygous for a missense variant (c.397C>T, p.R133W) at the end of the PAX8 DNA binding domain. This previously described mutation had no deleterious effect on TG transactivation or with the synergism between PAX8 and NKX2-1 (25). Pathogenicity is unclear, for the third variant (patient #13) (c.658C>T, p.R220X) located after the PAX8 binding domain and responsible for a premature stop codon; described previously in a single patient who did not undergo functional studies and whose phenotype is unclear (26). In addition, the mutation was inherited from the mother, who has normal thyroid function, position, and size.

SLC5A5/NIS Variants

The two Tunisian patients (#14 and #15), born to consanguineous parents, were homozygous for the same SLC5A5 mutation, c.1183 G>A, p.G395R. In a previous study of this homozygous mutation, no perchlorate-sensitive iodide uptake was observed in COS-7 cells transfected with the mutant G395R NIS cDNA (27). Moreover, Dohan et al. have analyzed the effect of the p.G395R mutation allowing valuable insights into the structure-function and mechanistic properties of NIS (39). Amino acid substitutions at position 395 showed that the presence of an uncharged amino acid residue with a small side chain at position 395 is required for NIS function, suggesting that glycine 395 is located in a tightly packed region of NIS. For family of patient #14, the mother carries the variant; father’s DNA was not available. The brother diagnosed also with CH at 8 months of age is homozygous for the mutation. For patient #15, both parents are heterozygous as well as the healthy sibling.

Unsolved Cases With “No Causative” Variants

In four patients (#16–19), our filter prioritization strategy identified no mutations. Among these patients, three had goiter at diagnosis and two had familial CH, including one born to consanguineous parents.

Literature Review

We reviewed the literature by searching PubMed with the following terms: “hypothyroidism AND mutations”, “hypothyroidism AND mutations AND sequencing”, and “hypothyroidism AND dyshormonogenesis”. We excluded articles that did not provide NM accession numbers, detailed clinical data, and/or a detailed genetic analysis. Nearly 400 patients with hypothyroidism and GIS, with or without goiter, have been evaluated using either TNGS including a mean of 14 genes or whole exome sequencing (7, 8, 1013, 40, 41). Most patients underwent thyroid sonography to assess gland position and size. Selected variants were missense mutations and nonsense mutations in coding regions and splice sites. Variants in untranslated regions or noncoding RNA and synonymous variants were disregarded. The filters used were based on minor allele frequency [mainly MAF of 0.01 or 0.02, and 0.001 in only one study (41)] and in silico prediction tool results (usually SIFT and Polyphen-2 and less often Mutation Taster, Mutation Assessor, FATHMM, GERP score, CONDEL, and PROVEAN). Variants were classified based on frequency, in silico prediction tool results, pedigree segregation, and functional studies, as available. In one study, a score from A to C was used to stratify variants according to these criteria (8). The frequency of patients with mutations in known genes varied from 20 to 60% in cohorts including patients of various ethnicities (Korean, Chinese, Finnish, Italian, Saudi Arabian, Russian, and multiethnic). Table 5 recapitulates the main clinical and molecular NGS studies published so far.

Table 5

Park, Ann Lab Med 2016Lof, Thyroid, 2016Jiang, Eur J Med Genet, 2016Nicholas, J Clin Endocrinol Metab, 2016de Filippis, Hum Mol Genet, 2017Zou, JCEM, 2018Sun, EJE, 2018Makretskaya, PlosOne, 2018
Sequencing approachmultiplexPCRTNGSTNGSTNGS, WESTNGSWESTNGSTNGS and MLPA
genesTPO, TSHR, DUOX2, DUOXA2,
NIS, PAX8
TG, TPO, TSHR, DUOX2, IYD, NIS, PDS, DUOX1,
NKX2-5, PAX8, TRH, TRHR, TSHB
TG, TPO, TSHR, DUOX2, IYD, NIS, NKX2-5, PAX8, NKX2-1, FOXE1, SLC26A4, GNASTG, TPO, TSHR, DUOX2, DUOXA2, IYD, NIS, PDSTG, TPO, TSHR, DUOX2, DUOXA2, PDS, PAX8, NKX2-1, FOXE1, GLIS3, JAG1TG, TPO, TSHR, DUOX2, PDS, PAX8, NKX2-1, SLC26A7, TSHB, CDCA8, HOXB3 (mutated genes)TG, TPO, TSHR, DUOX2, DUOXA2, IYD, NIS, PDS, PAX8, NKX2-1, FOXE1, DIO1,TG, TPO, TSHR, DUOX2, DUOXA2, IYD, NIS, PDS, PAX8, NKX2-1, FOXE1, NKX2-5
causative genes for DH or DT61312811WESDIO2, DUOX1, DUOXA1, THRB, THRA, GNAS, SLC16A2, HHEX, NKX2-512
Patients
patients with GIS112 (CH newborn screening) + 58 CH
(outpatients, adult follow-up)=170
26 (15 sporadic goiter, athyreosis, hypoplasia; 11
families GIS, athyreosis, hypoplasia)
124994 (goiter, GIS)30 DH (goiter, GIS)110 CH (37 trios), 21 goiter, 51 GIS, 10 TD, 28 NA243 CH
patients with TD8325 TD (including 1 CeH)
clinical description DH/TDCH, thyroid scan and ultrasound for
outpatients without data
thyroid US if data available, TG levelsCH, newborn screening, ultrasonic scanningCH, newborn screening, thyroid imaging
(GIS or goiter)
CH, newborn screening, thyroid US and/or
scintigraphy
CH, newborn screening, thyroid US and/or
scintigraphy
CH, newborn screeningsevere CH (TSH at diagnosis >90mU/L)
ethnicityKoreanFinnishChineseMultiethnic originItalianSaudi ArabiaChineseRussian
Filters used variants analysis
frequency0.010.010.020.020.010.010.01
types of variantsmissense, nonsense mutations in
coding regions, without variants
UTR, non coding RNA, without
synonymous variants;
deleterious/damaging
coding regions or splicing exons, unknown and variant
<1%; variant classification with selection of variants
with high and moderate effect on gene function
no intronic and synonymous, "tolerated" or
"benign" variants were excluded; rare,
deleterious, putative deleterious variants
variants affecting protein coding
sequence/splicing, possibly damaging and
above
nonsense, frameshift, splice site, missense;
deleterious in 5 out of 7 algorithms of the
dbSNP database
VUS: mutations if <0.01, damaging or disease
causing in 3/4 prediction tools, strict segregation, biallelic: disease causing
functional variants (altering protein), without UTR or intergenic variants, synonymousBenign and "likely benign" variants were excluded
in silico predictionSIFT, PolyPhen-2,
Mutation Taster, Mutation Assesor, FATHMM, GERP
score >2, HGMD
CondelSIFT, PolyPhen-2, CONDELEnsembl VEP, SIFT, PolyPhen-2, GERPSIFT, Polyphen2, Mutation Taster, Mutation
Assessor, LRT, FATHMM, NetGen2v2.4 ESE Finder 2.0 for intron variants
Mutation Taster, PolyPhen-2, SIFT, PROVEANFunction using ANNOVAR (UCSC)ACMG guidelines
pedigree segregation studiesfor unknown mutationsin familial casesnowhen possiblein familiesyeswhen possibleno
functional testingnoprotein modeling and in vitro experimentsnowhen possible, protein modelingif publishednonono
Conclusions
% diagnosed patients according to authors criteria31% (53/170),
mono and biallelic variants
54.5% (6/11 familial cases), 20% (3/15 sporadic cases) with accurately analysis by variant91.7 % (11/12 patients), mono and biallelic variants59% solved cases, (29/49), 22% ambiguous cases (11/49), 18% unsolved cases (9/49) with accurate analysis by variant103/177 patients with a rare variant, 5 cases with monogenic recessive forms, 39 patients with oligogenic model60% (18/30) in DH (biallelic mutations), 37.5% (9/24) for TD, if HOXB3 causative: 40% (10/25) for TD51.8% (57/110 patients) with biallelic mutations, recessive manner of inheritance37.9% (92/243) with variants considered as pathogenic/likely pathogenic including VUS mono-and biallelic
final conclusions of articleDUOX2: frequent cause of CH in the
Korean population
TNGS: cost-effective, efficient, and multigenic screening, classification of variants (based on segregation, literature and in vitro experiments)high prevalence of DUOX2 mutations (83.3%) in central China, all patients were biallelic, tri-allelic or compound mutations in other genesbiallelic variants TPO/TG, PDS/TPO, DUOX2/TG, TG+TPO : more severe CH phenotype, triallelic variant are frequentOligogenic models of CH with causative genes, CH population is significantly enriched with rare/low frequency alleles in the 11 CH- related genesTG mutations: more frequent in DH with diagnostic yield of 66% in mutated DH patients (12/18) and 40% for all patients (12/30), TSHR more frequent in TD (60% of TD mutated patients 6/10 and 25% for 6/24 patients), SLC26A7 : new candidate gene for DH ?Diagnostic yield of 51,82% (for biallelic mutations), high frequency of DUOX2 mutations compared to Caucasian populationMajority of variants in DH genes responsible for severe CH

Literature review.

CeH, Central hypothyroidism.

VUS, variant of incertain signifiance.

ACMG, American College of Medical Genetics and Genomics.

Discussion

We used TNGS to perform comprehensive genetic screening of a well-characterized cohort of patients with CH due to DH, including patients with GIS and/or goiter at diagnosis and/or a positive perchlorate discharge test. The proportion of patients with identified disease-causing mutations was 53%. TG mutations predominated, as described previously (7, 13). We found 25% of DUOX2 and DUOXA2 variants as in others European countries (42). DUOX2 mutations were uncommon in our cohort, in contrast to studies in Asians showing a prevalence of 60% (12). This could be explained by the absence of patients of Asian ethnicity in our cohort and the detailed phenotypic and molecular description and assessment of variants. The pathogenicity of each variant was carefully evaluated based on clinical data including correlations with clinical phenotypes, previously published information, availability of functional studies, in silico prediction tool results, and location of variants in regions of interest of the protein. Interestingly we detected no causative DEHAL1/IYD or SLC26A4/PDS variants, suggesting that these may be rarely responsible for CH due to DH, depending usually on iodine uptake or associated with syndromic features as in the case of Pendred syndrome (4, 6). The proportion of patients with identified mutations differed between familial and sporadic cases (62 versus 54%, respectively).

The biallelic TG mutations identified in patient #2 have been reported previously and were consistent with the clinical presentation of goiter, low thyroglobulin levels, elevated iodide uptake, and normal perchlorate discharge test. Similarly, in patients #1 and #3, the goiter in utero or GIS with normal radionuclide uptake and nearly normal perchlorate discharge test are consistent with a TG mutation. Interestingly, the perchlorate discharge test result in patient #5 was elevated. Variable perchlorate discharge test values and partial iodide organification defects have been reported in patients with TG mutations (43, 44). When available, thyroglobulin values were in agreement with the molecular diagnosis, as observed in patients #2 and #7. This finding confirms that very low thyroglobulin levels are a good indication for TG mutation screening (45).

Biallelic DUOX2 mutations explaining the DH were detected in a single patient (#4), who had a goiter and a positive perchlorate discharge test. Monoallelic DUOX2 variants were identified combined with biallelic mutations in TG gene. The pathogenic role of these variants and their contribution, if any, to disease severity is difficult to determine. We identified two heterozygous TPO variants (patients #9 and #10) as the only disease-causing candidates. DH due to monoallelic TPO variants has been reported (35). Monoallelic expression in thyroid tissue and/or other, unidentified genetic factors may explain the phenotype. Indeed, the TPO variant of the patient #9 (c.866T>C, considered as deleterious through three in silico predictive algorithms) could be disease-causing if associated with another TPO variant or if there is monoallelic expression. However, given the uncertainty regarding the molecular diagnosis and the absence of functional data, the contribution to the CH phenotype of patients remains unclear.

We detected compound heterozygosity for two different novel DUOXA2 variants in a patient with DH and a partial iodide organification defect (patient #8). DUOXA2 mutations are a rare cause of DH, and only seven variants have been reported so far (5). Interestingly, we identified three different PAX8 variants in three patients (#11, #12, and #13), including two variants located in the DNA-binding domain. A single variant (p.I34N) was considered causative, based on location and familial segregation. However, p.R133W is also located in the binding domain, although a previously reported functional study found no evidence of a causative effect (25). The variant p.I34N in PAX8 of patient #11 was causative probably due to its involvement in transactivation of DUOX2 and TPO leading to defect of iodide organification. PAX8 mutations cause thyroid dysgenesis and some mutations were compatible with dyshormonogenesis as already described (37, 38).

Our literature review of studies of the molecular diagnosis of CH using NGS techniques including whole exome sequencing showed that differences in mutation frequencies across cohorts were chiefly ascribable to differences in ethnicity. Korean, Chinese, Finnish, Italian, Russian, or Saudi Arabian patients were studied. A single study included patients of different ethnicities (7). In two studies that distinguished between familial and sporadic cases, mutations were identified in about 54% of familial cases and 20–22% of sporadic cases (7, 8). No such difference was observed in our cohort. Furthermore, frequency differences across cohorts depend on the type of variant classification. Some studies determined the number of variants without differentiating variants with recessive versus dominant inheritance. Inheritance is usually recessive for variants responsible for CH with DH (11, 12, 40). The frequency of pathogenic variants was therefore overestimated. When identifying genetic causes of CH, the challenge consists in using appropriate criteria to select variants for TNGS screening. Interestingly, the diagnostic yield of TNGS in our study was 53%, in keeping with the results of previous studies that used a similar filter prioritization strategy (Table 5). Reports of digenic variants in several genes (TPO/TG, PDS/TPO, DUOX2/TG) suggest a pathogenic effect of variant accumulation, with the occurrence of DH. Oligogenic models involving CH-causing genes have been developed (10). We also found two or three mutated genes in several patients, although presence of a single recessive mutation was sufficient to cause DH, without the presence of the other monoallelic variants.

Combining scintigraphy and thyroid ultrasound in the individual patient improves diagnostic accuracy and guides molecular studies. In our cohort, positive TNGS findings correlated well with thyroid radionuclide uptake and perchlorate discharge test results. TNGS after newborn screening and CH confirmation may be a valid strategy for rapidly obtaining the accurate diagnosis of CH due to DH. TNGS, if available, may serve as a diagnostic alternative to thyroid scintigraphy, which is a time-consuming and invasive method. However, this approach should not delay treatment initiation and appropriate clinical care of patients.

In conclusion, in a well-characterized cohort of patients with DH, our TNGS approach provided the molecular diagnosis and shed light on genetic cause in 53% of cases. Several novel mutations were detected, half of which were causative for DH. Our analysis of the identified variants was based on both a detailed phenotypic description and an in-depth assessment of causality. TNGS is a rapid and cost-effective method for screening patients with CH. Patients whose TNGS results fail to provide the molecular diagnosis can then be assessed using other NGS approaches, i.e., whole exome sequencing or whole genome sequencing, with the goal of identifying new candidate genes.

Funding

AS was supported in part by an Onassis Foundation Grant and a European Society for Pediatric Endocrinology (ESPE) Research Fellowship grant. AC and MP received financial support from three corporations (EDF, Sandoz SAS, and Merck Serono France) and from the non-profit Princess Grace Foundation of Monaco. GS was supported by ESPE. Funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Statements

Data availability statement

The original contributions presented in the study are publicly available. This data can be found here: Clinical data: ClinVar accession numbers: VCV000888352, VCV000712030, VCV000631732, VCV000372358, VCV000361974, VCV000279800, VCV000265105, VCV000012706, VCV000012695, VCV000012691, VCV000007670.

Ethics statement

The studies involving human participants were reviewed and approved by French Biomedecine Agency. Written informed consent to participate in this study was provided by the participants’ legal guardian/next of kin.

Author contributions

AC and MP coordinated and instigated the study. AS, CT, GP, MM, SB, MD, RR, PB, MH, and NB provided clinical samples and data. AS and GAHC performed molecular studies. AC, AS, and GAHC analyzed the data. CB-F and SH coordinated NGS procedure. PN and CF gave bioinformatics support. AC, AS, and MP draft and finalized the manuscript with the help of GS and DK. All authors contributed to the article and approved the submitted version.

Acknowledgments

We thank the patients and families for their kind participation, and the IMAGINE Institute Biobank. We would like to thank Drs Brigitte Mignot, Robert Rapaport, Delphine Zenaty, Jean de Monleon, Christine Raybaud, Sylvie Soskin for clinical care of patients, for whom no causative variant was so far found.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Abbreviations

CH, congenital hypothyroidism; DH, dyshormonogenesis; GIS, gland in situ; MAF, minor allele frequency; NGS, Next generation Sequencing.

References

  • 1

    BarryYBonaldiCGouletVCoutantRLégerJPatyACet al. Increased incidence of congenital hypothyroidism in France from 1982 to 2012: a nationwide multicenter analysis. Ann Epidemiol (2016) 26:100–5. doi: 10.1016/j.annepidem.2015.11.005

  • 2

    DeladoëyJRuelJGiguèreYVan VlietG. Is the incidence of congenital hypothyroidism really increasing? A 20-year retrospective population-based study in Québec. J Clin Endocrinol Metab (2011) 96:2422–9. doi: 10.1210/jc.2011-1073

  • 3

    StoupaAKariyawasamDCarréAPolakM. Update of Thyroid Developmental Genes. Endocrinol Metab Clin North Am (2016) 45:243–54. doi: 10.1016/j.ecl.2016.01.007

  • 4

    TargovnikHMCitterioCERivoltaCM. Iodide handling disorders (NIS, TPO, TG, IYD). Best Pract Res Clin Endocrinol Metab (2017) 31:195212. doi: 10.1016/j.beem.2017.03.006

  • 5

    MuzzaMFugazzolaL. Disorders of H2O2 generation. Best Pract Res Clin Endocrinol Metab (2017) 31:225–40. doi: 10.1016/j.beem.2017.04.006

  • 6

    WémeauJLKoppP. Pendred syndrome. Best Pract Res Clin Endocrinol Metab (2017) 31:213–24. doi: 10.1016/j.beem.2017.04.011

  • 7

    NicholasAKSerraEGCangulHAlyaarubiSUllahISchoenmakersEet al. Comprehensive Screening of Eight Known Causative Genes in Congenital Hypothyroidism With Gland-in-Situ. J Clin Endocrinol Metab (2016) 101:4521–31. doi: 10.1210/jc.2016-1879

  • 8

    LöfCPatyraKKuulasmaaTVangipurapuJUndeutschHJaeschkeHet al. Detection of Novel Gene Variants Associated with Congenital Hypothyroidism in a Finnish Patient Cohort. Thyroid (2016) 26:1215–24. doi: 10.1089/thy.2016.0016

  • 9

    FanXFuCShenYLiCLuoSLiQet al. Next-generation sequencing analysis of twelve known causative genes in congenital hypothyroidism. Clin Chim Acta (2016) 468:7680. doi: 10.1016/j.cca.2017.02.009

  • 10

    de FilippisTGelminiGParaboschiEVigoneMCDi FrennaMMarelliFet al. A frequent oligogenic involvement in congenital hypothyroidism. Hum Mol Genet (2017) 26:2507–14. doi: 10.1093/hmg/ddx145

  • 11

    ParkKJParkHKKimYJLeeKRParkJHParkJHet al. DUOX2 Mutations Are Frequently Associated With Congenital Hypothyroidism in the Korean Population. Ann Lab Med (2016) 36:145–53. doi: 10.3343/alm.2016.36.2.145

  • 12

    SunFZhangJXYangCYGaoGQZhuWBHanBet al. The genetic characteristics of congenital hypothyroidism in China by comprehensive screening of 21 candidate genes. Eur J Endocrinol (2018) 178:623–33. doi: 10.1530/EJE-17-1017

  • 13

    ZouMAlzahraniASAl-OdaibAAlqahtaniMABabikerOAl-RijjalRAet al. Molecular Analysis of Congenital Hypothyroidism in Saudi Arabia: SLC26A7 Mutation Is a Novel Defect in Thyroid Dyshormonogenesis. J Clin Endocrinol Metab (2018) 103:1889–98. doi: 10.1210/jc.2017-02202

  • 14

    StoupaAAdamFKariyawasamDStrasselCGawadeSSzinnaiGet al. TUBB1 mutations cause thyroid dysgenesis associated with abnormal platelet physiology. EMBO Mol Med (2018) 10:e9569. doi: 10.15252/emmm.201809569

  • 15

    LegerJOlivieriADonaldsonMTorresaniTKrudeHvan VlietGet al. European Society for Paediatric Endocrinology consensus guidelines on screening, diagnosis, and management of congenital hypothyroidism. J Clin Endocrinol Metab (2014) 99:363–84. doi: 10.1210/jc.2013-1891

  • 16

    AlzahraniASBaiteiEYZouMShiY. Clinical case seminar: metastatic follicular thyroid carcinoma arising from congenital goiter as a result of a novel splice donor site mutation in the thyroglobulin gene. J Clin Endocrinol Metab (2006) 91:740–6. doi: 10.1210/jc.2005-2302

  • 17

    van de GraafSARis-StalpersCVeenboerGJCammengaMSantosCTargovnikHMet al. A premature stopcodon in thyroglobulin messenger RNA results in familial goiter and moderate hypothyroidism. J Clin Endocrinol Metab (1999) 84:2537–42. doi: 10.1210/jcem.84.7.5862

  • 18

    CaputoMRivoltaCMEsperanteSAGruñeiro-PapendieckLChiesaAPellizasCGet al. Congenital hypothyroidism with goitre caused by new mutations in the thyroglobulin gene. Clin Endocrinol (Oxf) (2007) 67:351–7. doi: 10.1111/j.1365-2265.2007.02889.x

  • 19

    PardoVVono-TonioloJRubioIGKnobelMPossatoRFTargovnikHMet al. The p.A2215D thyroglobulin gene mutation leads to deficient synthesis and secretion of the mutated protein and congenital hypothyroidism with wide phenotype variation. J Clin Endocrinol Metab (2009) 94:2938–44. doi: 10.1210/jc.2009-0150

  • 20

    PfarrNKorschEKaspersSHerbstAStachAZimmerCet al. Congenital hypothyroidism caused by new mutations in the thyroid oxidase 2 (THOX2) gene. Clin Endocrinol (Oxf) (2006) 65:810–5. doi: 10.1111/j.1365-2265.2006.02672.x

  • 21

    TargovnikHMEsperanteSARivoltaCM. Genetics and phenomics of hypothyroidism and goiter due to thyroglobulin mutations. Mol Cell Endocrinol (2010) 322:4455. doi: 10.1016/j.mce.2010.01.009

  • 22

    TonaccheraMDe MarcoGAgrettiPMontanelliLDi CosmoCFreitas FerreiraACet al. Identification and functional studies of two new dual-oxidase 2 (DUOX2) mutations in a child with congenital hypothyroidism and a eutopic normal-size thyroid gland. J Clin Endocrinol Metab (2009) 94:4309–14. doi: 10.1210/jc.2009-0426

  • 23

    BrustESBeltraoCBWatanabeT. New heterozygous mutations in thyroglobulin gene in patients with congenital hypothyroidism. Endoc Rev (2011). The endocrine society’s 93rd annual meeting.

  • 24

    LanzerathKBettendorfMHaagCKneppoCSchulzeEGrulich-HennJ. Screening for Pax8 mutations in patients with congenital hypothyroidism in South-West Germany. Horm Res (2006) 66:96100. doi: 10.1159/000093799

  • 25

    VincenziMCamilotMFerrariniETeofoliFVenturiGGaudinoRet al. Identification of a novel pax8 gene sequence variant in four members of the same family: from congenital hypothyroidism with thyroid hypoplasia to mild subclinical hypothyroidism. BMC Endocr Disord (2014) 14. doi: 10.1186/1472-6823-14-69

  • 26

    FuCChenRZhangSLuoSWangJChenYet al. PAX8 pathogenic variants in Chinese patients with congenital hypothyroidism. Clin Chim Acta (2015) 450:322–6. doi: 10.1016/j.cca.2015.09.008

  • 27

    KosugiSBhayanaSDeanHJ. A novel mutation in the sodium/iodide symporter gene in the largest family with iodide transport defect. J Clin Endocrinol Metab (1999) 84:3248–53. doi: 10.1210/jcem.84.9.5971

  • 28

    Di JesoBArvanP. Thyroglobulin From Molecular and Cellular Biology to Clinical Endocrinology. Endocr Rev (2016) 37:236. doi: 10.1210/er.2015-1090

  • 29

    KosugiSOkamotoHTamadaASanchez-francoF. A Novel Peculiar Mutation in the Sodium/Iodide Symporter Gene in Spanish Siblings with Iodide Transport Defect. J Clin Endocrinol Metab (2002) 87:3830–6. doi: 10.1210/jcem.87.8.8767

  • 30

    MorenoJBikkerHKempersMvan TrotsenburgPBaasFde VijlderJet al. Inactivating mutations in the gene for thyroid oxidase 2 (thox2) and congenital hypothyroidism. N Engl J Med (2002) 347:95102. doi: 10.1056/NEJMoa012752

  • 31

    GrasbergerHRefetoffS. Identification of the maturation factor for dual oxidase. J Biol Chem (2006) 281:18269–72. doi: 10.1074/jbc.C600095200

  • 32

    DeladoëyJPfarrNVuissozJMParmaJVassartGBiesterfeldSet al. Pseudodominant Inheritance of Goitrous Congenital Hypothyroidism Caused by TPO Mutations: Molecular and in Silico Studies. J Clin Endocrinol Metab (2008) 93:627–33. doi: 10.1210/jc.2007-2276

  • 33

    PoleevAOkladnovaOMustiAMSchneiderSRoyer-PokoraBPlachovD. Determination of functional domains of the human transcription factor PAX8 responsible for its nuclear localization and transactivating potential. Eur J Biochem (1997) 247:860–9. doi: 10.1111/j.1432-1033.1997.00860.x

  • 34

    TargovnikHMMedeiros-NetoGVarelaVCochauxPWajchenbergBLVassartG. A nonsense mutation causes human hereditary congenital goiter with preferential production of a 171-nucleotide-deleted thyroglobulin ribonucleic acid messenger. J Clin Endocrinol Metab (1993) 77:210–5. doi: 10.1210/jcem.77.1.8325944

  • 35

    FugazzolaLCeruttiNMannavolaDVannucchiGFalliniCPersaniLet al. Monoallelic expression of mutant thyroid peroxidase allele causing total iodide organification defect. J Clin Endocrinol Metab (2003) 88:3264–71. doi: 10.1210/jc.2002-021377

  • 36

    RamosHECarréAChevrierLSzinnaiGTronECerqueiraTLet al. Extreme phenotypic variability of thyroid dysgenesis in six new cases of congenital hypothyroidism due to PAX8 gene loss-of-function mutations. Eur J Endocrinol (2014) 171:499507. doi: 10.1530/EJE-13-1006

  • 37

    JoWIshizuKFujiedaKTajimaT. Congenital Hypothyroidism Caused by a PAX8 Gene Mutation Manifested as Sodium/Iodide Symporter Gene Defect. J Thyroid Res (2010) 2010:619013. doi: 10.4061/2010/619013

  • 38

    MeeusLGilbertBRydlewskiCParmaJRoussieALAbramowiczMet al. Characterization of a novel loss of function mutation of PAX8 in a familial case of congenital hypothyroidism with in-place, normal-sized thyroid. J Clin Endocrinol Metab (2004) 89:4285–91. doi: 10.1210/jc.2004-0166

  • 39

    DohánOGavrielidesMVGinterCAmzelLMCarrascoN. Na(+)/I(-) symporter activity requires a small and uncharged amino acid residue at position 395. Mol Endocrinol (2002) 16:1893–902. doi: 10.1210/me.2002-0071

  • 40

    JiangHWuJKeSHuYFeiAZhenYet al. High prevalence of DUOX2 gene mutations among children with congenital hypothyroidism in central China. Eur J Med Genet (2016) 59:526–31. doi: 10.1016/j.ejmg.2016.07.004

  • 41

    MakretskayaNBezlepkinaOKolodkinaAKiyaevAVasilyevEVPetrovVet al. High frequency of mutations in “dyshormonogenesis genes” in severe congenital hypothyroidism. PloS One (2018) 13:e0204323. doi: 10.1371/journal.pone.0204323

  • 42

    PetersCNicholasAKSchoenmakersELyonsGLanghamSSerraEGet al. DUOX2/DUOXA2 Mutations Frequently Cause Congenital Hypothyroidism that Evades Detection on Newborn Screening in the United Kingdom. Thyroid (2019) 29:790801. doi: 10.1089/thy.2018.0587

  • 43

    NiepomniszczeHMedeiros-NetoGARefetoffSDegrootLJFangVS. Familial goitre with partial iodine organification defect, lack of thyroglobulin, and high levels of thyroid peroxidase. Clin Endocrinol (Oxf) (1977) 6:2739. doi: 10.1111/j.1365-2265.1977.tb01993.x

  • 44

    NiuDMHsuJHChongKWHuangCHLuYHKaoCHet al. Six new mutations of the thyroglobulin gene discovered in taiwanese children presenting with thyroid dyshormonogenesis. J Clin Endocrinol Metab (2009) 94:5045–52. doi: 10.1210/jc.2009-0646

  • 45

    TargovnikHMCitterioCERivoltaCM. Thyroglobulin gene mutations in congenital hypothyroidism. Horm Res Paediatr (2011) 75:311–21. doi: 10.1159/000324882

Summary

Keywords

congenital hypothyroidism, dyshormonogenesis, mutations, targeted next-generation sequencing, gland in situ

Citation

Stoupa A, Al Hage Chehade G, Chaabane R, Kariyawasam D, Szinnai G, Hanein S, Bole-Feysot C, Fourrage C, Nitschke P, Thalassinos C, Pinto G, Mnif M, Baron S, De Kerdanet M, Reynaud R, Barat P, Hachicha M, Belguith N, Polak M and Carré A (2021) High Diagnostic Yield of Targeted Next-Generation Sequencing in a Cohort of Patients With Congenital Hypothyroidism Due to Dyshormonogenesis. Front. Endocrinol. 11:545339. doi: 10.3389/fendo.2020.545339

Received

15 April 2020

Accepted

15 December 2020

Published

22 February 2021

Volume

11 - 2020

Edited by

Noriyuki Koibuchi, Gunma University, Japan

Reviewed by

Izuki Amano, Gunma University, Japan; Hiroaki Shimizu, Dokkyo Medical University, Japan

Updates

Copyright

*Correspondence: Michel Polak, ; Aurore Carré,

†These authors share last authorship

This article was submitted to Thyroid Endocrinology, a section of the journal Frontiers in Endocrinology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics