Abstract
Objective:
To explore the differential gene expression in peripheral blood immune cells of individuals with type 2 diabetes mellitus (DM), comparing those with and without non-proliferative diabetic retinopathy (NPDR).
Methods:
From a pool of 126 potential participants, 60 were selected for detailed analysis. This group included 12 healthy donors (HDs), 22 individuals with DM, and 26 with NPDR. We analyzed peripheral blood mononuclear cells (PBMCs) using RNA sequencing and quantitative PCR (qPCR) to pinpoint differentially expressed genes (DEGs). Western blot and flow cytometry were also employed to evaluate the protein expression of specific genes.
Results:
In patients with NPDR compared to those with DM alone, MerTK—a gene implicated in inherited retinal dystrophies due to its mutations—was notably downregulated in PBMCs. Through flow cytometry, we assessed the protein levels and cellular distribution of MerTK, finding a predominant expression in monocytes and myeloid-derived suppressor cells (MDSCs), with a marked reduction in CD4+ and CD8+ T cells, as well as in natural killer T (NKT) cells. Patients with DM demonstrated a significant deviation in the PBMCs composition, particularly in B cells, CD4+ T cells, and NK cells, when compared to HDs.
Conclusions:
The study indicates that MerTK expression in T cells within PBMCs could act as a viable blood biomarker for NPDR risk in patients with DM. Furthermore, the regulation of T cells by MerTK might represent a critical pathway through which DM evolves into NPDR.
Introduction
Diabetic retinopathy (DR), a major ocular complication of diabetes mellitus (DM), is a primary cause of vision loss, especially in individuals over 50 years old (). Clinically, DR is classified into non-proliferative diabetic retinopathy (NPDR) and advanced proliferative diabetic retinopathy (PDR) (). NPDR involves vascular basement membrane thickening and microaneurysm formation, progressing to PDR with severe risks due to neovascularization (). Current DR treatments mainly address symptoms and show varied patient outcomes. Early retinal function and cellular changes preceding visible microangiopathy in DR suggest the necessity for early intervention ().
Research has shown that individuals with DM and DR experience changes in the composition of immune cells in their bloodstream (, ). Bo Li et al. have unveiled a significant association between 35 distinct immune cell phenotypes and the risk of developing DR (). This alteration in peripheral immune cells is believed to play a crucial role in chronic inflammation, setting the stage for the development and progression of DR (, ). This process is not only pivotal in the early stages of NPDR but also in the progression to more severe forms of the condition, such as PDR. PDR is marked by severe complications, including neovascularization, vitreous hemorrhage, and tractional retinal detachment (). Peripheral inflammation is thought to exacerbate retinopathy by altering the intraocular environment and disrupting the vascular protective mechanisms in the retina, as indicated by Yokomizo et al (). Thus, targeting the activity of circulating immune cells presents a potential strategy for the early diagnosis and prevention of DR.
Circulating immune cells have systemic effects on inflammation and can penetrate tissues by crossing the parenchyma-blood barriers, occurring during both health and disease states (). The movement of specific immune cell subsets into and out of tissues is vital for health and disease progression. Particularly in the retina, the interactions between these immune cells and retinal cells can either worsen or alleviate disease-related changes (–), highlighting the critical role of peripheral immune regulation in retinopathy’s development and progression. Understanding the mechanisms by which these cells affect retinal diseases is crucial for creating targeted treatments. Such therapies could adjust immune responses to prevent or manage retinopathy effectively, opening new pathways for intervention.
This study seeks to elucidate the pivotal molecular alterations in circulating immune cells that drive the advancement of DM to NPDR. We analyzed peripheral blood mononuclear cells (PBMCs) from patients with and without NPDR to achieve this. Through RNA sequencing (RNA-seq), we discovered a significant reduction in the expression of the Mer tyrosine kinase (MerTK) gene in patients with NPDR, particularly noting its marked decrease in circulating T cells. MerTK, a member of the Tyro/Axl/Mer receptor family, is predominantly expressed on various immune cells such as monocytes/macrophages, dendritic cells, and microglia (). It plays a vital role in phagocytosis and clearing apoptotic cells, thereby preventing prolonged inflammation. This phagocytic function is critical in maintaining tissue functionality and internal environment stability (). MerTK has been extensively researched in the context of retinal pigment epithelium and macrophages, where its mutations are linked to severe retinitis pigmentosa and the dysregulation of macrophage functions in phagocytosis and inflammation (). Therefore, our findings suggest a critical role for MerTK in circulating T cells, potentially influencing the development of DR.
Methods
Study subjects
We enrolled 126 donors from the First People’s Hospital of Guangzhou between 2022 and 2023, and 12 HDs, 22 patients with DM (type 2 diabetes mellitus), and 26 patients with NPDR (type 2 diabetes mellitus with non-proliferative diabetic retinopathy) were selected for analysis (Figure 1). Diagnostic criteria adhered to the Clinical Diagnosis and Treatment Criteria for Diabetic Retinopathy in China. Briefly, all participants were subjected to stereoscopic fundus photography for the detection of NPDR utilizing a Non-Mydriatic Fundus Camera through undilated pupils. For every participant, two fundus images centered on the fovea and optic disc for each eye were taken in a darkened room. Two experienced ophthalmologists from the First People’s Hospital of Guangzhou, working independently and in a blinded fashion, assessed each photograph for DR assessment. In cases of discordant evaluations, a third ophthalmologist would make the ultimate decision. The severity of DR in each eye was established, and the subject’s overall classification was determined by the severity observed in the more affected eye.
Figure 1
Inclusion criteria included confirmed DM diagnosis and accurate clinical diagnosis of NPDR grading; diagnosed with type 2 DM; the duration of diabetes ranged from 1 to 20 years; and the participants’ ages ranged from 40 to 90 years. Exclusion criteria encompassed if they were younger than 18 years old or had type 1 diabetes mellitus; other diabetic microangiopathies like nephropathy or neuropathy; autoimmune, neurological, or malignant diseases; major cardiovascular and cerebrovascular events; other systemic infections or inflammatory diseases; recent usage of hormones, immunosuppressants, or anti-inflammatory drugs; and laser photocoagulation, steroid or anti-vascular endothelial growth factor treatment in the past week.
We collected participants’ age, gender, duration of diabetes, and blood pressures. Venous blood samples were drawn after an overnight fast. All biochemical analyses were performed in our hospital, including glycosylated hemoglobin A1c (HbA1c), total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol (LDL), and estimated glomerular filtration rate (eGFR). This study complied with the Declaration of Helsinki for research involving human subjects and was approved by the research ethics committee of the institute (K-2022-157-01). Informed consent was obtained from all participants per ethical standards. Flow chart of participants enrollment is in Figure 1. Detail of participants are in Supplementary Tables 1–4.
PBMCs preparation
Peripheral blood (5mL) was collected in EDTA-containing tubes (Sanli, Liuyang, China) and processed within 2 hours. Lymphocyte Separation Medium (LSM, biosharp, Beijing, China) was added to the blood before centrifugation (). The PBMCs layer was transferred to a new tube, washed with PBS (labgic, Beijing, China), and treated with red blood cell lysis buffer (solarbio, Beijing, China) at room temperature for 5 minutes. After a final PBS wash, the PBMCs were obtained ().
Flow cytometry and UMAP analysis
PBMCs were incubated with a mixture of antibodies for 25 minutes at 4°C in the dark. After PBS washing, cells were suspended in 300 uL PBS and analyzed using a BD flow cytometer. FlowJo 10.8.1 software was used for data analysis. Those antibodies used are in Supplementary Table 5.
UMAP analysis was conducted using the “UMAP plugin” in FlowJo 10.8.1. High-quality cells were selected with “FlowAI” for gating and doublet discrimination, followed by random selection of 10000 cells per sample using the “Downsample plugin”. Samples were merged into a new FCS file and visualized with UMAP in FlowJo. UMAP outputs were used for “FlowSOM plugin” clustering with nine predefined clusters. “ClusterExplorer plugin” was then used to present the FlowSOM results. Data from the “ClusterExplorer plugin” were normalized in R software for final visualization and cellular annotation accordingly.
Gating strategies
Flow cytometry-acquired cells were gated and classified into various immune cells. Myeloid cells were identified as monocytes (CD14+) and their subpopulations, and lymphoid lineage cells included B cells (CD19+), T cells (CD3+ and its subpopulations), NK cells (CD56+), and NKT cells (CD3+CD56+). The details are in Figure 2C.
Figure 2
Quantitative RT-PCR
RNA was extracted from PBMCs using TRIzol (Invitrogen, Waltham, MA, USA) and quantified spectrophotometrically. cDNA was synthesized from 1μg of RNA using a kit (agbio, Hunan, China). qPCR was performed using SYBR-Green PCR Master Mix (agbio, Hunan, China) on a QuantStudioTM 5 system (Thermo Fisher Scientific, Waltham, MA, USA). MerTK gene expression was normalized to GAPDH and analyzed using the 2-ΔΔCt method (Table 1).
Table 1
| MerTK | Forward primer GTACCAGCCTGCCTTGATGT Reverse primer GTGTTTGAAGGCAAGAGGCG |
| GAPDH | Forward primer AAAGCCTGCCGGTGACTAAC Reverse primer TAGGAAAAGCATCACCCGGAG |
Sequences of MerTK and GAPDH.
Western blot analysis
PBMCs were lysed on ice for 30 minutes using Western & IP lysis buffer (Beyotime, Jiangsu, China) containing phenylmethanesulfonyl fluoride (Beyotime, Jiangsu, China). Protein extracts (40 μg) were separated on a 10% SDS-PAGE gel and transferred onto polyvinylidene fluoride membranes (Millipore, Massachusetts, USA). Membranes were blocked with 5% non-fat milk at room temperature for 2 hours, then incubated overnight at 4°C with the following primary antibodies: rabbit anti-MerTK (1:1000, Proteintech, Wuhan, China) and mouse anti-β-actin (1:4000, Bioworld, Dublin, USA). After washing, membranes were incubated for 1 hour at room temperature with HRP-conjugated secondary antibodies: goat anti-rabbit IgG (H+L) (1:2000, Proteintech, Wuhan, China) and goat anti-mouse IgG (1:2000, Proteintech, Wuhan, China). Bands were visualized using the SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Fisher Scientific, Waltham, MA, USA) and quantified using ImageJ software, with protein levels normalized to β-actin.
RNA-seq and analysis
RNA integrity was checked on a 1% agarose gel and quantified with NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). Samples with RIN > 7 were sequenced on Illumina HiSeq/Novaseq/MGI2000 instruments (2 x 150 PE). Data were quality-checked, filtered, and aligned to the reference genome.
This study utilized R 4.3.0 for bioinformatics analysis. The expression matrix was derived from raw sequencing data and analyzed using the “deseq2” package in R. The negative binomial regression model was fitted, and hypothesis testing was performed using the Wald test or likelihood ratio test to identify DEGs. Upregulated genes were selected based on the criteria of |log2FC| ≥ 1 and adjusted P < 0.05, while downregulated genes were selected based on |log2FC| ≤ -1 and adjusted P < 0.05. Volcano plot was generated using the “ggplot2” package, and heatmap was created with the “pheatmap” package. For Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, we used the “ClusterProfiler” package in R software ().
The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Genomics, Proteomics & Bioinformatics 2021) in National Genomics Data Center (Nucleic Acids Res 2021), China National Center for Bioinformation/Beijing Institute of Genomics, Chinese Academy of Sciences (GSA: HRA007945) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa.
Statistical analyses
Data analysis was conducted using GraphPad Prism 8.0. T-tests and one-way ANOVA were employed for comparisons, with the Mann-Whitney test or Kruskal-Wallis test used when assumptions of normal distribution or homoscedasticity were not met. Mean ± SEM was reported, with P < 0.05 considered significant.
Results
Downregulation of MerTK in circulating immune cells of patients with NPDR
Following our inclusion and exclusion criteria, we selected the PBMCs of four patients with DM and five patients with NPDR for RNA-seq analysis (Figure 1). This analysis revealed seven differentially expressed genes (Figures 3A, B), highlighting alterations in biological processes like neutrophil homeostasis and apoptotic cell clearance (Figure 3C). Notably, we observed a significant downregulation of MerTK in the NPDR group compared to the DM group (adjusted P = 0.02, |log2FC| = -1.232, Figures 3A, D). This reduction in MerTK expression at both transcriptional and translational levels was confirmed using qPCR, western blot and flow cytometry (Figures 2A–E), indicating a consistent decline of MerTK in PBMCs of patients with NPDR. However, no significant difference in MerTK expression was observed between the HD and DM groups (Supplementary Figure 1).
Figure 3
Specific decline of MerTK expression in T cells of patients with NPDR
Our analysis extended to various immune cell types to investigate MerTK expression differences. Using UMAP analysis, we identified nine distinct immune cell clusters (Figures 4A, B). MerTK expression was primarily noted in monocytes and MDSCs, with lesser amounts in NK and NKT cells, and minimal in T cells, including CD4+ and CD8+T cells, and the lowest in B cells (Figures 4C, D). In the NPDR group, significant reductions in MerTK expression were observed specifically in CD4+, CD8+, and NK T cells (P < 0.01, P < 0.05, P < 0.05, respectively) (Figures 4E, F). Conversely, monocytes, B cells, NK cells, and MDSCs did not show significant expression changes between DM and NPDR groups (Figure 4G).
Figure 4
Immune cell population changes in DM and NPDR
Our study analyzed peripheral blood from 9 HDs, 15 patients with DM (without NPDR), and 18 patients with NPDR. We found significant alterations in the immune cell populations between the DM or NPDR groups and HDs, with no notable differences between DM and NPDR groups. Specifically, B cells increased significantly in both DM and NPDR groups compared to HDs, while NK cells showed a significant increase only in the DM group (Figure 5A). T cells, monocytes, low-density eosinophils, low-density neutrophils, NKT cells, and MDSCs did not significantly differ among the three groups (Figures 5B, C). Further analysis of T cell and monocyte subtypes revealed an increase only in CD4+T cells in the DM and NPDR groups, with no significant changes in CD8+T cells or in classical, non-classical, and intermediate monocytes (Figures 5D, E). These findings suggest that hyperglycemia-induced dysregulation of circulating immune cells may contribute to the onset of NPDR.
Figure 5
Discussion
MerTK is known for its role in retinal pigment epithelium (RPE), mediating rapid phagocytosis and clearance of photoreceptor debris, with its dysfunction leading to retinal dystrophy and retinitis pigmentosa (–). Contrary to its well-documented presence in RPE cells, our study found MerTK to be significantly downregulated in the circulating T cells of patients with NPDR compared to those with DM, particularly in CD4+ and CD8+T cells, as well as NKT cells. Given that T cells are implicated in retinal infiltration during DR, our findings suggest a potential role for MerTK in modulating T cell functions, contributing to the progression from DM to NPDR.
MerTK is a crucial cell surface receptor involved in the innate immune system, involved in the function of a variety of immune cells. One of the most well-known functions of MerTK in macrophages is mediating the clearance of apoptotic cells in vitro and vivo (). Cai et al. found that the signal from MerTK in macrophages can activate the ERK-dependent pathway and inhibit the phosphorylation of 5-lipoxygenase, thus promoting the production of specialized proresolving mediators and promoting the regression of inflammation (). Meanwhile, TAM family kinases can suppress antitumor immunity and promote resistance to immune-checkpoint inhibitors (). In dendritic cells, MerTK regulates antigen presentation and immune activation, influencing initial activation and immune tolerance of CD8+T cells (). The research between MerTK with T cells is also very crucial. Previous research has indicated that MerTK negatively regulates T cell activation () and serves as a co-stimulatory receptor on CD8+T cells (). Studies in pediatric T-cell acute lymphoblastic leukemia showed increased MerTK expression (), while inhibition of MerTK curtailed T-cell precursor expansion and induced apoptosis (, ). These insights bolster our hypothesis that MerTK downregulation could enhance T cell activation and proliferation, intensifying T-cell-mediated immune responses and potentially hastening the transition from DM to DR.
The relationship between DR and DM underscores a complex interplay of factors, including the vitreous environment () and systemic inflammation (, ) from prolonged hyperglycemia. Our results raise the question of whether changes in circulating T cells mirror alterations within the vitreous environment. The infiltration of these cells through the blood-retina barrier suggests their substantial influence on the vitreous immune response, either protective or harmful (). Furthermore, the common signaling pathways in blood and retinal T cells hint at a shared mechanism in their regulation.
While the influence of immune cell-mediated inflammation on pathogenesis of DR is widely recognized, there is a lack of detailed quantitative analyses comparing immune cell profiles among patients with DM, those with NPDR, and HD (). Our study’s comparison of immune cell profiles among HD, DM, and NPDR groups revealed significant changes, particularly in immune cells like B cells, NK cells and T cell subtypes, suggesting their involvement in pathogenesis of DR. Interestingly, we observed increased NK and B cell activities in patients with DM, which might play a role in the early stages of DR (37, 38). The adaptive immune response, represented by CD4+T cell, also showed significant increase, while CD8+ cell showed a decrease, aligning with literature indicating their varied involvement in progression of DR (). Follicular helper T cells, a subpopulation of CD4+T cells, have also been found to be elevated in patients with DR and diabetic mice, and inhibition of this population attenuates vascular inflammation and neovascularization (39). Some studies have indicated that CD8+T cells can penetrate into retina and concentration significantly higher in vitreous and macular edema in patients with DR, which is associated with poor visual prognosis (40, 41). These can further underline the significance of these cells in DR.
Despite these findings, our study has limitations. We could not fully assess the impact of diabetes medication on PBMCs, with drugs like metformin known to modulate immune responses (42, 43). Additionally, our patient cohort’s demographic skew towards postmenopausal women may influence the observed immune changes. Furthermore, it has been reported that the expression of MerTK in the lymphopoietic system is 59.3% higher in men than in women (44). In our study, although there was no statistical difference in patient gender between the DM and NPDR groups, there were more men in the NPDR group. Therefore, it is necessary to investigate the changes in MerTK expression across different genders. Besides, future research should delve into MerTK’s functional role in T cells and its impact on development of NPDR.
In conclusion, our study elucidates the nuanced differences in immune cell behavior between HD, DM, and NPDR groups, highlighting T cell dysregulation and MerTK downregulation as potential factors in pathogenesis of DR. These findings pave the way for further investigation into the role of immune cells in early development of DR.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Ethics statement
The studies involving humans were approved by Ethics Committee of Guangzhou First People’s Hospital. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent for participation was not required from the participants or the participants’ legal guardians/next of kin because we explained verbally to participants and obtained their informed consent.
Author contributions
SB: Data curation, Formal analysis, Investigation, Visualization, Writing – original draft. JL: Investigation, Methodology, Software, Visualization, Writing – original draft. XW: Investigation, Methodology, Software, Visualization, Writing – original draft. LZ: Methodology, Software, Visualization, Writing – original draft. ZZ: Investigation, Visualization, Writing – original draft, Methodology, Software. XS: Writing – original draft, Data curation. LH: Supervision, Validation, Writing – review & editing. YY: Supervision, Validation, Writing – review & editing. ZX: Supervision, Validation, Writing – review & editing. YUL: Validation, Writing – review & editing, Funding acquisition, Project administration. YL: Funding acquisition, Project administration, Resources, Writing – review & editing. YZ: Funding acquisition, Project administration, Resources, Writing – review & editing.
Funding
The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by National Natural Science Foundation of China (Grant No. 8217060280 to YL and No. 82071188 to YUL), Natural Science Foundation of Guangdong Province (Grant No. 2023A1515010376 to YZ), and Natural Science Foundation of Guangzhou Municipality, China (Grant No. 2023A03J0479 to YZ).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declare that no Generative AI was used in the creation of this manuscript.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fendo.2024.1509445/full#supplementary-material
References
1
BresslerSBScanlonPHPearceE. Why is continued vision loss still a problem in some patients with diabetic retinopathy, despite treatment? JAMA Ophthalmol. (2022) 140:308–9. doi: 10.1001/jamaophthalmol.2022.0135
2
CheungNMitchellPWongTY. Diabetic retinopathy. Lancet. (2010) 376:124–36. doi: 10.1016/S0140-6736(09)62124-3
3
WongTYCheungCMGLarsenMSharmaSSimóR. Diabetic retinopathy. Nat Rev Dis Primers. (2016) 2:16012. doi: 10.1038/nrdp.2016.12
4
HonasogeANudlemanESmithMRajagopalR. Emerging insights and interventions for diabetic retinopathy. Curr Diabetes Rep. (2019) 19:100. doi: 10.1007/s11892-019-1218-2
5
LiaoDFanWLiNLiRWangXLiuJet al. A single cell atlas of circulating immune cells involved in diabetic retinopathy. iScience. (2024) 27:109003. doi: 10.1016/j.isci.2024.109003
6
BerbudiARahmadikaNTjahjadiAIRuslamiR. Type 2 diabetes and its impact on the immune system. CDR. (2020) 16:442–9. doi: 10.2174/1573399815666191024085838
7
LiBZhaoXHongZDingYZhangY. Circulating immune cell phenotyping is potentially relevant for diabetic retinopathy risk assessment. Diabetes Res Clin Pract. (2024) 211. doi: 10.1016/j.diabres.2024.111667
8
BinetFCagnoneGCrespo-GarciaSHataMNeaultMDejdaAet al. Neutrophil extracellular traps target senescent vasculature for tissue remodeling in retinopathy. Science. (2020) 369:eaay5356. doi: 10.1126/science.aay5356
9
ForresterJVKuffovaLDelibegovicM. The role of inflammation in diabetic retinopathy. Front Immunol. (2020) 11:583687. doi: 10.3389/fimmu.2020.583687
10
KovoorEChauhanSKHajrasoulihaA. Role of inflammatory cells in pathophysiology and management of diabetic retinopathy. Survey Ophthalmol. (2022) 67:1563–73. doi: 10.1016/j.survophthal.2022.07.008
11
YokomizoHMaedaYParkKClermontACHernandezSLFickweilerWet al. Retinol binding protein 3 is increased in the retina of patients with diabetes resistant to diabetic retinopathy. Sci Trans Med. (2019) 11:eaau6627. doi: 10.1126/scitranslmed.aau6627
12
LusterADAlonRVon AndrianUH. Immune cell migration in inflammation: present and future therapeutic targets. Nat Immunol. (2005) 6:1182–90. doi: 10.1038/ni1275
13
MengZChenYWuWYanBMengYLiangYet al. Exploring the immune infiltration landscape and M2 macrophage-related biomarkers of proliferative diabetic retinopathy. Front Endocrinol (Lausanne). (2022) 13:841813. doi: 10.3389/fendo.2022.841813
14
BhuttoIAVaidyaTGhoshSPadmanabhanAYazdankhahMShangPet al. Infiltrating immune cells and pathophysiology in Diabetic Retinopathy (DR). Invest Ophthalmol Visual Sci. (2019) 60:2683.
15
XuHChenM. Diabetic retinopathy and dysregulated innate immunity. Vision Res. (2017) 139:39–46. doi: 10.1016/j.visres.2017.04.013
16
BehrensEMGaduePGongSGarrettSSteinPLCohenPL. The mer receptor tyrosine kinase: expression and function suggest a role in innate immunity. Eur J Immunol. (2003) 33:2160–7. doi: 10.1002/eji.200324076
17
CaiBThorpEBDoranACSubramanianMSansburyBELinC-Set al. MerTK cleavage limits proresolving mediator biosynthesis and exacerbates tissue inflammation. Proc Natl Acad Sci U.S.A. (2016) 113:6526–31. doi: 10.1073/pnas.1524292113
18
LieffrigSAGyimesiGMaoYFinnemannSC. Clearance phagocytosis by the retinal pigment epithelial during photoreceptor outer segment renewal: Molecular mechanisms and relation to retinal inflammation. Immunol Rev. (2023) 319:81–99. doi: 10.1111/imr.13264
19
VillaniA-CSatijaRReynoldsGSarkizovaSShekharKFletcherJet al. Single-cell RNA-seq reveals new types of human blood dendritic cells, monocytes, and progenitors. Science. (2017) 356:eaah4573. doi: 10.1126/science.aah4573
20
WangCYangSDuanLDuXTaoJWangYet al. Adaptive immune responses and cytokine immune profiles in humans following prime and boost vaccination with the SARS-CoV-2 CoronaVac vaccine. Virol J. (2022) 19:223. doi: 10.1186/s12985-022-01957-1
21
ChengXHeYBaoWZhangZChenLSongGet al. Transcriptomic analysis of mRNA expression in giant congenital melanocytic nevi. Gene. (2023) 850:146894. doi: 10.1016/j.gene.2022.146894
22
ShelbySJFeathersKLGaniosAMJiaLMillerJMThompsonDA. MERTK signaling in the retinal pigment epithelium regulates the tyrosine phosphorylation of GDP Dissociation Inhibitor alpha from the GDI/CHM family of RAB GTPase effectors. Exp Eye Res. (2015) 140:28–40. doi: 10.1016/j.exer.2015.08.006
23
LewDSMazzoniFFinnemannSC. Microglia inhibition delays retinal degeneration due to merTK phagocytosis receptor deficiency. Front Immunol. (2020) 11:1463. doi: 10.3389/fimmu.2020.01463
24
MercauMEAkaluYTMazzoniFGyimesiGAlbertoEJKongYet al. Inflammation of the retinal pigment epithelium drives early-onset photoreceptor degeneration in Mertk-associated retinitis pigmentosa. Sci Adv. (2023) 9:eade9459. doi: 10.1126/sciadv.ade9459
25
WankeFGutbierSRümmelinASteinbergMHughesLDKoenenMet al. Ligand-dependent kinase activity of MERTK drives efferocytosis in human iPSC-derived macrophages. Cell Death Dis. (2021) 12:1–13. doi: 10.1038/s41419-021-03770-0
26
CaiBKasikaraCDoranACRamakrishnanRBirgeRBTabasI. MerTK signaling in macrophages promotes the synthesis of inflammation resolution mediators by suppressing CaMKII activity. Sci Signaling. (2018) 11:eaar3721. doi: 10.1126/scisignal.aar3721
27
DeRyckereDHuelseJMEarpHSGrahamDK. TAM family kinases as therapeutic targets at the interface of cancer and immunity. Nat Rev Clin Oncol. (2023) 20:755–79. doi: 10.1038/s41571-023-00813-7
28
Silva–SanchezAMeza–PerezSLiuMStoneSLFlores–RomoLUbilEet al. Activation of regulatory dendritic cells by Mertk coincides with a temporal wave of apoptosis in neonatal lungs. Sci Immunol. (2023) 8:eadc9081. doi: 10.1126/sciimmunol.adc9081
29
CabezónRCarrera-SilvaEAFlórez-GrauGErrastiAECalderón-GómezELozanoJJet al. MERTK as negative regulator of human T cell activation. J Leukocyte Biol. (2015) 97:751–60. doi: 10.1189/jlb.3A0714-334R
30
PeetersMJWDulkeviciuteDDraghiARitterCRahbechASkadborgSKet al. MERTK acts as a costimulatory receptor on human CD8+ T cells. Cancer Immunol Res. (2019) 7:1472–84. doi: 10.1158/2326-6066.CIR-18-0841
31
BrandaoLNWingesAChristophSSatherSMigdall-WilsonJSchlegelJet al. Inhibition of MerTK increases chemosensitivity and decreases oncogenic potential in T-cell acute lymphoblastic leukemia. Blood Cancer J. (2013) 3:e101–1. doi: 10.1038/bcj.2012.46
32
PowellRMPeetersMJWRahbechAAehnlichPSeremetTthor StratenP. Small molecule inhibitors of MERTK and FLT3 induce cell cycle arrest in human CD8+ T cells. Vaccines (Basel). (2021) 9:1294. doi: 10.3390/vaccines9111294
33
SummersRJJainJVasileiadiESmithBStoutMKelvinJet al. Therapeutic targeting of mertk and BCL-2 in T-cell and early T-precursor acute lymphoblastic leukemia. Blood. (2021) 138:1184. doi: 10.1182/blood-2021-151726
34
WanHCaiYWangYFangSChenCChenYet al. The unique association between the level of peripheral blood monocytes and the prevalence of diabetic retinopathy: a cross-sectional study. J Transl Med. (2020) 18:248. doi: 10.1186/s12967-020-02422-9
35
Llorián-SalvadorMde FuenteAGMcMurranCEDashwoodADooleyJListonAet al. Regulatory T cells limit age-associated retinal inflammation and neurodegeneration. Mol Neurodegeneration. (2024) 19:32. doi: 10.1186/s13024-024-00724-w
36
ObasanmiGLoisNArmstrongDLaveryN-JHombrebuenoJRLynchAet al. Circulating leukocyte alterations and the development/progression of diabetic retinopathy in type 1 diabetic patients - A pilot study. Curr Eye Res. (2020) 45:1144–54. doi: 10.1080/02713683.2020.1718165
37
KimJHParkKLeeSBKangSParkJSAhnCWet al. Relationship between natural killer cell activity and glucose control in patients with type 2 diabetes and prediabetes. J Diabetes Investig. (2019) 10:1223–8. doi: 10.1111/jdi.13002
38
LiuBHuYWuQZengYXiaoYZengXet al. Qualitative and quantitative analysis of B-cell-produced antibodies in vitreous humor of type 2 diabetic patients with diabetic retinopathy. J Diabetes Res. (2020) 2020:4631290. doi: 10.1155/2020/4631290
39
LiuYYangZLaiPHuangZSunXZhouTet al. Bcl-6-directed follicular helper T cells promote vascular inflammatory injury in diabetic retinopathy. Theranostics. (2020) 10:4250–64. doi: 10.7150/thno.43731
40
KaseSSaitoWOhnoSIshidaS. Proliferative diabetic retinopathy with lymphocyte-rich epiretinal membrane associated with poor visual prognosis. Invest Ophthalmol Vis Sci. (2009) 50:5909. doi: 10.1167/iovs.09-3767
41
HuangJZhouQ. CD8+T cell-related gene biomarkers in macular edema of diabetic retinopathy. Front Endocrinol (Lausanne). (2022) 13:907396. doi: 10.3389/fendo.2022.907396
42
Al DubayeeMSAlayedHAlmansourRAlqaoudNAlnamlahRObeidDet al. Differential expression of human peripheral mononuclear cells phenotype markers in type 2 diabetic patients and type 2 diabetic patients on metformin. Front Endocrinol (Lausanne). (2018) 9:537. doi: 10.3389/fendo.2018.00537
43
Al DubayeeMAlshahraniAAlmalkMHakamiAHomoudBAlzneidiNet al. Metformin alters peripheral blood mononuclear cells (PBMC) senescence biomarkers gene expression in type 2 diabetic patients. J Diabetes Complications. (2021) 35:107758. doi: 10.1016/j.jdiacomp.2020.107758
44
LiuSWuJYangDXuJShiHXueBet al. Big data analytics for MerTK genomics reveals its double-edged sword functions in human diseases. Redox Biol. (2024) 70:103061. doi: 10.1016/j.redox.2024.103061
Summary
Keywords
diabetes mellitus, retinopathy, non-proliferative diabetic retinopathy, PBMC (peripheral blood mononuclear cells), MERTK
Citation
Bu S, Ling J-Y, Wu X, Zhang L, Shi X, Huang L, Zhao Z, Yang Y, Xiang Z, Liu YU, Liu Y and Zhang Y (2025) Downregulation of MerTK in circulating T cells of patients with non-proliferative diabetic retinopathy. Front. Endocrinol. 15:1509445. doi: 10.3389/fendo.2024.1509445
Received
11 October 2024
Accepted
09 December 2024
Published
08 January 2025
Volume
15 - 2024
Edited by
Raba Thapa, Tilganga Institute of Ophthalmology, Nepal
Reviewed by
Norbert Nass, Brandenburg Medical School Theodor Fontane, Germany
Endre Károly Kristóf, University of Debrecen, Hungary
Updates
Copyright
© 2025 Bu, Ling, Wu, Zhang, Shi, Huang, Zhao, Yang, Xiang, Liu, Liu and Zhang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yong U. Liu, liuy6@foxmail.com; Yufeng Liu, eyyufengliu@scut.edu.cn; Yuehong Zhang, eyyuehongzhang@scut.edu.cn
†These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.