ORIGINAL RESEARCH article

Front. Immunol., 28 October 2021

Sec. Autoimmune and Autoinflammatory Disorders

Volume 12 - 2021 | https://doi.org/10.3389/fimmu.2021.741140

Polymorphisms of the FCN2 Gene 3’UTR Region and Their Clinical Associations in Preterm Newborns

  • 1. Laboratory of Immunobiology of Infections, Institute of Medical Biology, Polish Academy of Sciences, Łódź, Poland

  • 2. Department of Newborns’ Infectious Diseases, Poznań University of Medical Sciences, Poznań, Poland

  • 3. Department of Neonatology, Medical University of Gdańsk, Gdańsk, Poland

  • 4. Department of Perinatology, First Chair of Gynecology and Obstetrics, Medical University of Łódź, Łódź, Poland

  • 5. Department of Applied Biochemistry, Tokai University, Hiratsuka, Japan

  • 6. Scottish National Blood Transfusion Service, National Science Laboratory, Edinburgh, Scotland, United Kingdom

  • 7. Department of Immunology, Fukushima Medical University, Fukushima, Japan

Abstract

Ficolin-2 is regarded as an important innate immunity factor endowed with both lectin (carbohydrate recognition) qualities and ability to induce complement activation. The aim of this study was to investigate the association of the FCN2 3’-untranslated region (3’UTR) polymorphisms with ficolin-2 expression and perinatal complications in preterm neonates. The sequencing analysis allowed us to identify six 3’UTR polymorphisms with minor allele frequency (MAF) >1%: rs4521835, rs73664188, rs11103564, rs11103565, rs6537958 and rs6537959. Except for rs4521835, all adhered to Hardy-Weinberg expectations. Moreover, rs6537958 and rs6537959 were shown to be in perfect linkage disequilibrium (LD) with nine other genetic polymorphisms: rs7040372, rs7046516, rs747422, rs7847431, rs6537957, rs6537960, rs6537962, rs11462298 and rs7860507 together stretched on a distance of 1242 bp and very high LD with rs11103565. The 3’UTR region was shown to bind nuclear extract proteins. The polymorphisms at rs4521835 and rs73664188 were found to influence serum ficolin-2 concentration significantly. All polymorphisms identified create (together with exon 8 polymorphism, rs7851696) two haplotype blocks. Among 49 diplotypes (D1-D49) created from rs7851696 (G>T), rs4521835 (T>G), rs73664188 (T>C), rs11103564 (T>C), rs11103565 (G>A) and rs6537959 (T>A), twenty two occurred with frequency >1%. Two diplotypes: D13 (GTTTGT/GGTCGT) and D10 (GTTTGT/GGTCGA), were significantly more frequent among preterm neonates with early onset of infection and pneumonia, compared with newborns with no infectious complications (OR 2.69 and 2.81, respectively; both p<0.05). The minor (C) allele at rs73664188 was associated with an increased risk of very low (≤1500 g) birthweight (OR=1.95, p=0.042) but was associated with the opposite effect at rs11103564 (OR=0.11, p=0.005).

Introduction

Ficolin-2 (L-ficolin) is a serum pattern-recognition molecule, which is able to accelerate clearance of microorganisms directly as an opsonin and indirectly by complement activation via the lectin pathway.

Ficolin-2 has been shown to recognise numerous clinically relevant isolates like enteroaggregative Escherichia coli, Aspergillus fumigatus, Mycobacterium tuberculosis, Streptococcus pneumoniae, Staphylococcus aureus and Trypanosma cruzi (15). Lipoteichoic acids, peptidoglycan, 1,3-β-glucans or mycobacterial Ag85 complex have been identified as ficolin-2 microbial targets (68). Moreover, ficolin-2 was shown to interact with endogenous factors like elastin, complement CR1 receptor, C-reactive protein (CRP) and long pentraxin 3 (912) and may be involved in the clearance of late apoptotic/necrotic cells (13). The CRP-ficolin-2 complex, formed under inflammatory conditions, enables a cross-talk between lectin and classical pathways of complement activation that results in enhancement of serum antimicrobial activity (11).

The FCN2 gene contains 8 exons and has been localised to chromosome 9 (9q34) (14). Exon 1 encodes the 5’UTR, the signal peptide (S) and the N-terminal fragment of the mature protein; exons 2 and 3 encode the collagen-like domain (C and C2), exon 4 encodes a linker peptide (L), exons 5-7 encode part of the fibrinogen like (FBG) domain (F1-F3), and exon 8 encodes the rest of the FBG and the 3’UTR (14). Three splicing variants have been identified: the first variant lacks the second exon sequence and has an additional 76 bp sequence extending from 3’UTR; the second variant is generated by the insertion of the fifth intron and also has an additional 3’UTR sequence of 1060 bp; and the third variant is generated by the insertion of both third and fifth introns (14).

The concentration of ficolin-2 in serum is known to depend on polymorphisms in both FCN2 promoter and structural regions. Hummelshoj et al. (15) and Kilpatrick et al. (16) demonstrated significant associations of ficolin-2 levels with promoter polymorphisms at positions -986 (rs3124952, A>G), -602 (rs3124953, G>A), -64 (rs7865453, A>C) and -4 (rs17514136, A>G). Two exon 8 single nucleotide polymorphisms (SNPs) (rs7851696 and rs17549193, at positions +6424 (G>T) and +6359 (C>T), respectively) were also shown to affect ficolin-2 concentration in serum/plasma, due to strong linkage disequilibria (LD) with rs7865453 (-64) and rs17514136 (-4), respectively (17, 18). Those two exon 8 SNPs influence the structure of the fibrinogen-like domain and the affinity of ficolin-2 to its ligands (12, 15). However, marked variations among individuals carrying the same polymorphic variants were reported and genotype-independent factors seem also to influence ficolin-2 serum concentration (16). For example, cord blood serum ficolin-2 level was shown to be associated with gestational age and birthweight (19). Furthermore, Troldborg et al. (20) found significantly lower serum ficolin-2 in female compared with male adult blood donors. In patients suffering from malaria, markedly higher serum ficolin-2 levels were also observed in the acute phase of disease than after treatment (21). Huge intra-genotype differences in ficolin-2 concentrations may lead to the difficulties in data interpretation and identification of ficolin-2 genotype/phenotype disease associations - especially in studies with a restricted number of samples. Therefore, genotyping alone cannot be used to predict serum concentration. However, an influence of other, still undefined polymorphisms on ficolin-2 serum level cannot be excluded.

93% of functional polymorphisms in the genome-wide association study (GWAS) catalogue are located in non-coding regions (22). Such polymorphisms can affect gene splicing, binding of transcription factors and the interaction between transcript and microRNA – posttranscriptional regulators of gene expression. Generally, 11% of human reference SNP are located in the 3’UTR and they are gaining growing attention (23). They were shown for example to have an impact on the susceptibility to bacterial or viral infections (24, 25), periodontitis (26), sepsis and risk of development of multiorgan dysfunction syndrome (MODS) in severe traumatic patients (27). Moreover, they may be associated with cancer (2830) and pulmonary hypertension (31).

Previously, we have suggested that low ficolin-2 concentration in cord serum may contribute to the adverse consequences of prematurity (19). Since the marked intra-genotype variations in ficolin-2 levels cannot be fully explained with known promoter/exon 8 polymorphisms, we aimed to search for SNPs within FCN2 3’UTR and verify their biological significance using samples from neonates born preterm as a clinical model. In contrast to FCN2 gene 5’UTR and exon 8 SNPs, knowledge about 3’UTR variability and clinical associations is very limited. To our knowledge, this is the first report concerning the FCN2 3’UTR genotype-phenotype relationship.

Materials and Methods

Subjects

Cord blood samples from 504 Polish preterm neonates including 106 extremely/early preterm (born at gestational age <33 weeks, according to the classification of The World Health Organisation, WHO) and 398 moderate/late preterm (gestational age 33-37 weeks) (Table 1) were obtained from the Department of Newborns’ Infectious Diseases (University of Medical Sciences, Poznań, Poland), Department of Neonatology (Medical University of Gdańsk, Poland) and Department of Perinatology (Medical University of Łódź, Poland). 326 babies came from singleton pregnancies, 172 from 97 twin pregnancies (in 22, material from only one sibling was collected) and 6 from 2 triple pregnancies. The study was approved by the corresponding local ethics committees (Bioethics Committee of The Karol Marcinkowski Poznań University of Medical Sciences, Independent Bioethics Committee for Scientific Research at Medical University of Gdańsk, Bioethics Committee of The Medical University of Łódź). Written informed parental consent was obtained. This work conforms to the provisions of the Declaration of Helsinki. Isolated serum (blood taken into tubes with clot activator) was kept at -80°C. DNA (blood taken into tubes with sodium citrate) was isolated using GeneMATRIX Quick Blood Purifaction Kit (EURx Ltd. Gdańsk, Poland), according to the manufacturer’s protocol.

Table 1

ParameterAll samplesNeonates
Extremely/early pretermModerate/late pretermStatistical significance (extremely/early vs. moderate/late preterm)
n504106398
Gestational agep<0.0001
Median353135
Mean3430.335
Range24-3624-3233-36
Birthweight
Mean229616082476p<0.0001
Median233016152480
Range565-4630565-3400970-4630
Female/Male0.91.10.86p=0.27
Early onset of infection (%)72 (14.7%)38 (36%)34 (8.5%)p<0.0001
Late onset of infection (%)35 (6.9%)16 (15%)19 (4.8%)p=0.0007
Pneumonia39 (7.7%)27 (25%)12 (3%)p<0.0001
pPROM1 (%)142 (28%)36 (34%)106 (26.6%)p=0.14
RDS2 (%)107 (21%)60 (56.6%)47 (11.8%)p<0.0001
Ficolin-23 (ng/ml)
Median182915931909p=0.024
Mean198117052040
Range153-5644237-4426153-5644

Basic clinical characteristics of the study group.

1preterm prelabor rupture of membranes; 2respiratory distress syndrome; 3concentration in cord serum.

DNA Sequencing of the FCN2 3’UTR Region

The FCN2 3’UTR region was generally amplified in three separate PCRs: reaction A (amplified region on chromosome 9: 134 887 339-134 888 460), reaction B (amplified region on chromosome 9: 134 888 251-134 890 157) and reaction C (amplified region on chromosome 9: 134 889 426-134 890 521). Alternatively, in the case of problems with sequencing of the product of reaction B, the additional reaction D (amplified region on chromosome 9: 134 887 339-134 890 506) was performed. PCR conditions, as well as sequences of primers and expected PCR products lengths are listed in Table 2. The PCR mixtures (in a total volume of 20 µl) consisted of 50 ng of genomic DNA, 1× DreamTaq polymerase reaction buffer (includes 20 mM MgCl2) (Life Technologies, Carlsbad, CA, USA), 1 U DreamTaq polymerase (Life Technologies, USA), 1 mM of each deoxynucleotide, and 0.5 µM of each primer. Reactions were performed using a Veriti™ 96-Well Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA). PCR amplicons were analyzed using horizontal 2% agarose gel electrophoresis in a 1 × TAE buffer. The 100 bp Plus DNA size marker (Thermo Fisher Scientific) was used to normalize the size of each PCR product. The PCR products were purified using the EPPiC Fast mixture (A&A Biotechnology, Gdańsk, Poland), according to the manufacturer’s protocol. For sequencing of PCR products, the BrilliantDye™ Terminator (v.3.1) Cycle Sequencing kit (Life Technologies) was used, according to the manufacturer’s protocol. For both A and C reactions – primers A_ F, A_R, C_F and C_R, were used (Table 2), respectively whereas for sequencing of the PCR products of B and D reactions, the forward primer GCCTGACCAGGCTTTTAGAG or reverse primer AGGTGCACACACACACACAC were employed. For the analysis of following SNP: rs4521835, rs73664188 and rs11103564 SNP, the reaction E (amplified region on chromosome 9: 134 887 339-134 888 155) was performed. The sequencing was successful in 97% at rs11103564 and 99% at rs4521835 and rs73664188. PCR products were purified with the use of BigDye XTerminator™ Purification Kit (Thermo Fisher Scientific), according to the manufacturer’s protocol and then sequenced using the 3500xl Genetic Analyzer (Applied Biosystems, San Diego, CA, USA). Sequencing results were analyzed using Chromas software version 2.4.1 (Technelysium, Brisbane, Australia).

Table 2

ReactionPrimersPCR conditionPCR product size
AA_F: ATGGCATCAACTGGAAGTCG96°C, 3 min; 38 x: (96°C, 45 s; 58°C, 20 s; 72°C, 60 s); 72°C, 7 min1122 bp
A_R : GGACCCTTCTGGATCCTCTC
BB_F: CCCTCTCCTCTCACCACGTC96°C, 3 min; 61°C, 45 s; 72°C, 2 min; 38x: (96°C, 45 s; 59°C,30 s; 72°C, 2 min); 72°C, 7 min1907 bp
B_R: TTCTTTACCGCATCCTGACC
CC_F: GGTTTGTTGGGATAAGAAAATG96°C, 3 min; 38x: (96°C, 45 s; 58°C, 20 s; 72°C, 60 s); 72°C, 7 min1096 bp
C_R: TTTGGGGCGAGTTCATAAAG
DD_F: ATGGCATCAACTGGAAGTCG96°C, 2 min; 35x: (96°C, 60 s; 62°C, 30 s; 72°C, 4 min); 72°C, 10 min3258 bp
D_R: TTCACAGCTTTGGGGAAAAT
EA_F: ATGGCATCAACTGGAAGTCG94°C, 5 min, 35x (94°C, 15 s; 56°C, 20 s; 72°C, 45 s); 72°C, 3 min817 bp
E_R: GGCTTTCTGATTCAATCTGC
FF_F : GCTTTTAGAGGCTCCGCAC96°C, 5 min, 40x (96°C, 15 s 62°C, 20 s; 72°C, 45 s); 72°C, 5 min1325bp
F_R : TCCTACAGAGCCCTTCCGA

Primers and PCR conditions used for the FCN2 gene 3’UTR sequencing.

Allelic Discrimination Using TaqMan Probes

Three SNPs were analyzed using TaqMan® Assays purchased from Thermo Fisher Scientific: rs6537958 (Assay ID: C_29220561_10), rs6537959 (Assay ID: C_29220562_20) and rs11103565 (Assay ID: C_31552275_10). For all three SNPs, the PCR mixture consisted of 10 µl of 2 × TaqMan™ Genotyping Master Mix (Thermo Fisher Scientific), 1 µl of appropriate 20X TaqMan® Assay, and 10 ng of genomic DNA. The PCR mixture was filled up with a distilled, DNase and RNase free water (Gibco, Waltham, MA, USA) to the final volume of 20 µl. The real-time PCR was performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems) with 96-Well Block Module using standard mode thermal cycling setting under the following conditions: an initial denaturation step at 95°C for 10 min, followed by 40 cycles of denaturation (95°C, 15 s), single annealing and extension step (60°C for 1 minute). Fluorescence signal detection for both dyes was performed after each cycle. For each plate, a no template control (NTC) was included. Allelic discrimination analysis was performed using a SDS 2.3 software (Applied Biosystems).

Determination of the FCN2 Gene Promoter and Exon 8 Polymorphisms

Promoter polymorphisms at positions -986 (rs3124952, A>G) and -602 (rs3124953, G>A) were investigated according to the procedures described by Metzger et al. (32) while those at positions -64 (rs7865453, A>C) and -4 (rs17514136, A>G) as well as exon 8 SNPs (+6359, rs17549193, C>T; +6424, rs7851696, G>T) were determined as described by Szala et al. (33), with minor modifications.

Determination of Ficolin-2 Concentration in Cord Sera

Ficolin-2 in 395 cord blood serum samples was determined in TRIFMA as described by Świerzko et al. (34). Briefly, anti-ficolin-2 mAb (ABS 005-16, BioPorto Diagnostics, Hellerup, Denmark) were employed for 384 HB Optiplate coating, whereas biotinylated mAb (GN4, Hycult Biotech, Uden, The Netherlands) and Eu3+-labelled streptavidin (Perkin Elmer, Boston, MA, USA) were used for protein detection. The inter-assay and intra-assay coefficients of variation (%CV) were 18% and 13% for serum with ficolin-2 concentration of 3500 ng/ml, respectively whereas for serum with ficolin-2 concentration of 4900 ng/ml they equalled 10% and 7%, respectively.

Electrophoretic Mobility Shift Assay

Electrophoretic Mobility Shift Assay was performed using LightShift Chemiluminescent EMSA Kit (Thermo Fisher Scientific), according to the manufacturer’s protocol. A 1325 bp DNA PCR product was obtained using F_F and F_R primers (Table 2). The PCR mixtures (in a total volume of 50 µl) consisted of 20 ng of genomic DNA, 1× DreamTaq polymerase reaction buffer (includes 20 mM MgCl2) (Life Technologies), 1 U DreamTaq polymerase (Life Technologies), 800 µM of each deoxynucleotide, and 0.4 µM of each primer. PCR product was labelled with biotin at 3’ end of the probe using the Pierce™ Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific), according to the manufacturer’s protocol. Nuclear extract was prepared from human hepatocyte HepG2 cell line using a Nuclear Extract kit (Thermo Fisher Scientific). Four fmol of biotinylated PCR product was incubated (20 min, RT) with or without 3 µl of nuclear extract in the binding buffer supplemented with glycerol (2.5%), MgCl2 (5 mM), Poly (dI·dC) 50 ng/µl, NP-40 (0.05%), 50 mM KCl and 10 mM EDTA. For inhibition experiments, four fmol of biotinylated PCR product was incubated (20 min, RT) with or without 3 µl of nuclear extract, as well as with or without inhibitor (0.4 pmol of unlabelled PCR product). After electrophoresis in native 6% polyacrylamide gel in TBE buffer, DNA was transferred to Amersham Hybond-N+ nylon membrane (Cytiva, Marlborough, MA, USA) and crosslinked at 120 mJ/cm2 using a commercial UV-light crosslinking instrument (auto-crosslinking function). The biotin-labelled DNA was detected by chemiluminescence by placing a membrane in a film cassette and exposure membrane to X-ray for 1 minute.

Statistics

The Hardy-Weinberg equilibrium (HWE) exact test was used for the analysis of the genotype distribution consistency for all polymorphisms. Linkage disequilibrium (LD) and haplotype block analysis were performed by Haploview 4.2 software (http://www.broad.mit.edu/mpg/haploview/). LD analysis was performed for each pair of polymorphisms using D’ and r2, indicating the amount of LD between two genetic loci. A value of 1 suggests no random association of alleles at different loci. Haplotype block identification was performed based on Four Gamete Rule. The PHASE software (http://stephenslab.uchicago.edu/phase/download.html, version 2.1.1.) was used for diplotype reconstruction from genotype data. In silico analysis was performed with SNPinfo (FuncPred) (https://snpinfo.niehs.nih.gov) and RegulomeDB (https://www.regulomedb.org) databases. The statistical significance of the genetic impact on serum levels was tested with Mann-Whitney U test, Kruskal-Wallis ANOVA test and Spearman Rank correlation. The frequencies of genotypes were compared by two-sided Fischer’s exact test (or χ2 when appropriate). The GraphPad Prism 6 software (https://www.graphpad.com) was used for those calculations. P values <0.05 were considered statistically significant. Odds ratio was calculated using online MedCalc software (https://www.medcalc.org).

Results

Identification of Polymorphisms in 3’UTR Region of FCN2 Gene and Their Frequencies in Preterm Neonates

To identify the polymorphic sites in FCN2 3’UTR region, in the preliminary experiment the 3183 bp fragment in 75 consecutive DNA samples was analyzed via Sanger sequencing. Initial screening allowed us to identify fifteen polymorphic sites with MAF>0.1 (Table 3).

Table 3

PolymorphismHGVS* variant descriptionConsequence typePosition on chromosome 9
1rs4521835c.*45T>G3’UTR variant134 887 460
c.*45T>C
c.*45T>A
2rs73664188c.*346T>CRegulatory region variant134 887 761
3rs11103564c.*614T>CRegulatory region variant134 888 029
4rs11103565c.*853G>ARegulatory region variant134 888 268
5rs7040372c.*963C>TRegulatory region variant134 888 378
6rs7046516c.*1014A>GRegulatory region variant134 888 429
7rs7847422c.*1309A>GRegulatory region variant134 888 724
8rs7847431c.*1326A>CRegulatory region variant134 888 741
9rs6537957c.*1496T>CRegulatory region variant134 888 911
10rs6537958c.*1562C>TRegulatory region variant134 888 977
11rs6537959c*1631T>ARegulatory region variant134 889 046
12rs6537960c.*1652C>TRegulatory region variant134 889 067
13rs6537962c*1674T>CRegulatory region variant134 889 089
14rs11462298c.*2009_*2010insAIntergenic variant134 889 424-
134 889 425
15rs7860507c.*2205G>AIntergenic variant134 889 620

Polymorphisms identified in the FCN2 gene 3’UTR region.

*HGVS, Human Genome Variants Society.

Next, the frequency of those genetic variants was determined in the remaining samples of preterm neonates (Table 4). Rs4521835, rs73664188 and rs111103564 were investigated using Sanger sequencing, whereas rs11103565 was investigated by using the TaqMan Allelic Discrimination assay. The agreement between sequencing analysis and TaqMan probes for 89 samples was 91%. Disagreement was observed in three cases, whereas in five cases the SDS 2.3 software was not able to determine the genotype. Eleven polymorphic sites located between 134 888 378 and 134 889 620 bp analyzed in the 75 samples mentioned were shown to be in complete LD. Using the SNPinfo algorithm for the Caucasian population two tag SNPs: rs6537958 (correlated with rs6537957, rs6537960, rs7040372 and rs7847431) and rs6537959 (correlated with rs7046516, rs6537962a and rs7860507) were indicated. The frequencies of rs4521835, rs73664188, rs111103564 as well as rs6537958 and rs6537959 (representing eleven polymorphic sites) in preterm neonates are presented in Table 4. They did not differ from those reported for the Central European (CEU) population. Except for rs4521835, all FCN2 polymorphisms tested adhered to the Hardy-Weinberg expectations (p>0.05) (Table 4).

Table 4

dbSNP IDObserved genotypesa (n)HWE p valuebMAFcMAFd in population:
RRRVVVTotalCEU
rs45218351992001010.0000170.4020.4150.407
rs7366418837711670.26140.1300.1210.116
rs11103564187228740.86110.3840.3090.312
rs11103565275184280.52170.2460.1850.182
rs6537958234216500.52170.3160.2450.243
rs6537959234216500.52170.3160.2360.229

The frequencies of analyzed FCN2 3’UTR genetic variants in polish preterm babies.

a

Number of detected genotypes, R, reference allele; V, variant allele; bp value is consistent with Hardy-Weinberg equilibrium if p>0.001; cminor allele frequency; dminor allele frequency reported in dbSNP [ALFA allele frequencies in total and Central European (CEU) populations].

Linkage Disequilibrium and Haploblock Analysis

Based on four FCN2 promoter, two exon 8 and five 3’UTR polymorphisms, linkage disequilibrium analysis was performed in 504 samples (Figure 1). According to the r2 and D’ parameters, perfect linkage (r2 = 1, D’=1) was detected between two 3’UTR SNPs (rs6537958 and rs6537959). As a result of sequencing analysis of 75 DNA samples, a perfect LD with them was also detected for other nine 3’UTR polymorphisms (rs7040372, rs7046516, rs7847422, rs7847431, rs6537957, rs6537960, rs6537962, rs114662298 and rs7860507) and confirmed in the ensembl database (https://www.ensembl.org/Homo_sapiens/Info/Index) for the CEU population. Very high r2 and D’ values (0.669 and 0.98, respectively) were observed also between rs11103565 and rs6537958 as well as rs11103565 and rs6537959. Low r2 but high D’ values (>0.8) were observed between 3’UTR rs73664188 and promoter rs3124953 (-602), rs7865453 (-64), rs17514136 (-4), exon 8 rs7851696 (+6424) as well as 3’UTR polymorphisms (rs11103564, rs11103565, rs6537958, rs6537959 and presumably nine others mentioned above).

Figure 1

Since rs4521835 did not comply with Hardy-Weinberg equilibrium, it was not included in the analysis. However, in the subgroup of early preterm neonates, no deviation from HWE was found for this SNP and Haploview analysis revealed a high LD with rs73664188, rs11103564, rs11103565, rs6537958 and rs6537959. The LD plots for separated extremely/early and moderate/preterm neonates are presented in Supplementary Materials (Figure S1).

Using the Four Gamete Rule approach, four haplotype blocks were identified: block 1 and block 2 - each created by two promoter SNPs [rs3124952 (-986) and rs3124953 (-602) or rs7865453 (-64) and rs17514136 (-4), respectively], block 3 [involving three SNPs: exon 8 rs7851696 (+6424), rs73664188 and rs11103564, both 3’UTR] and block 4 [created by 3’UTR rs11103565, rs6537958, rs6537959 and presumably nine others variants] (Figure 2). As mentioned above, rs4521835 was excluded from analysis. Four haplotypes corresponding to block 3 were identified. Among them GTT (the reference genotype) and GTC had frequency >1%. Within the block 4, three haplotypes were found, including GTA (the reference genotype) and ATA with frequency >1%. The D’ between 3 and 4 blocks was 0.85. The frequency of haploblocks identified in extremely/early and moderate/late preterm neonates is presented in Supplementary Materials (Figure S2). In the case of neonates born before 33 week of gestation, data analysis gave five haploblocks, whereas for those having gestational age ≥33 weeks at birth, only three.

Figure 2

The Diplotype-Phenotype Association

PHASE software allowed us to identify 49 diplotypes (D1-D49), corresponding to block 3 and block 4 genetic variants: exon 8 rs7851696 (+6424, G>T) and five 3’UTR SNPs: rs4521835 (T>G), rs73664188 (T>C), rs11103564 (T>C), rs11103565 (G>A) and rs6537959 (T>A). Twenty of them, with frequency ≥1% are listed in the Table 5, whereas all identified diplotypes are presented in the Supplementary Materials (Table S1). GTTTGT/GTTTGT (D15) represents the reference diplotype. Diplotypes differing only in SNPs with no greater influence on ficolin-2 level, were grouped into five subgroups (I-V). The sixth subgroup was associated with relatively low ficolin-2 concentration (Table 6 and Figure 3). There were no significant differences in gestational age or birthweight between subgroups. Two diplotypes: D28, (GTTTGT/GGTTGA) and D35 (GGTCGT/GGTCGA) with frequency of 1% were not included in any subgroup.

Table 5

SubgroupDiplotypeFicolin-2 serum concentration (ng/ml)
SequenceDescriptionFrequency (%, n)nMedianRange
IGTTTGT/GTTTGTD1518.7 (94)702154153-4893
GTTTGT/GTTCGT**D61.4 (7)428171637-3747
IIGTTTGT/GGTCGTD136.7 (34)282053611-3957
GTTTGT/GGTCGAD103.6 (18)141601803-5408
IIIGTTTGT/GGTCAAD116 (80)631932372-4381
IV GGTTGT/GGTCAAD96.1 (31)272285481-5299
GGTTGT/GGTCGAD231.6 (8)622771455-4891
GGTTGT/GGTCGTD221.2 (6)522571166-3642
VGGTCAA/GGTCAAD35 (25)191549706-4165
GGTCGT/GGTCAAD44.1(21)181923520-3646
GGTCGA/GGTCAAD114 (20)181785479-5481
VI***GTTTGT/TGCTGTD25.7 (29)221479204-4081
GTTTGT/GGCTGTD174 (20)161132242-5644
GGTCAA/TGCTGTD143.6 (18)161383478-2157
GGTCAA/GGCTGTD52.6 (13)121410237-5068
GGTTGT/TGCTGTD71.8 (9)91737976-3935
GGTCGT/TGCTGTD321.4 (7)41075504-1456
GGTCGT/GGCTGTD191.2 (6)321481934-2196
GGTTGT/GGCTGTD211.2 (6)523231266-2657
TGCTGT/TGCTGTD121.0 (5)5937331-2194

The subgroups including identified diplotypes (with the frequency ≥1%*) in preterm neonates.

* - as mentioned, D28 and D35 were not included in any subgroup; ** - the differing nucleotide (in comparison with the most common diplotype within subgroup is underlined; *** - in the subgroup VI, all diplotypes with frequency of ≥1% with G allele at rs4521835 and C at rs73664188 (marked in red) are collected. For D12, the T allele at rs7851696 (+6424, G>T) related also with ficolin-2 low level is also marked.

Table 6

Diplotype group:
IIIIIIIVVVII-VI
D6, D15D10, D13D1D9, D22, D23D3, D4, D11D2, D5, D7, D14, D17, D19, D32
n10251804666122467
Median ficolin-2 concentration (ng/ml) (n)2178 (74)1938 (41)1914 (63)2271 (38)1831 (55)1438 (100)1831 (371)
Median gestational age (weeks)34353534.5353535
Median birthweight (g)2305252022702430231023052320
Gestational age <33 weeks22/102 (21.6%)14/51 (27.5%)17/77 (22%)5/44 (11.4%)13/66 (19.7%)25/122 (20.5%)96/462 (20.8%)
nsnsnsnsnsns
Birthweight ≤1500g12/102 (11.8%)6/51 (11.8%)10/77 (13%)2/44 (4.5%)1/66 (1.5%)20/122 (16.4%)51/462 (11%)
p=0.005, OR=0.11,p=0.042, OR=1.95,
nsnsnsns95% CI (0.01-0.78)*95% CI (1.07-3.58)*
Early onset of perinatal infection13/100 (13%)14/49 (28.6%)10/78 (12.8%)5/43 (11.6%)7/64 (10.9%)17/117 (14.5%)66/451 (14.6%)
p=0,008, OR=2.69,
ns95% CI (1.36-5.34)*nsnsnsns
Late onset of perinatal infection8/100 (8%)3/49 (6.1%)6/78 (7.7%)2/43 (4.7%)3/64 (4.7%)10/117 (8.5%)32/451 (7.1%)
nsnsnsnsnsns
Pneumonia12/102 (11.8%)9/51 (17.6%)4/79 (5.1%)3/43 (7%)5/65 (7.7%)5/120 (4.2%)38/460 (8.3%)
p=0.026, OR=2.81,ns; p=0.08, OR=0.4,
ns95% CI (1.25-6.33)*nsnsns95% CI (0.15-1.06)*
RDS15/101 (14.9%)10/51 (19.6%)18/79 (22.8%)8/43 (18.6%)16/66 (24.2%)29/119 (24.4%)96/459 (20.9%)
ns; p=0.074, OR=0.57, 95% CI (0.31-1.04)*nsnsnsnsns
pPROM18/101 (17.8%)5/50 (10%)10/76 (13.2%)10/44 (22.7%)11/66 (16.7%)19/119 (16%)73/456 (16%)
nsnsnsnsnsns

Associations of the FCN2 gene 3’UTR diplotypes with adverse effects of prematurity.

* - OR and 95% CI are given when p<0.1; ns, not significant.

Figure 3

The diplotype association with ficolin-2 concentration in cord serum was found to be markedly influenced by SNPs at rs4521835 and rs73664188 (Figures 4A, B). Genetic variant GC (present in D2, D5, D7, D12, D14, D17, D19, D21 and D32 diplotypes, included in subgroup VI; Table 5) was associated with low ficolin-2 serum concentration. The lowest median was associated with D12, where both haplotypes carry GC variants. Additionally, D12 represents the T allele at rs7851696 (+6424), also associated with low ficolin-2 level in cord serum (data not shown). The trend towards lower protein concentrations was found for the A variant of rs11103565 as well as TA variants at rs6537958 and rs6537959, being in perfect LD (Figure 4F). No association was observed for rs11103564 (Figure 4D). Interestingly, T/G heterozygosity at rs4521835 seems to be related to a higher protein concentration (Figure 4A).

Figure 4

Besides the relationship of 3’UTR diplotypes with ficolin-2 cord serum concentration described above, the association of genotype with selected complications like early prematurity, low birthweight, susceptibility to perinatal infection, pPROM and RDS was analyzed (Table 6).

It revealed that the probability of carrying one of subgroup II diplotypes, [heterozygous at rs4521835: GTTTGT/GGTCGT (D13) and GTTTGT/GGTCGA (D10)] is significantly higher among neonates with early onset of infection or pneumonia (OR=2.69, p=0.008 and OR=2.81, p=0.026, respectively) than in the group of neonates without such complications (Table 6). Diplotypes representing subgroup V (homozygous for C allele at rs11103564) were less frequent among babies born with birthweight ≤1500 g (OR=0.11 p=0.005) than among neonates born with a higher body mass. In contrast the over-representation of subgroup VI diplotypes with GC variants at rs4521835 and rs73664188 was found among newborns with the same birthweight range (OR=1.95, p=0.042). Moreover, that association seems to be independent of multiple pregnancies, since after excluding twins and triplets, the OR was even higher (2.98, p=0.003). No association of diplotypes with other prematurity-related complications was found.

In Silico Functional Analysis

SNPinfo (FuncPred) software was used for in silico determination of the interactions of genetic variants with microRNA (Table 7). Only rs4521835 was predicted to be a target for microRNA (miR-150, miR-484, miR-618 miR-1226 and miR-1229). The regulomeDB database [designed to assess the probability of particular variant that affects binding of transcription factor (35)] helped to determine the regulatory function of SNPs investigated, with lower score indication of more evidence of functionality (36). Rs11103564 with score of 1f was predicted to be linked to expression of a gene target and to be an eQTL (expression quantitative trait locus) for OLFM1 (olfactomedin 1), whereas rs4521835, rs7847431 and rs11462298 with rank of 3a are less likely to be associated within the functional region. The remaining genetic variants with score 4-5 have minimal evidence of binding. Variants of rs4521835, rs11103565, rs7040372, rs7046516, rs7847431 and rs11462298 may alter significantly transcription factor (TF) binding motifs.

Table 7

SNPinfoRegulomeDB
miRNA bindingScoreBinding motif for TFeQTL
rs4521835+3aRREB1
TERF1
-
rs736641884
rs111035641fOLFM1
rs111035655ELF4
rs70403725ZSCAN26
rs70465165HNF4A
rs78474224
rs78474313aEWSR1
rs65379574
rs65379584
rs65379594
rs65379604
rs65379624
rs114622983aRREB1
TERF1
rs78605074-

In silico prediction of functional role of analyzed genetic variants.

The Impact of the FCN2 Gene 3’UTR Genetic Variants on Protein Binding

Sanger sequencing and LD analysis revealed a perfect linkage among eleven SNPs (rs7040372, rs7046516, rs7847422, rs7847431, rs6537957, rs6537958, rs6537959, rs6537960, rs6537962, rs11462298 and rs7860507) and a very high LD with rs11103565. In order to investigate the biological significance of non-random perfect linkage of twelve SNPs, their impact on nuclear protein binding was tested. Biotin-labelled 1325 bp PCR products of DNA samples from homozygotes for reference/variant alleles as well as from heterozygotes were incubated with nuclear extract. A significant shift in electrophoretic mobility was observed in all cases (Figure 5A). Moreover, the interaction between biotinylated wild-type DNA and nuclear extract proteins was inhibited not only by corresponding unlabelled PCR product but also by DNA of homozygote for variant alleles as well as by unrelated DNA PCR product (Figure 5B).

Figure 5

Discussion

Ficolin-2 has been associated with a variety of disorders (3, 32, 34, 3742) and proposed as a potential biomarker of certain clinical conditions. Previous studies have demonstrated that ficolin-2 serum concentration/activity is significantly affected by polymorphisms located in both the promoter region and exon 8 (15, 16, 18). However, marked intra-genotype variations in ficolin-2 levels can complicate disease association studies.

The 3’-untranslated region may be involved in regulation of gene expression by controlling mRNA nuclear export, cytoplasmic localization and stability. It may be a target for transcriptional factors and microRNAs. 3’UTR polymorphic variants may create or abolish their binding sites, or modulate enhancer/silencer effects. The influence of 3’UTR variants on concentration of corresponding proteins in the circulation has been demonstrated previously. For example, Ning and Zhang (43) described the impact of two PTX3 gene 3’UTR SNPs on pentraxin-3 level in the Chinese Han population. Doi et al. (44) described the association of two VEGF gene 3’UTR polymorphisms with plasma VEGF levels in Japanese. Furthermore, Zanetti et al. (28) and Świerzko et al. (29) found MBL2 gene 3’UTR polymorphisms to influence mannose-binding lectin (MBL) serum concentration. The polymorphisms in the FCN2 gene 3’UTR were still unexplored and to our knowledge, this is the first report to investigate this issue in depth. Previously, there was only one report describing a trend towards a higher frequency of the G allele at rs4521835 in Polish kidney allograft recipients with delayed graft function (45).

We report here 15 genetic variants with MAF >1% in the FCN2 3’UTR in a cohort of 504 Polish preterm neonates. Their frequencies were similar to the frequencies reported for Caucasian/Central European populations (Table 4). RegulomeDB predicted four SNPs (rs11103564, rs4521835, rs7847431and rs11462298) to lie in the functional location and likely to result in functional consequences (Table 7).

Eleven SNPs (rs7040372, rs7046516, rs747422, rs7847431, rs6537957, rs6537958, s6537959, rs6537960, rs6537962, rs11462298 and rs7860507) were shown to be in complete linkage disequilibrium and together with rs73664188, rs11103564 and rs11103565 as well as with exon 8 rs7851696 (+6424) formed two related haplotype blocks. Among 49 diplotypes created from rs7851696 (G>T), rs4521835 (T>G), rs73664188 (T>C), rs11103564 (T>C), rs11103565 (G>A) and rs6537959 (T>A), twenty two occurred with frequency ≥1% (Table 5). Rs4521835 - due to deviation from HWE - was excluded from haplotype creation by Haploview software, but it was included in diplotypes reconstructed by PHASE software. Interestingly, deviation from HWE for rs4521835 was observed in neonates with gestational age ≥33 weeks only, but not in the neonates born before 33rd week of pregnancy.

Two polymorphisms (rs4521835 and rs73664188) were shown to significantly influence ficolin-2 concentration in cord serum, with the lowest levels observed in the GC haplotype carriers (Table 5 and Figures 3, 4). When the diplotype-serum concentration relationship was analyzed, the lowest ficolin-2 levels were shown in individuals carrying the C allele at rs73664188, the G allele at rs4521835 and the T allele at exon 8 rs7851696 (+6424) at least on one strand (Table 5). Interestingly, the SNPinfo database indicated possible involvement of rs4521835 genetic variants in creating or abolishing miRNA targets sites, which may suggest epigenetic regulation of ficolin-2 synthesis. Moreover, the rs73664188 SNP seems to modify an impact of promoter polymorphisms on ficolin-2 concentration in cord serum (Figure S3).

There have been some reports of significant differences in FCN2 genotypes (involving promoter and/or structural regions) between patients and healthy controls in several clinical contexts (34, 39, 4649). The results presented here demonstrate an association of subgroup II diplotypes D13 (GTTTGT/GGTCGT) and D10 (GTTTGT/GGTCGA) among preterm neonates with early onset of infection and/or pneumonia (OR in range 2.69-2.81, p<0.05, in comparison with newborns with no infections till hospital discharge). Moreover, in the group of neonates with birthweight ≤1500 g the lower frequency of subgroup V genotypes (both C allele at rs11103564, OR=0.11, p=0.005) but higher probability of subgroup VI diplotypes [associated with low ficolin-2 level resulting from GC variants at rs4521835 and rs73664188 (OR=1.95, p=0.042)] were observed. The assumption that carrying C allele at rs73664188 is associated with low birthweight is supported by an increased odds ratio when only data from singleton pregnancies were analyzed (OR=2.98, p=0.003). Therefore, this variant seems to be a risk factor for one of the adverse effects of prematurity.

Eleven SNPs stretched on the distance of 1242 bp analyzed here were shown to be in perfect LD and with very high LD with rs11103565. They had no greater impact on ficolin-2 concentration in cord sera, however some of them were predicted by RegulomeDB to be associated with transcription factor binding (rs7040372, rs7046516, rs7847431 and rs11462298). We assumed that absolute LD between eleven SNP may be associated with nuclear protein binding. Polymorphism of DNA and RNA 3’ untranslated regions may modulate such interactions. For example, the 3’UTR T variant of the XRCC2 gene at rs3218550 was shown to enhance nuclear protein binding (50). Using a gel shift assay, we tested whether 1325 bp PCR product including twelve SNPs may be involved in protein binding and whether such interaction may be influenced by their genetic variants. Our results indicate that three tested genetic variants were able to bind nuclear extract factors. The results are not easy to interpret since the protein-DNA interaction can be either DNA sequence-nonspecific (protein-sugar phosphate DNA backbone interactions) or DNA sequence-specific (protein-base pair interactions) (51). The inhibition of nuclear extract induced electrophoretic mobility of biotinylated wild type DNA with variant alleles homozygote DNA may suggest non-allele specific binding, however partial inhibition by an unrelated DNA PCR product may indicate partially specific interaction between wild type DNA and nuclear protein(s).

In addition to RegulomeDB, in silico analysis using PROMO software, 31 different transcription factors (TF) were predicted to be able to recognise putative binding sites including 12 SNPs. Five of them were able to bind to major allele variants only, and seven to minor variants only, whereas fourteen were predicted to be reactive independently of genotype. For example p53 was shown to possibly interact with both variants at rs7046516, rs7847422 and rs6537957. In contrast to other TFs, p53 DNA targets are not defined by a particular consensus sequence, but it is able to bind various DNA sequences and DNA targets defined by their secondary structures and the majority of p53 target structures are out with the promoter region [reviewed by Brazda and Fojta (52)]. Moreover, p53 was shown to interact with other TFs, like YY-1, which was predicted to interact at rs7040372, rs7847422 and rs6537962. This, among other things, makes the elucidation of the molecular basis of the interactions of the nuclear extract factors with the FCN2 3’UTR region more difficult.

To summarize, sequencing of the 3’UTR of the FCN2 gene in a relatively large cohort of preterm babies and a multiway in silico analysis allowed us to find potential associations of certain polymorphic variants of that region with common adverse effects of prematurity. Furthermore, some polymorphisms were demonstrated to affect ficolin-2 concentration in cord serum, although the associations mentioned may reflect linkage disequilibrium with promoter/coding region SNP. The 3’UTR polymorphism can be also involved in nuclear protein binding.

Funding

This work was funded by National Science Centre, Poland, grant 2015/17/B/NZ6/04250.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics statement

The studies involving human participants were reviewed and approved by Bioethics Committee of The Karol Marcinkowski Poznań University of Medical Sciences; Independent Bioethics Committee for Scientific Research at Medical University of Gdańsk; Bioethics Committee of The Medical University of Łódź. Written informed consent to participate in this study was provided by the participants’ legal guardian/next of kin.

Author contributions

AŚ coordinated project realisation, designed the study, planned and supervised experimental work, determined ficolin-2 concentrations, sequenced FCN2 gene 3’UTR and determined SNP at -986/-602, analyzed experimental data. DJ and MMi designed the procedure for FCN2 gene 3’UTR sequencing and produced corresponding data. DJ determined SNP using TaqMan probes; analyzed haplotypes and preformed EMSA experiments. GG determined SNP at -64/-4/+6359/+6424 and performed EMSA experiments. AS-P analyzed diplotypes. KC, PK, MK-B, and KS were responsible for patients’ qualification, taking and collecting samples as well as collecting clinical data. JM, ID-P, and JK supervised qualification and recruitment of patients and analysis of clinical data. MMa and HS provided anti-ficolin-2 mAbs for initial experiments, contributed to modification of the procedure and discussed corresponding data. DK contributed to the study design and data analysis. MC contributed to the study design, supervision of experimental work, analyzed haplotypes and performed statistical analysis. Draft manuscript was written by AŚ, DJ, and MC, and revised by DK and MC. All authors contributed to the article and approved the submitted version.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2021.741140/full#supplementary-material

References

  • 1

    SorensenCARosbjergAJensenHBKrogfeltKAGarredP. The Lectin Complement Pathway is Involved in Protection Against Enteroaggregative Escherichia Coli Infection. Front Immunol (2018) 9:1153. doi: 10.3389/fimmu.2018.01153

  • 2

    BidulaSSextonDWAbdolrasouliAShahAReedAArmstrongJDet al. The Serum Opsonin L-Ficolin is Detected in Lungs of Human Transplant Recipients Following Fungal Infections and Modulates Inflammation and Killing of Aspergillus Fumigatus. J Infect Dis (2015) 212:234–46. doi: 10.1093/infdis/jiv027

  • 3

    LuoFSunXWangYWangQWuYPanQet al. Ficolin-2 Defends Against Virulent Mycobacteria Tuberculosis Infection In Vivo, and Its Insufficiency is Associated With Infection in Humans. PloS One (2013) 8(9):e73859. doi: 10.1371/journal.pone.0073859

  • 4

    SosoniukEVallejosGKenawyHGaboriaudCThielensNFujitaTet al. Trypanosoma Cruzi Calreticulin Inhibits the Complement Lectin Pathway Activation by Direct Interaction With L-Ficolin. Mol Immunol (2014) 60:80–5. doi: 10.1016/j.molimm.2014.03.014

  • 5

    KrarupASorensenUBMatsushitaMJenseniusJCThielS. Effect of Capsulation of Opportunistic Pathogenic Bacteria on Binding of the Pattern Recognition Molecules Mannan-Binding Lectin, L-Ficolin, and H-Ficolin. Infect Immun (2005) 73:1052–60. doi: 10.1128/IAI.73.2.1052-1060.2005

  • 6

    MaYGChoMYZhaoMParkJWMatsushitaMFujitaTet al. Human Mannose-Binding Lectin and L-Ficolin Function as Specific Pattern Recognition Proteins in the Lectin Activation Pathway of Complement. J Biol Chem (2004) 279:25307–12. doi: 10.1074/jbc.M400701200

  • 7

    LynchNJRoscherSHartungTMorathSMatsushitaMMaennelDNet al. L-Ficolin Specifically Binds to Lipoteichoic Acid, a Cell Wall Constituent of Gram-Positive Bacteria, and Activates the Lectin Pathway of Complement. J Immunol (2004) 72:1198–202. doi: 10.4049/jimmunol.172.2.1198

  • 8

    ŚwierzkoASBartłomiejczykMABrzostekAŁukasiewiczJMichalskiMDziadekJet al. Mycobacterial Antigen 85 Complex (Ag85) as a Target for Ficolins and Mannose-Binding Lectin. Int J Med Microbiol (2016) 306:212–21. doi: 10.1016/j.ijmm.2016.04.004

  • 9

    HarumiyaSTakedaKSuquiraTFukumotoYTachikawaHMiyazonoKet al. Characterization of Ficolins as Novel Elastin-Binding Proteins and Molecular Cloning of Human Ficolin-1. J Biochem (1996) 120:745–51. doi: 10.1093/oxfordjournals.jbchem.a021474

  • 10

    JacquetMLacroixMAnceletSGoutEGaboriaudChThielensNMet al. Deciphering Complement Receptor Type 1 Interactions With Recognition Proteins of the Lectin Pathway. J Immunol (2013) 190:3721–31. doi: 10.4049/jimmunol.1202451

  • 11

    ZhangJKhJLuJThielSLeongBSHSethiSet al. Local Inflammation Induces Complement Crosstalk Which Amplifies the Antimicrobial Response. PloS Pathog (2009) 5:e1000282. doi: 10.1371/journal.ppat.1000282

  • 12

    MaYJDoniAHummeshojTHonoreCBastoneAMantovaniAet al. Synergy Between Ficolin-2 and Pentraxin 3 Boots Innate Immune Recognition and Complement Deposition. J Biol Chem (2009) 284:28263–75. doi: 10.1074/jbc.M109.009225

  • 13

    JensenMLHonoreCHummeshojTHansenBEMadsenHOGarredP. Ficolin-2 Recognizes DNA and Participates in the Clearance If Dying Host Cells. Mol Immunol (2007) 44:856–65. doi: 10.1016/j.molimm.2006.04.002

  • 14

    EndoYSatoYMatsushitaMFujitaT. Cloning and Characterization of the Human Lectin P35 Gene and Its Related Gene. Genomics (1996) 36:515–21. doi: 10.1006/geno.1996.0497

  • 15

    HummelshojTMunthe-FogLMadsenHOFujitaTMatsushitaMGarredP. Polymorphisms in the FCN2 Gene Determine Serum Variation and Function of Ficolin-2. Hum Mol Genet (2005) 14:1651–8. doi: 10.1093/hmg/ddi173

  • 16

    KilpatrickDCŚwierzkoAMatsushitaMDomżalska-PopadiukIBorkowska-KłosMSzczapaJet al. The Relationship Between FCN2 Geneotypes and Serum Ficolin-2 (L-Ficolin) Protein Concentrations From a Large Cohort of Neonates. Hum Immunol (2013) 74:867–71. doi: 10.1016/j.humimm.2013.04.011

  • 17

    Munthe-FogLHummelshojTHansenBEKochCMadsenHOSkjodtKet al. The Impact of FCN2 Polymorphisms and Haplotypes on the Ficolin-2 Serum Levels. Scand J Immunol (2007) 65:383–92. doi: 10.1111/j.1365-3083.2007.01915.x

  • 18

    CedzynskiMNuytinckLAtkinsonAPSwierzkoAZemanKSzemrajJet al. Extremes of L-Ficolin Concentration in Children With Recurrent Infections Are Associated With Single Nucleotide Polymorphisms in the FCN2 Gene. Clin Exp Immunol (2007) 50:99104. doi: 10.1111/j.1365-2249.2007.03471.x

  • 19

    ŚwierzkoAAtkinsonAPMCedzyńskiMMacDonaldSLSzalaADomżalska-PopadiukIet al. Two Factors of the Lectin Pathway of Complement, L-Ficolin and Mannan-Binding Lectin, and Their Associations With Prematurity, Low Birthweight and Infections in a Large Cohort of Polish Neonates. Mol Immunol (2009) 46:551–8. doi: 10.1016/j.molimm.2008.07.025

  • 20

    TroldborgAHansenAHansenSKWJenseniusJCStengaard-PedersenKThielS. Lectin Complement Pathway Proteins in Healthy Individuals. Clin Exp Immunol (2017) 188:138–47. doi: 10.1111/cei.12909

  • 21

    FaikISegunIOyedejiAZulkarnainIde Messias-ReasonIJLellBet al. Ficolin-2 Levels and Genetic Polymorphisms of FCN2 in Malaria. Hum Immunol (2011) 72:74–9. doi: 10.1016/j.humimm.2010.10.003

  • 22

    TakYGFarnhamPJ. Making Sense of GWAS: Using Epigenomics and Genome Engineering to Understand the Functional Relevance of SNPs in Noncoding Regions of the Human Genome. Epigenet Chromatin (2015) 8:57. doi: 10.1186/s13072-015-0050-4

  • 23

    MoszyńskaAGebertMCollawnJFBartoszewskiR. SNP in microRNA Target Sites and Their Potential Role in Human Disease. Open Biol (2017) 7:170019. doi: 10.1098/rsob.170019

  • 24

    LiuYZhaoEZhuLZhangDWangZ. 3’UTR Polymorphisms in NRAMP1 Are Associated With the Susceptibility to Pulmonary Tuberculosis: A MOOSE-Compliant Meta-Analysis. Med (Baltimore) (2019) 98:e15955. doi: 10.1097/MD.0000000000015955

  • 25

    SyBTHoanNXTongHVMeyerCGToanNLSongLHet al. Genetic Variants of Interferon Regulatory Factor 5 Associated With Chronic Hepatitis B Infection. World J Gastoenterol (2018) 24:248–56. doi: 10.3748/wjg.v24.i2.248

  • 26

    FukusakiTOharaNHaraYYoshimuraAYoshiuraK. Evidence for Association Between a Toll-Like Receptor 4 Gene Polymorphism and Moderate/Severe Periodontitis in the Japanese Population. J Periodontal Res (2007) 42:541–5. doi: 10.1111/j.1600-0765.2007.00979.x

  • 27

    GanLHuCDengZLuHSunJPengGet al. Rs1982809 is a Functional Biomarker for the Prognosis of Severe Post-Traumatic Sepsis and MODs. Exp Biol Med (Maywood) (2019) 244:1438–45. doi: 10.1177/1535370219880490

  • 28

    ZanettiKAHaznadarMWelshJARoblesAIRyanBMMcClaryACet al. 3’-UTR and Functional Secretor Haplotypes in Mannose-Binding Lectin-2 Are Associated With Increased Colon Cancer Risk in African Americans. Cancer Res (2012) 72:1467–77. doi: 10.1158/0008-5472.CAN-11-3073

  • 29

    ŚwierzkoASMichalskiMSokołowskaANowickiMEppaŁSzala-PoździejAet al. The Role of Complement Activating Collectins and Associated Serine Proteases in Patients With Hematological Malignancies, Receiving High-Dose Chemotherapy, and Autologous Hematopoietic Stem Cell Transplantations (Auto-HSCT). Front Immunol (2018) 9:2153. doi: 10.3389/fimmu.2018.02153

  • 30

    YanSSunRWuSJinTZhangSNiuFet al. Single Nucleotide Polymorphism in the 3’untranslated Region of LPP Is a Risk Factor for Lung Cancer: A Case-Control Study. BMC Cancer (2019) 19:35. doi: 10.1186/s12885-018-5241-5

  • 31

    LiDSunYKongXLuanCYuYChenFet al. Association Between a Single Nucleotide Polymorphism in the 3’UTR of ARGHEF18 and the Risk of Nonidiopathic Pulmonary Arterial Hyportension in Chinese Population. Dis Markers (2018) 2018:2461845. doi: 10.1155/2018/2461845

  • 32

    MetzgerMLMichelfelderIGoldackerSMekaouiKLiztmanJGuzmanDet al. Low Ficolin-2 Levels in Common Variable Immunodeficiency Patients With Bronchiectasis. Clin Exp Immunol (2015) 179:256–64. doi: 10.1111/cei.12459

  • 33

    SzalaAŚwierzkoACedzyńskiM. Cost-Effective Procedures for Genotyping of Human FCN2 Gene Single Nucleotide Polymorphisms. Immunogenetics (2013) 65:439–46. doi: 10.1007/s00251-013-0696-7

  • 34

    ŚwierzkoASMichalskiMSokołowskaANowickiMSzala-PoździejAEppaŁet al. Associations of Ficolins With Haematological Malignancies in Patients Receiving High-Dose Chemotherapy and Autologous Hematopoietic Stem Cell Transplantations. Front Immunol (2020) 10:3097. doi: 10.3389/fimmu.2019.03097

  • 35

    MaqboolSNNazeerHSRafiqMJavedAHanifR. Bridging the Gap by Discrerning SNPs in Linkage Disequilibrium and Their Role in Breast Cancer. Gene (2018) 679:4456. doi: 10.1016/j.gene.2018.06.102

  • 36

    BoyleAPHongELHariharanMChengYSchaubMAKasowskiMet al. Annotation of Functional Variation in Personal Genomes Using RegulomeDB. Genome Res (2012) 22:1790–7. doi: 10.1101/gr.137323.112

  • 37

    CedzynskiMAtkinsonAPSwierzkoAMacDonaldSLSzalaAZemanKet al. L-Ficolin (Ficolin-2) Insufficiency Is Associated With Combined Allergic and Infectious Respiratory Disease in Children. Mol Immunol (2009) 47:415–9. doi: 10.1016/j.molimm.2009.08.028

  • 38

    KilpatrickDCChalmersJDMacDonaldSLMurrayMMohammedAHartSPet al. Stable Bronchiectasis Is Associated With Low Serum L-Ficolin Concentrations. Clin Respir J (2009) 3:2933. doi: 10.1111/j.1752-699X.2008.00105.x

  • 39

    de Messias-ReasonIKremsnerPGKunJFJ. Functional Haplotypes That Produce Normal Ficolin-2 Levels Protect Against Clinical Leprosy. J Infect Dis (2009) 199:801–4. doi: 10.1086/597070

  • 40

    SzalaASawickiSŚwierzkoASSzemrajJŚniadeckiMMichalskiMet al. Ficolin-2 and Ficolin-3 in Woman With Malignant and Benign Ovarian Tumours. Cancer Immunol Immunother (2013) 62:1411–9. doi: 10.1007/s00262-013-1445-3

  • 41

    KasperkiewiczKEppaŁŚwierzkoASBartłomiejczykMAŻuberZMSiniewicz-LuzeńczykKet al. Lectin Pathway Factors in Patients Suffering From Juvenile Idiopathic Arthritis. Immunol Cell Biol (2017) 95:666–75. doi: 10.1038/icb.2017.31

  • 42

    SokołowskaAŚwierzkoASGajekGGołosAMichalskiMNowickiMet al. Associations of Ficolins and Mannose-Binding Lectin With Acute Myeloid Leukemia in Adults. Sci Rep (2020) 10:10561. doi: 10.1038/s41598-020-67516-2

  • 43

    NingXZhangW. PTX3 Gene 3’UTR Polymorphism and its Interaction With Environmental Factors With the Risk of Preeclampsia in a Chinese Han Population. Med (Baltimore) (2020) 99:e18740. doi: 10.1097/MD.0000000000018740

  • 44

    DoiKNoiriENakaoAFujitaTKobayashiSTokunagaK. Functional Polymorphisms in the Vascular Endothelial Growth Factor Gene are Associated With Development of End-Stage Renal Disease in Males. Am Soc Nephrol (2006) 17:823–30. doi: 10.1681/ASN.2005010094

  • 45

    Dabrowska-ZamojcinECzerewatyMMalinowskiDTarnowskiMSluczanowska-GlabowskaSDomanskiLet al. Ficolin-2 Gene Rs785196 Polymorphism Is Associated With Delayed Graft Function and Acute Rejection in Kidney Allograft Recipients. Arch Immunol Ther Exp (2018) 66:6572. doi: 10.1007/s00005-017-0475-5

  • 46

    GiangNTTongHVNghiaTHHungHVAnhDTNamLVet al. Association of FCN2 Polymorphisms and Ficolin-2 Levels With Dengue Fever in Vietnamese Patients. Int J Infect Dis (2020) 95:253–61. doi: 10.1016/j.ijid.2020.02.029

  • 47

    Van KempenHMeijvisSEndemanHVlaminckxBMeekBde JongBet al. Mannose-Binding Lectin and L-Ficolin Polymorphisms in Patients With Community-Acquired Pneumonia Caused by Intracellular Pathogens. Immunology (2017) 151:81–8. doi: 10.1111/imm.12705

  • 48

    AssafAVan HoangTFaikIAebischerTKremsnerPGKunJFJet al. Genetic Evidence of Functional Ficolin-2 Haplotypes as Susceptibility Factor in Cutaneous Leishmaniasis. PloS One (2012) 7(3):e34113. doi: 10.1371/journal.pone.0034113

  • 49

    BronkhorstMWGALomaxMAZVossenRHAMBakkerJPatkaPvan LieshoutEMM. Risk of Infection and Sepsis in Severely Injured Patients Related to Single Nucleotide Polymorphisms in the Lectin Pathway. Br J Surg (2013) 100:1818–26. doi: 10.1002/bjs.9319

  • 50

    SirisenaNDSamaranayakeNDissanayakeVHW. Electrophoretic Mobility Shift Assays Implicate XRCC2: Rs3218559c>T as a Potential Low-Penetrant Susceptibility Allele for Sporadic Breast Cancer. BMC Res Notes (2019) 12:476. doi: 10.1186/s13104-019-4512-9

  • 51

    BatabyalSChoudhurySSaoDMondolTPalSK. Dynamical Perspective of Protein-DNA Interaction. Biomol Concepts (2014) 5:2143. doi: 10.1515/bmc-2013-0037

  • 52

    BrazdaVFojtaM. The Rich World of P53 DNA Binding Targets: The Role of DNA Structure. Int J Mol Sci (2019) 20:5605. doi: 10.3390/ijms20225605

Summary

Keywords

3’UTR, ficolin-2, FCN2, newborn, prematurity

Citation

Świerzko AS, Jarych D, Gajek G, Chojnacka K, Kobiela P, Kufelnicka-Babout M, Michalski M, Sobczuk K, Szala-Poździej A, Matsushita M, Mazela J, Domżalska-Popadiuk I, Kilpatrick DC, Kalinka J, Sekine H and Cedzyński M (2021) Polymorphisms of the FCN2 Gene 3’UTR Region and Their Clinical Associations in Preterm Newborns. Front. Immunol. 12:741140. doi: 10.3389/fimmu.2021.741140

Received

27 July 2021

Accepted

12 October 2021

Published

28 October 2021

Volume

12 - 2021

Edited by

Attila Mócsai, Semmelweis University, Hungary

Reviewed by

Jiayi Qu, University of California, Davis, United States; Ying Jie Ma, Copenhagen University Hospital, Denmark

Updates

Copyright

*Correspondence: Maciej Cedzyński,

†These authors have contributed equally to this work and share first authorship

This article was submitted to Autoimmune and Autoinflammatory Disorders, a section of the journal Frontiers in Immunology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics