ORIGINAL RESEARCH article

Front. Immunol., 19 January 2023

Sec. Comparative Immunology

Volume 13 - 2022 | https://doi.org/10.3389/fimmu.2022.1099637

Endoplasmic reticulum-associated protein degradation contributes to Toll innate immune defense in Drosophila melanogaster

  • 1. Center for Developmental Biology, School of Life Sciences, Anhui Agricultural University, Hefei, Anhui, China

  • 2. School of Preclinical Medicine, Wannan Medical College, Wuhu, Anhui, China

  • 3. Center for Biological Technology, Anhui Agricultural University, Hefei, Anhui, China

  • 4. Université de Strasbourg, Centre National de la Recherche Scientifique (CNRS), Insect Models of Innate Immunity (M3I; UPR9022), Strasbourg, France

  • 5. Institut de Génétique et de Biologie Moléculaire et Cellulaire, Illkirch, France

Abstract

In Drosophila, the endoplasmic reticulum-associated protein degradation (ERAD) is engaged in regulating pleiotropic biological processes, with regard to retinal degeneration, intestinal homeostasis, and organismal development. The extent to which it functions in controlling the fly innate immune defense, however, remains largely unknown. Here, we show that blockade of the ERAD in fat bodies antagonizes the Toll but not the IMD innate immune defense in Drosophila. Genetic approaches further suggest a functional role of Me31B in the ERAD-mediated fly innate immunity. Moreover, we provide evidence that silence of Xbp1 other than PERK or Atf6 partially rescues the immune defects by the dysregulated ERAD in fat bodies. Collectively, our study uncovers an essential function of the ERAD in mediating the Toll innate immune reaction in Drosophila.

Introduction

Innate immunity is the first line of the defense for the host against invasion with foreign pathogenic microorganisms (, ). Upon activation of the pattern recognition receptors (PRRs) through sensing distinct pathogen-associated molecular patterns (PAMPs), a series of innate immune signaling pathways entail complex downstream cascades to evoke the synthesis of multiple pro-inflammatory cytokines contributing to defeating the invading pathogens (). Up to date, a large body of pioneering studies have highlighted the importance of the precise control of these signals, as defective or over-excessive innate immune response routinely trigger the occurrences of autoimmune disease, allergic reaction, and even cancer (). Unraveling the molecular mechanisms of how innate immune signaling pathways are dynamically modulated has always been one of the hotspots in the basic immunology research.

Over the last decades, Drosophila melanogaster has served as one of the fundamental animal models for studying the regulatory mechanisms of the host innate immune reaction. In Drosophila, the innate immune defense is mainly dominated by two classical nuclear factor-kappa B (NF-κB)-related signaling pathways, namely the Toll and the immune deficiency (IMD) pathways, which rely on their productions of various antimicrobial peptides (AMPs) to function as anti-infective agents (, ). The Drosophila Toll pathway receptors are normally activated following infection of fungi or some types of Gram-positive bacteria. This activation further induces signal transductions involving factors including Myd88, pelle, as well as tube, and ultimately the phosphorylation of cactus, releasing the transcription factor Dif/dorsal into the nucleus to direct the production of a series of AMPs, such as Drosomycin (Drs) and Metchnikowin (Mtk) (, ). The IMD signaling pathway is typically activated post challenging of most Gram-negative bacteria or some species of Gram-positive bacteria, controlling the expression of an alternative set of AMPs such as Attacin (Att) and Diptericin (Dpt) (, ). In particular, both signaling pathways have been demonstrated to be precisely controlled by a large body of modulators. For instance, ubiquitination modification plays a pivotal role in Imd signaling transduction and leveling off (), thus contributing to its homeostasis. While ubiquitin-involved cascade in the Toll pathway mediation was previously thought to be relatively rare, recent findings have been shedding light on this issue (, ).

In an effort to uncover novel regulators of the fly Toll pathway, we adopted the widely-used drosomycin promoter-luciferase (Drs-Luc) reporter system and performed an unbiased screening of various genes in Drosophila S2 cells. Of interest, we found that silence of Septin-interacting protein 3 (Sip3, also known as Hrd1) resulted in marked reduction in the Toll signaling activities (Figure S1A), implying that Sip3 is potentially a positive contributor of the Toll pathway. Previous literature has revealed that Sip3 is a multiplexed transmembrane protein in the endoplasmic reticulum (ER) behaving as an E3 ubiquitin ligase (). The predominant function of Sip3 is to catalyze the degradation of misfolded/unfolded proteins in the ER via specifically accepting ubiquitin from the ER-associated E2 enzyme and transferring it to the substrate to facilitate its degradation (known as ER-associated degradation, ERAD) (, ). We therefore hypothesized that the Sip3-involved ERAD is probably essential for the Toll-mediated innate immune defense in Drosophila.

In this study, we demonstrate a critical role of the ERAD in regulating fly innate immunity. We show that blockade of the ERAD cascade in Drosophila fat bodies results in reduced inductions of the Toll downstream AMPs upon Gram-positive bacterial challenging. We further provide a series of evidence that the ERAD is required for the host resistance against various pathogenic microbes. Additionally, our proteomic and genetic results imply that the dysregulated ERAD leads to abnormal accumulation of Me31B, which may further negatively contribute to the Toll innate immune defense primarily in an Xbp1-dependent manner. Overall, our studies shed lights on an essential role of the ERAD in modulating the Toll innate immunity in Drosophila.

Results

Sip3 is engaged in regulating the Toll innate immune response in Drosophila

In order to investigate whether the E3 ligase Sip3 is involved in controlling Drosophila Toll innate immune response in vivo, we infected Sip3 loss-of-function (LOF) mutant flies (Sip31, isogenized with w1118) and the controls (w1118 as the wild-type control and MyD88KG03447 homozygote as the positive control) with Enterococcus faecalis (E. faecalis), a type of Gram-positive bacteria that has been widely utilized to activate the Toll signaling pathway in flies. The reverse transcription plus quantitative polymerase chain reaction (RT-qPCR) assays were performed to monitor the transcript levels of the Toll downstream AMPs, including Drs and Mtk. As illustrated in Figures 1A, B, loss of Sip3 resulted in marked decreases in the mRNA levels of both Drs (by ~42%) and Mtk (by ~51%) upon bacterial challenging, which is consistent with what we found in S2 cells (Figure S1A). Of note, similar results were obtained (Figures 1C, D) when flies were challenged with another type of Gram-positive bacteria Staphylococcus aureus (S. aureus).

Figure 1

To test whether Sip3 modulates Toll signaling through its potential role in the fat body, which is the dominant immune organ/tissue of flies during systemic infection, we adopted two different Sip3 RNAi strains (see Materials and Methods) and crossed them with c564-gal4 to produce progenies with fat body-specific down-regulation of Sip3. The tub-gal80ts was utilized in our experimental system to carry out RNAi of Sip3 at adult stage. The RNAi efficiency in those Sip3 RNAi progenies (referred as c564ts>Sip3 RNAi #1 and c564ts>Sip3 RNAi #2) was tested by Western blot using anti-Sip3 antibody (Figures 1E, F). Further, these flies were infected with E. faecalis and subjected to RT-qPCR as described above. As illustrated in Figures 1G, H, silencing Sip3 reduced the transcript levels of both Drs (by ~23% to 35%) and Mtk (by ~25% to 28%) relative to those in the controls (c564ts>+). Moreover, ectopic expression of Sip3 in the fat body reversed the reductions in Drs and Mtk transcript levels by loss of Sip3 upon infection (Figures 1I, J), implying that the E3 ligase Sip3 controls the activation of Toll signaling post bacterial stimuli primarily through its essential role in the fat body. Notably, we failed to observe any apparent alterations in the context of pathogen-driven inductions of the Toll downstream AMPs in the c564>Sip3 flies, compared to those in the controls (Figures 1I, J).

A detailed understanding of the physiological function of Sip3 in regulating the host innate immune defense was achieved by analyzing the fly survival post infection of E. faecalis or S. aureus, as Sip3 LOF mutants were more susceptible to both pathogens than the wild-type flies (Figures 2A–C). Further, we quantified the amounts of bacteria present in the flies at various time points post infection (0, 6, and 12h, respectively). Much higher levels of colony-forming units (CFU) were observed in the samples of Sip3 LOF mutants (increased on average by more than 1-fold), relative to those in the control samples (Figures 2D, E), implying that Sip3 defective flies are less capable of scavenging pathogenic microorganisms. Similar results were obtained when we performed infection experiments with E. faecalis utilizing Sip3 RNAi and the control flies (Figures S2A, B).

Figure 2

In summary, our results indicate that E3 ligase Sip3 plays a crucial role in the Toll innate immune defense in fruit flies.

Sip3 is dispensable for impacting the IMD immune reaction in Drosophila

In Drosophila, the humoral immune defense is principally governed by two signaling pathways, namely the Toll and the IMD pathways (). It is thus reasonable to explore whether Sip3 is as well involved in regulating the fly IMD innate immunity. To this end, an alternative set of infection experiment was conducted utilizing the Erwinia carotovora carotovora 15 (Ecc15), a type of broadly-used Gram-negative bacteria activating the IMD pathway in flies. Unfortunately, we hardly detected apparent alterations in the contexts of host survival (Figure 2F) and IMD downstream AMP inductions (Figures 2G, H), between those of the Sip3 LOF mutants and the wild-type controls upon Ecc15 injection. Collectively, our data endorse the notion that Sip3 is required for the Toll but not the IMD innate immune reaction in Drosophila.

ERAD is essential for Drosophila Toll innate immune defense

As mentioned in the Introduction, Sip3 has been demonstrated to be responsible for the degradation of misfolded/unfolded proteins accumulated in the ER following a range of stresses (for instance metabolic dysfunction, excessive accumulation of reactive oxygen species, infection, etc.), a process known as ERAD (, ). We then sought to investigate whether other components of the ERAD also participate in affecting fly innate immunity, which is analogous to Sip3. To do this, we again debited the c564ts system to obtain flies with fat body-specific RNAi of Hrd3, Derlin-1, or Herp, which encode pivotal elements of the fly ERAD cascade (, ). As shown in Figures 3A, B, silence of Hrd3, Derlin-1, or Herp resulted in marked abatements (by ~34% to 58%) in the inductions of Drs and Mtk post bacterial stimuli. Accordingly, the c564ts>Hrd3 RNAi, c564ts>Derlin-1 RNAi, and c564ts>Herp RNAi flies were more sensitive to the injected E. faecalis and S. aureus (Figures 3C–E) but not Ecc15 (Figure 3F) with respective to the controls. Taken together, our results support the notion that the ERAD is responsible for the Drosophila Toll innate immune defense upon bacterial infection.

Figure 3

ERAD regulates Toll-mediated innate immune response largely via Me31B

We next sought to address how the ERAD is implicated in impacting the innate immune defense in Drosophila. A proteomic analysis was performed using dissected fat bodies from c564ts>Sip3 RNAi and the control flies following bacterial injection (Supplementary Table 1). Whereas over 1500 proteins/peptides were identified in this assay, the majority (more than 95%) of them overlapped in both samples (Figure 4A), implying that the E3 ligase Sip3 is of low potential for silencing or evoking gene expression. The fact that knockdown of Sip3 in S2 cells certainly leads to a reduction in Toll signaling activity (Figure S1A) makes us assume that when Sip3 is silenced, one (or possibly more) pivotal factors of the Toll pathway is dysregulated. However, we failed to observe any significant differences when we compared the appearances of protein/peptide of Myd88, pll, tube, cactus, dorsal, and Dif from both samples (Figure S3A), even though the Toll downstream effectors (e.g. BaraA2, Drs, Mtk, IM1) were markedly reduced by Sip3 RNAi (Figure S3B). Thus, we reasoned that the Sip3-mediated ERAD likely engage in an indirect way to modulate the fly Toll pathway.

Figure 4

Since blockade of the ERAD leads to accumulation of misfolded/unfolded proteins, we thus prioritized higher existences of proteins/peptides present in the Sip3 RNAi flies, as we hypothesized that they are probably the key to the deregulated Toll signaling. Based upon the data from the proteomic analysis, only around 70 proteins/peptides out of the ~1500 were significantly increased (by more than 2-fold) by down-regulation of Sip3 (Figure 4B). Gene ontology (GO) analysis upon the increased proteins/peptides indicated that the top 3 categories regarding their molecular functions were 1) catalytical activity, 2) ion binding, and 3) hydrolase activity (Figure 4C).

We first focused on the top 10 increased proteins/peptides (including Cbp80, Kat60, Arts, Tango1, Cpb, LManV, Me31B, Vasa, CG7900, and CG31974). They were barely detectable in the control samples, whereas they enormously accumulated in the Sip3 RNAi fat bodies. Among these, Tango1 and Me31B are the only two candidates considered to be ER-related proteins (, ), allowing us to postulate that they are likely under the control of the ERAD and play potential roles in the ERAD-mediated innate immunity of Drosophila. To test this assumption, we used Tango1 RNAi and Me31B RNAi flies for genetic manipulations. We observed that the induction of Drs or Mtk post bacterial infection was not affected by knockdown of Tango1 or Me31B in fat bodies (Figures 4D, E). However, double knock down of Me31B and Sip3 restored the induction of the Toll pathway-regulated AMPs, and this was not observed in the case of Tango1 and Sip3 double RNAi (Figures 4D, E). Pioneering studies have demonstrated that Drosophila Me31B is a putative DEAD-box helicase, which is functionally involved in protein translation and mRNA decay through a set of associations with other adaptor proteins (). Consistently, when we looked at the fly survival post infection of E. faecalis or S. aureus, we found that the low resistances to bacterial infection in Sip3 RNAi flies were profoundly elevated by Me31B RNAi (Figures 4F–H). Moreover, loss of Me31B also prevented the passive impacts on bacteria-driven AMP inductions by RNAi of Hrd3, Derlin-1, or Herp (Figures 4I, J). Taken together, our results indicate that the ERAD contributes to the Toll innate immune defense to a large extent in an Me31B-dependent manner in Drosophila.

Silence of Xbp1 partially rescues the phenotype of Sip3 mutants

Our next aim is to explore how accumulation of Me31B negatively impacts on Toll signaling. It is reported that the accumulated misfolded/unfolded proteins on ER can be recognized by diverse stress sensors, namely inositol acquisition enzyme-1 (IRE1), double-stranded RNA-activated protein kinase-like ER kinase (PERK), and/or activated transcription factor 6 (ATF6), in a manner that leads to the activation of specific signaling cascades (referred to as unfolded protein response to ER, UPRER) (, ). We thereby sought to determine whether the stockpiled Me31B by the ERAD dysfunction is responsible for the activation of UPRER, which passively impacts on the Toll innate immune pathway. Indeed, we observed an elevated mRNA occurrence of Xbp1RB (generated by splicing of Xbp1 mRNA) and PERK in the Sip3 RNAi fat bodies (Figures S4A, B), implicating that activation of UPRER in the fly fat bodies with the ERAD blockade. Notably, we detected decreased transcript levels of both Drs and Mtk in the Sip3 RNAi samples relative to those in the control (Figures S4C, D). In addition, we obtained flies with fat body-specific RNAi of Sip3 combined with Xbp1, PERK, or Atf6 RNAi and conducted infection experiments. As illustrated in Figures 5A, B, down regulation of PERK or Atf6 was dispensable for affecting the Sip3 RNAi-mediated decrease of Drs or Mtk induction following E. faecalis infection. However, loss of Xbp1 partially rescued the reduced transcript levels of Drs and Mtk in the Sip3 RNAi flies upon challenging. Regarding fly survival, we observed that the Xbp1 and Sip3 double RNAi flies were more resistant to both E. faecalis and S. aureus than flies with Sip3 RNAi alone (Figures 5C–E), implying an epistatic relationship between Xbp1 and Sip3 in modulating the fly innate immunity.

Figure 5

To obtain additional genetic evidence, we generated Hrd3, Derlin-1, or Herp RNAi flies together with Xbp1 RNAi. When these flies were challenged with E. faecalis, we obtained similar results with respect to the inductions of AMPs (Figures 5F, G). Further, we subjected flies with fat body specific down regulation or ectopic expression of Xbp1 to bacterial infection. We observed remarkable reduction in the inductions of Drs and Mtk in the c564ts>Xbp1-EGFP flies, although it was not the case in the c564ts>Xbp1 RNAi samples (Figures 5H, I). Since Xbp1 mainly functions as a transcription factor governing expression of downstream targets (, ), it is probably that one/some factor(s) of the Toll pathway is/are under the control of Xbp1. Ultimately, our data point to a working model in which the accumulated Me31B in the ERAD defective flies largely relies on the Xbp1-involved axis of the UPRER pathway to antagonize the Toll innate immune defense (Figure 5J).

Discussion

ER has been well known for its fundamental importance in the proper post-translational modification and folding of proteins (). Nevertheless, it is constantly challenged by diverse pathological insults and/or physiological defects, which may lead to ER dysfunction and the accumulation of some misfolded/unfolded proteins in ER (, ). As an E3 ligase, Drosophila Sip3 harbors a critical action in the ubiquitination and degradation of misfolded/unfolded ER proteins (also known as ERAD) (), thus positively contributing to the maintenance of ER homeostasis to ensure its function. In flies, the Sip3-involved ERAD on retinal degeneration has been well established (), yet whether it fulfils a role in innate immune modulation remains elusive. In the present study, we observed remarkably reduced induction of the Toll downstream AMPs and increased mortality in the Sip3 LOF mutants following bacterial infection. Importantly, ectopic expression of Sip3 in fat bodies almost fully rescued the Sip3 LOF mutant phenotypes in our experimental system. Further, we provided a series of genetic evidence suggesting that the ERAD is involved in governing the Toll innate immune defense. Our study provides a potential functional linkage between ER homeostasis and innate immunity in Drosophila.

How does the ERAD positively contribute to modulating the Toll innate immune defense? Despite our proteomic analyses revealing an increase of a series of proteins/peptides that are primarily involved in several pathways in the Sip3 RNAi fat body cells, it appears that none of the crucial factors of the canonical Toll pathway is altered. We therefore shifted our attention unbiasedly to the most increased proteins/peptides (top10) and focused on the proteins shown to be localized in ER, because Sip3 plays a critical role in the ERAD. Between the two potential candidates (Me31B and Tango1 in our study), we identified that Me31B is likely the major downstream effector in the ERAD-mediated Toll innate immune defense, as silencing Me31B nearly completely reverses the innate immune defects in the Sip3, Hrd3, Derlin-1, or Herp RNAi flies. Nonetheless, our current data cannot address whether the accumulated Me31B is misfolded/unfolded and if so, how the E3 ligase Sip3 promotes its ubiquitination and degradation. It would be worthwhile in the future to obtain a Me31B variant that could somehow mimic its misfolding/unfolding pattern and to inspect its effect in the fly innate immune regulation.

Several lines of evidence have indicated that ERAD and UPRER can intersect to control ER homeostasis and relevant cellular processes (, , ). Interestingly, in blocking the Xbp1 axis of the UPRER, we observed a striking impact on the ERAD-involved Toll innate immune reaction, albeit the immune dysfunction in the ERAD-deficient flies cannot be entirely rescued by Xbp1 RNAi. One possibility is that the three UPRER signaling cascades could be somehow reciprocally interrelated under the current experimental conditions. Nevertheless, in accordance with our results, we would like to hypothesize that while the ERAD is blocked, bacterial stimuli possibly lead to excessive accumulation of unfolded/misfolded Me31B protein in ER, where it activates the Xbp1-involved UPRER to antagonize the Toll innate immune defense in flies (Figure 5J). In agreement with this model, we further observed that ectopic expression of Xbp1 in fat bodies markedly prevented the pathogen-driven induction of the Toll downstream AMPs, through a way in which we currently have no knowledge. As a reminder, ERAD has been proposed to be deployed for the clearance of proteins not only misfolded/unfolded (“quality” control), but also excessively abundant (“quantity” control) (). Indeed, several pioneering studies revealed that Me31B is abundant in variable types of ribonucleoprotein granules as a putative ATP-dependent RNA helicase for post-transcriptionally modulating specific target RNAs (, ). It would thus not be surprising if further studies demonstrate a functional utility of Me31B in correlating with and governing the fates of some mRNAs instrumental to the Drosophila Toll pathway.

Materials and methods

Fly strains

All flies were maintained under normal condition (12h light/12h dark, 65% humidity) with medium (6.65% cornmeal, 7.15% dextrose, 5% yeast, 0.66% agar, 2.2% nipagin, and 3.4 ml/l propionic acid). The c564-gal4;tub-gal80ts (c564ts) was used to allow gene manipulation in fat bodies at adult stage. The following strains were obtained from Bloomington Drosophila Stock Center: Sip31 (#86518), MyD88KG03447 (#14091), Me31B RNAi (#38923), Tango1 RNAi (#67887), and UAS-Xbp1-EGFP (#60730). The following strains were purchased from Vienna Drosophila RNAi Center: Sip3 RNAi 2# (#6870), Hrd3 RNAi (#1161), Derlin-1 RNAi (#44210), Herp RNAi (#11724), Xbp1 RNAi (#109312), PERK RNAi (#16427), and Atf6 RNAi (#36504). The Sip3 RNAi 1# (#TH01506.N) was obtained from Tsinghua Stock Center. The UAS-Sip3 strain was described previously ().

RT-qPCR assay

RT-qPCR assays were performed according to protocols described previously (). Briefly, whole flies (male) or dissected fat bodies were homogenized in the RNA-easy Isolation Reagent (Vazyme) using glass beads. Total RNA was extracted, followed by cDNA synthesis using the first-strand cDNA synthesis kit (Transgen) according to the manufacturer’s instructions. Quantitative PCR assays were performed using SYBR Green Mix (Transgen) in triplicate on a Bio-Rad iCycler iQ5 PCR Thermal Cycler. All results were normalized to the endogenous reference RpL32, which encodes the ribosomal protein Rp49. Primers used in RT-qPCR assays were shown as follows. RpL32-s: GCTAAGCTGTCGCACAAATG; RpL32-as: GTTCGATCCGTAACCGATGT; Drs-s: CGTGAGAACCTTTTCCAATATGATG; Drs-as: TCCCAGGACCACCAGCAT; Mtk-s: CAGTGCTGGCAGAGCCTCAT; Mtk-as: ATAAATTGGACCCGGTCTTG; Dpt-s: TTTGCAGTCCAGGGTCACCA; Dpt-as: CACGAGCCTCCATTCAGTCCAATCTCGG; CecA1-s: ACGCGTTGGTCAGCACACT; CecA1-as: ACATTGGCGGCTTGTTGAG; Xbp1RB-s: CAACCTTGGATCTGCCGCAGGG; Xbp1RB-as: CGCTCCAGCGCCTGTTTCCAG; PERK-s: CTGCGCAGTCTTCGGGACGG; PERK-as: AGCTGCTGAAGGTGCGGCTG.

Infection, survival rate and bacterial burden assays

Overnight bacterial cultures were harvested and diluted in sterile 1×PBS at a concentration of OD600 = 1. Indicated male flies were injected with 4.6nl of diluted bacteria or the same volume of PBS as controls. After infection, flies were immediately transferred to fresh vials (30-40 flies per vial) every day. For survival assays, the numbers of death were counted every day. Flies that died within 2h (< 5% of the total) after bacterial challenge were not considered in the analyses.

For bacterial burden assays, 10 flies were harvested, dipped in 75% EtOH and subsequently volatilized with EtOH on the fly pad for several minutes. Flies were then homogenized in 200μl of sterile 1×PBS. The ground homogenate was serially diluted and 100μl of each diluent was placed on LB agar. Plates were incubated in a 30°C culture hood overnight before counting the numbers of bacterial colonies.

Western blot assay

Western blot assays were performed as described previously (). In brief, fat bodies were lysed in lysis buffer (150mM NaCl, 50mM Tris-HCl, pH=7.4, 10% glycerol, 0.5% TritonX-100, and 1mM PMSF). Lysates were then centrifuged at 12,000rpm for 10min at 4°C. The supernatant was subjected to Western blot analysis. The Sip3 polyclonal antibody was generated by immunizing mice with purified GST-tagged Sip3527-626. The β-Tubulin antibody was purchased from Cowin (1:2000, Cat#CW0098M).

Proteomic analysis by LC-MS/MS

Proteomic analysis by LC-MS/MS was performed according to previously described method (). Briefly, Fat bodies were harvested from indicated flies in three independent biological replicates, followed by lysate preparation using lysis buffer (50mM Tris-HCl, pH=7.5, 150mM NaCl, 0.5% TritonX-100, 10% glycerol with 1mM PMSF). Samples were precipitated overnight with acetone on ice. Proteins/peptides were digested with Trypsin (Promega) and then desalted (PiecrceTMC-18 Spin Columns, Thermo) according to manufacturer’s instructions. Peptides were then subjected to LC-MS/MS assays. Resulting MS/MS data were processed using Thermo Proteome Discovery (version 1.4.1.14) and tandem mass spectra were searched against UniProt-Drosophila database.

Statistical analysis

All statistical analyses were performed by using GraphPad Prism 8. Data were shown as mean and standard errors. Statistical significance was determined by using the ANOVA or Mann-Whitney tests except for survival assays, in which the Log-Rank test (Kaplan-Meier method) was used for statistical analysis. The p value of less than 0.05 was considered statistically significant. *p < 0.05; **p < 0.01; ***p < 0.001; ns, not significant.

Statements

Data availability statement

The data presented in the study are deposited in the "Mendeley" repository (https://data.mendeley.com/datasets/6xbrt3n75v/1).

Author contributions

YZ, LL, QC, and SJ conceived and designed the experiments. YZ, LL, ChuZ, ChaZ, TH, RD, YJ, KS, YX, and QC performed the experiments. YZ, LL, and QC analyzed the data. YZ and LL performed statistical analyses. YZ, AG, QC, and SJ wrote the manuscript. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by grants from the National Natural Science Foundation of China (32100702) and the Anhui Provincial Natural Science Foundation (2008085J14).

Acknowledgments

We thank Bloomington Drosophila Stock Center, Vienna Drosophila RNAi Center, and Tsinghua Stock Center for the fly resources. We thank the staff members at Omics-Laboratory of the Biotechnology Centre of Anhui Agricultural University for providing technical supports in mass data collection.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2022.1099637/full#supplementary-material

References

Summary

Keywords

Sip3, Me31B, Xbp1, ERAD, Toll innate immune defense, Drosophila melanogaster

Citation

Zhu Y, Liu L, Zhang C, Zhang C, Han T, Duan R, Jin Y, Guo H, She K, Xiao Y, Goto A, Cai Q and Ji S (2023) Endoplasmic reticulum-associated protein degradation contributes to Toll innate immune defense in Drosophila melanogaster. Front. Immunol. 13:1099637. doi: 10.3389/fimmu.2022.1099637

Received

16 November 2022

Accepted

22 December 2022

Published

19 January 2023

Volume

13 - 2022

Edited by

Liang Jiang, Southwest University, China

Reviewed by

Ilias Kounatidis, The Open University, United Kingdom; Toshio Shibata, Kyushu University, Japan

Updates

Copyright

*Correspondence: Qingshuang Cai, ; Shanming Ji,

†These authors have contributed equally to this work

This article was submitted to Comparative Immunology, a section of the journal Frontiers in Immunology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics