Abstract
T cell development in the thymus is dependent on the thymic microenvironment, in which thymic epithelial cells (TECs) are the major component. However, TECs undergo both a qualitative and quantitative loss during aging, which is believed to be the major factor responsible for age-dependent thymic atrophy. FOXN1 plays a critical role in TEC development and adult TECs maintenance. We have previously reported that intrathymic injection of a recombinant (r) protein containing murine FOXN1 and a protein transduction domain increases the number of TECs in mice, leading to enhanced thymopoiesis. However, intrathymic injection may not be an ideal choice for clinical applications. In this study, we produced a rFOXN1 fusion protein containing the N-terminal of CCR9, human FOXN1 and a protein transduction domain. When injected intravenously into 14-month-old mice, the rFOXN1 fusion protein enters the thymus and TECs, and enhances thymopoiesis, resulting in increased T cell generation in the thymus and increased number of T cells in peripheral lymphoid organ. Our results suggest that the rFOXN1 fusion protein has the potential to be used in preventing and treating T cell immunodeficiency in older adults.
1 Introduction
Aging affects several organ systems, and the immune system is one of the systems most significantly affected (1, 2). The deleterious effects of aging on the immune system are well recognized as they lead to increased susceptibility to infection and cancer. In addition, the efficiency of vaccination is significantly reduced, limiting preventative prophylaxis.
The thymus is a specified immune organ that provides an inductive environment for the generation of T cells that play a critical role in the adaptive immune system. Although the thymus continues to export T cells throughout life, it undergoes a profound atrophy with age, a process termed thymic involution, resulting in decreased numbers and functional capacity of T cells in older adults, which has direct etiological linkages with many diseases (3–5). Furthermore, T cell immune deficiency in the older adult is exacerbated when the immune system is insulted by chemotherapy, radiotherapy, infections (e.g. HIV), and preparative regimens for foreign tissue or organ transplants. Therefore, restoring thymus function in the older adult has important implications (3–5).
T cell development in the thymus is dependent on the thymic microenvironment, in which thymic epithelial cells (TECs) are the major component (6–10). Despite their importance, TECs undergo both a qualitative and quantitative loss over time, which is believed to be the major factor responsible for age-dependent thymic atrophy/involution (3–5). It is generally acknowledged that FOXN1 is a critical regulator for TEC development (11–17). FOXN1 is expressed in both fetal thymus and postnatal TECs and its expression is downregulated with aging (18–23). FOXN1 is required for TEC development in fetal thymus and the maintenance of the postnatal thymus (17–21, 24, 25).
We have previously reported that intrathymic injection (i.t.) of a recombinant (r) protein containing murine FOXN1 and a protein transduction domain embedded in the HIV transactivator of transcription (TAT) protein (amino acids 47–57) increases the number of TECs in mice that have undergone congenic or allogeneic hematopoietic stem cell transplantation (26) and mice with Alzheimer’s disease (27). Consequently, these mice had enhanced thymopoiesis, an improved thymic output and an increased number of naïve T cells in the periphery (26). However, i.t. injection may not be an ideal choice for clinical applications.
It has been reported that chemokine CCL25 is highly expressed in thymic tissue, especially thymic stroma (28). CCR9 is the receptor for CCL25 (29). Unlike other CC chemokine receptors, CCR9 shows a strict specificity for its ligand CCL25 (28–30). It has been shown intramural injection of a fusion protein containing the N-terminal of CCR9 and IL-7 increased the content of IL-7 in the thymus as compared to injection of IL-7 alone (28).
In this study, we develop a rFOXN1 fusion protein that contains the N-terminal of CCR9, human FOXN1 and TAT (CCR9-FOXN1-TAT, simplified as “rFOXN1 fusion protein” also). We show here that, when injected intravenously (i.v.) into 14-month-old mice, the rFOXN1 fusion protein can enter the thymus and enhance T cell generation in the thymus, resulting in an increased number of peripheral T cells (Scheme 1). Our results suggest that the rFOXN1 fusion protein has the potential to be used in preventing and treating T cell immunodeficiency in older adults.
Scheme 1
2 Materials and methods
2.1 Mice
C57BL/6 mice were obtained or purchased from NIA and Jackson Laboratory. The mice were used in accordance with protocols approved by the Institutional Animal Care and Use Committee of the University of Connecticut.
2.2 Plasmid construction
The extracellular domain of the murine CCR9 cDNA was amplified using the sense primer (primer 1) containing sequences homologous to the pET-45b (+) vector, and antisense primer (primer 2) containing a linker encoding (Gly4Ser)2 (Table 1). The human FOXN1-TAT gene was amplified using the sense primer (primer 3) containing the linker and antisense primer (primer 4) containing TAT and 19 bases that are homologous to the pET-45b (+) vector (Table 1). The polymerase chain reaction (PCR) products of CCR9 and FOXN1-TAT were combined and subjected to an overlap extension PCR with primers 1 and 4. The entire DNA fragment of the CCR9-FOXN1-TAT was cloned into the expression vector pET-45b (+) (Novagen, Gibbstown, NJ) using the In-Fusion Snap Assembly Kit (Clontech, Mountain View, CA) according to the manufacturer’s instructions. To generate control CCR9-MyoD-TAT fusion protein, the CCR9-MyoD-TAT gene was similarly cloned into the pET-45b (+) vector. The plasmid constructs were verified by DNA sequencing.
Table 1
| Sequence 5′–3′ | |
|---|---|
| Primer 1 | CCATCACGTGGGTACCGGTcccacagaactcacaagcct |
| Primer 2 | CGACCCACCACCGCCCGAGCCACCGCCTCCGCTTGC AAACTGCCTGACATT |
| Primer 3 | GGAGGCGGTGGCTCGGGCGGTGGTGGGTCGGTGTC GCTACCCCCGCCGCAGTCT |
| Primer 4 | tttctttaccagactcgagCTATCAACGTCTACGTTGCCTTCG |
Primers for CCR9-FOXN1-TAT pET-45b (+) construction.
Bold letters indicate the homologous to the pET-45b (+) vector.
2.3 Recombinant protein purification and verification
The expression vector containing the CCR9-FOXN1-TAT or CCR9-MyoD-TAT gene was transformed into BL21(DE3) pLysS bacteria (Novagen). The bacteria were expanded in LB medium with ampicillin until OD600 reached 1.0–1.2. Protein expression was induced with 0.4 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG, Novagen) at 37 ° for 4 h. Protein expression level and solubility were determined by the PopCulture quick screen with PopCulture® Reagent (Millipore, USA). Both rFOXN1 and rMyoD fusion proteins were expressed in the inclusion bodies of the bacteria. A freeze/thaw of the cell pellet was prepared by harvesting cells from culture, centrifuging at 10,000 g for 10 min, washing with 50mM Tris-HCl buffer (pH8.0) twice, then freezing the pellet completely at –70°C overnight. Next day, the inclusion bodies from the cell pellet were isolated by the BugBuster® Reagent (Millipore, USA) treatment. The proteins in the inclusion bodies were dissolved in the Inclusion Body Solubilization Reagent (Thermo Scientific). The proteins were further purified by the His Mag Sepharose Ni (Cytiva, USA), and then refolded by a Protein Refolding Kit (Thermo Scientific). The purified proteins were verified by SDS-PAGE, Coomassie Staining and Western blot, and quantified using the Pierce™ BCA Protein Assay Kit (Pierce, Rockford, IL) according to the manufacturer’s instructions.
2.4 SDS-PAGE and western blot
Cytoplasmic and nuclear proteins from cells were separated using the NE-PER® Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific, Rockford, IL). Purified CCR9-FOXN1-TAT and CCR9-MyoD-TAT cytoplasmic or nuclear proteins were loaded on a 10% SDS-PAGE, transferred to a polyvinylidene fluoride membrane, and then incubated with rabbit anti-FOXN1 (Thermo Scientific, or Fitzgerald, Acton, MA), or rabbit anti-MyoD (Santa Cruz Biotechnology, Inc., Dallas, TX), followed by HRP conjugated secondary antibody. The Western Blot was developed with Super Signal® West Pico chemiluminescent Substrate (Thermo Scientific).
2.5 rFOXN1 fusion protein and CCL25 binding assay
CCR9-FOXN1-TAT and CCR9-MyoD-TAT proteins were biotinylated by EZ-LinkTM Sulfo-NHS-LC-Biotin kit (Thermo Scientific). FOXN1-TAT and MyoD-TAT proteins that do not contain the CCR9 domain were also biotinylated and used as controls. The biotinylated proteins were incubated with 1 µg/ml CCL25 protein (R&D Systems, Minneapolis, MN) for 1 hour, added to streptavidin beads (Thermo Scientific) and incubated for additional 1 hour. After washing, the proteins were eluted from the beads by adding sample buffer under a reducing condition and subjected to Western blot with anti-FOXN1, MyoD and CCL25 antibodies.
2.6 Immunofluorescence
Immunofluorescence analysis of thymus tissues was performed as described (31). Briefly, tissues were incubated in 4% paraformaldeyde for 4 hours followed by incubation in 30% sucrose solution overnight. The tissues were embedded in OCT medium, snap frozen, and subsequently cut into 5 micrometer sections. The sections were stained with Alexa Fluor® 546-conjugated anti-FOXN1 Antibody (Santa Cruz Biotechnology) and rat anti-mouse EpCAM1 antibody (Biolegend), or rat anti-mouse K8 monoclonal antibody (Troma I mAb, raised by P. Brulet and R. Kemler and obtained from the Developmental Studies Hybridoma Bank, University of Iowa, IA), or rabbit anti-mouse K5 polyclonal antibody (Covance Research Products, Denver, PA), followed by AlexaFluor-488-conjugated goat anti-rat or rabbit IgG (Invitrogen). For cultured ESCs or CD45-EpCAM1+ TECs, the cells were washed and prepared by cytospin, fixed by 5% paraformaldehyde, and stained with the Alexa Fluor® 546-conjugated anti-FOXN1 antibody followed by DAPI nuclear staining. The cells were observed under a Nikon A1R Spectral Confocal microscope (Nikon, Kanagawa, Japan) or Keyence microscope (KEYENCE, USA).
2.7 TEC isolation
The thymus was incubated in 0.01 (w/v) liberase (Roche, Nutley NJ) and 0.02% (w/v) DNAse I (Roche) at 37 ° with regular and gentle agitation as described (32). CD45- cells from the single cell suspension of the thymus were negatively selected by CD45 microbeads, and EpCAM1+ cells were then positively selected by EpCAM1 microbeads (Miltenyi Biotec, San Diego).
2.8 Flow cytometry
Single-cell suspensions of thymocytes and spleen cells were stained with different combinations of the following fluorochrome-conjugated antibodies: CD4, CD8, CD3, CD25, CD44, CD62L, CD117, CD127, EpCAM1, Ly51, CD45, FoxP3, and I-Ab (BioLegend, BD Biosciences, San Jose, CA, or eBioscience, San Diego, CA). ETPs were identified as lin−IL-7Rα (CD127)−c-kit (CD117)+CD44+CD25−thymus cells; a cocktail of antibodies against TER-119, B220, CD19, IgM, Gr-1, CD11b, CD11c, NK1.1, TCRβ, CD3e, and CD8α was used to identify the lin- cells. For Ki67 staining, cells were stained with antibodies for TEC cell surface marker, and then permeabilized with a Cytofix/Cytoperm solution at 4° (BD Biosciences, San Jose, CA). The cells were then stained with FITC-conjugated anti-Ki67 antibody (BioLegend). The cells were analyzed on a LSR II flow cytometer (BD Biosciences); data analysis was done using FlowJo software (Ashland, OR).
2.9 TUNEL assay
Cells were stained with antibodies for TEC cell surface markers and with an in-situ cell death detection kit (Roche Applied Science). A negative control without the terminal deoxynucleotidyl transferase was also used. The cells were analyzed by flow cytometry.
2.10 Real-time qualitative RT-PCR
Total RNA from cells was isolated from tissues, and cDNA was synthesized as described (33). Equal amounts of cDNAs were used for RT-PCR. qRT-PCRs were performed with the Power SYBR green mastermix (Applied Biosystems, UK) using the 7500 real-time PCR system (Applied Biosystems, UK) (34). After normalization to GAPDH, samples were plotted relative to control protein-treated group. Primers are summarized in Supplementary Table 1.
2.11 Statistical analysis
P-values for two groups were based on the two-sided Student’s t test. For comparing means of multiple groups, significance was determined using one‐way ANOVA with Dunnett test, or two-way ANOVA with Tukey test by using SPSS29 software (IBM Corp., Armonk, NY). A confidence level above 95% (p<0.05) was determined to be significant.
3 Results
3.1 Expression, purification, and characterization of rFOXN1 and control fusion proteins
To produce rFOXN1 fusion protein, the extracellular domain of the murine CCR9 and human FOXN1 genes were connected by a flexible linker encoding (Gly4Ser)2. The TAT DNA was added to the C-terminal of the FOXN1 (Figure 1A). The entire DNA fragment of the CCR9-FOXN1-TAT was cloned into a prokaryotic expression vector pET-45b (+) which was then transformed into Rosetta 2 (DE3) bacteria. The CCR9-FOXN1-TAT fusion protein was purified from the bacteria. A relatively high purity of rFOXN1 fusion protein was obtained, as determined by Coomassie blue-stained SDS-PAGE (Figure 1B, lane 2). The identity of the protein was verified by Western blot using an anti-human FOXN1 antibody (Figure 1B, lane 3). For controls, a human MyoD fusion protein that contained murine CCR9 and human MyoD-TAT was similarly cloned, expressed and purified with the same system; the purified CCR9-MyoD-TAT protein was verified by SDS-PAGE and Western blot using an anti-human MyoD antibody (data not shown).
Figure 1
We then determined whether the rFOXN1 fusion protein, when added into cultured cells, could translocate into the cytoplasm and nucleus of cultured cells. Mouse embryonic stem cells (ESCs) from NU/J nude mice that lack FOXN1 protein were cultured in the presence of rFOXN1 or control rMyoD fusion protein. One or 12 hours later, nuclear and cytoplasmic protein extracts were prepared and subjected to Western blot analysis using the anti-FOXN1 or MyoD antibody (26). The FOXN1 or MyoD fusion protein was present in both the cytoplasm and nucleus after 1 and 12 hours, but greater in nucleus after the longer incubation (Figure 1C; Supplementary Figure 1). The results were confirmed by immunofluorescence staining showing that the rFOXN1 or MyoD fusion protein was present in both the cytoplasm and nucleus, with more protein in the nucleus than in the cytoplasm after 12-hour incubation (Figure 1D). Furthermore, we isolated CD45-EpCAM1+ primary TECs from C57BL/6 (B6) mice and incubated them with the rFOXN1 fusion protein or control protein. Since the anti-FOXN1 antibody reacts with both the endogenous mouse FOXN1 and the human rFOXN1 fusion protein, we detected the total expression levels of both FOXN1 proteins with immunofluorescence. As shown in Figure 1E, FOXN1 protein levels in both the cytoplasm and nucleus were significantly increased after the rFOXN1 fusion protein was added in the cultures. Collectively, the results suggest that the rFOXN1 fusion protein can translocate from the cell surface into the cytoplasm and nucleus.
3.2 The rFOXN1 fusion protein can enter the thymus when injected peripherally
To determine the ability of the rFOXN1 or rMyoD fusion protein to bind to the CCR9 ligand, CCL25, CCR9-FOXN1-TAT and CCR9-MyoD-TAT, as well as control FOXN1-TAT and MyoD-TAT proteins were labelled with biotin. The biotinylated proteins were incubated with CCL25 protein and then added to streptavidin beads. After washing, the proteins were eluted from the beads by adding sample buffer under a reducing condition and subjected to Western blot with anti-FOXN1, MyoD and CCL25 antibodies. We detected both FOXN1 or MyoD, and CCL25 from CCR9-FOXN1-TAT or CCR9-MyoD-TAT elution, but only FOXN1 or MyoD from FOXN1-TAT or CCR9-MyoD elution (Supplementary Figure 2). The results suggest that CCR9-FOXN1-TAT and CCR9-MyoD-TAT can bind to CCL25.
To determine the ability of the rFOXN1 fusion protein to travel to the thymus from the periphery, B6 mice were injected i.v. with graded doses of CCR9-FOXN1-TAT or control CCR9-MyoD-TAT fusion protein (20, 40, 80, and 160 µg). One day later, the thymic sections were stained with antibodies against FOXN1 and EpCAM1 (to identify total TECs). As shown in Figures 2A, B, i.v. injection of the rFOXN1 fusion protein resulted in increased levels of FOXN1 in the TECs in a dose-dependent manner with more than 2-, 2.5- and 4-fold increase with 40, 80 and 160 µg rFOXN1 fusion protein, as compared with respective doses of control protein. We then performed Western blot to confirm the levels of FOXN1. The lysis of the thymus tissues was analyzed by Western blot using the anti-FOXN1 antibody that also reacted with both mouse and human FOXN1. Since the molecular weight of the rFOXN1 fusion protein is higher than that of endogenous mouse FOXN1, we could separate the expression levels of the two FOXN1 proteins with this method. As shown in Figures 2C, D, the expression levels of the endogenous mouse FOXN1 protein were not significantly changed after injection of graded doses of the FOXN1 or control fusion protein. In contrast, the levels of the rFOXN1 fusion protein in the thymus were significantly increased in a dose-dependent manner after i.v. injection of the rFOXN1 fusion protein (Figures 2C, D; Supplementary Figure 1). Similar trends were also observed when CD45-EpCAM1+ TECs were purified from the thymus, and the cytoplasmic and nuclear fractions in the TECs were separated and analyzed for FOXN1 protein level by Western blot (data not shown).
Figure 2
To determine the potential of the rFOXN1 fusion protein to enter other organs, B6 mice were injected i.v. with 80 µg CCR9-FOXN1-TAT or CCR9-MyoD-TAT fusion protein. One day later, the thymus and other organs including the small intestine, thyroid, heart, and lung were harvested, and frozen sections of the organs were also prepared and analyzed for the expression of FOXN1 by immunofluorescence. We detected a significant increase of FOXN1 protein in the thymus and the small intestine after CCR9-FOXN1-TAT, but not control CCR9-MyoD-TAT, FOXN1-TAT, or MyoD-TAT protein injected i.v. (Figures 2E, F; Supplementary Figure 3). Only a few of CCR9-FOXN1-TAT fusion protein entered other organs (Figures 2E, F). The addition of DAPI nuclear staining showed an overlap of signals from rFOXN1 and nuclear dye in thymus (Figure 2E), suggesting the rFOXN1 fusion protein went to the nucleus of the cells. By using K5 to identify medullary TECs (mTECs) or keratin 8 (K8) to identify cortical TECs (cTECs), we found that CCR9-FOXN1-TAT could enter both mTECs and cTECs (Figures 2G–J). In contrast, little or none of the CCR9-FOXN1-TAT fusion protein entered thymocytes, endothelial cells and macrophages although some of the protein entered fibroblasts (Supplementary Figure 4). Taken together, the results suggest that the rFOXN1 fusion protein can transport to the thymus, and preferentially enter TECs when injected peripherally.
3.3 The rFOXN1 fusion protein increases the number of total TECs and TEC subsets in old mice
We then determined the ability of the rFOXN1 fusion protein to increase the number of TECs in old mice. Fourteen-month-old B6 mice were injected i.v. with graded doses of CCR9-FOXN1-TAT, control CCR9-MyoD-TAT or FOXN1-TAT protein (40, 80, and 160 µg) at 6 day-intervals. PBS was also used as a negative control. Two months later, the thymi were harvested. As shown in Figure 3A, CCR9-FOXN1-TAT-treated thymus was significantly larger than control CCR9-MyoD-TAT or FOXN1-TAT protein-treated thymus. We analyzed the thymic architecture by H&E staining. The control protein-treated thymus had a disorganized compartmentalization of cortical and medullary areas, and a reduction in medullary area (Figure 3B). In contrast, CCR9-FOXN1-TAT protein-treated thymus displayed a distinctive cortical and medullary area and increased medulla (Figure 3B), a structure similar to the young thymus.
Figure 3
We then analyzed the number of total TECs (CD45-EpCAM+) by flow cytometry. Control CCR9-MyoD-TAT or FOXN1-TAT protein did not affect the number of total TECs at any dose, as compared to PBS treatment (Figure 3C and data not shown). In contrast, the numbers of total TECs in 40, 80, and 160 µg CCR9-FOXN1-TAT protein-treated mice were increased 3-, 4-, and 3.9-fold, respectively, above those in control CCR9-MyoD-TAT protein-treated mice (Figure 3C). The number of total TECs in 80 µg rFOXN1 fusion protein-treated old mice almost reached that in 1-month-old untreated young mice (Figure 3C).
TECs can be broadly divided into cTECs and mTECs, which can be identified using flow cytometric analysis with anti-Ly51 and anti-UEA antibodies (Ly51+UEA- for cTECs and Ly51-UEA+ for mTECs). CCR9-FOXN1-TAT protein increased the numbers of both CD45-EpCAM+MHC II+Ly51+ cTECs and CD45-EpCAM+MHC II+Ly51- mTECs with a greater effect on mTECs, as compared with the rMyoD control protein (Figures 3D–G). Similar results were obtained when CD45-EpCAM+MHC II+UEA- cTECs and CD45-EpCAM+MHC II+UEA+ mTECs were analyzed (data not shown). mTECs can be further divided into mTECslo and mTECshi subsets based on the expression level of MHC II, and the former are considered as immature mTECs (35–37). As shown in Figure 3G, CCR9-FOXN1-TAT protein increased the number of both mTECslo and mTECshi. Taken together, our results suggest that the rFOXN1 fusion protein treatment increases the number of total TECs and TEC subsets in old mice.
To determine whether the increased number of TECs by the rFOXN1 fusion protein was due to enhanced cell survival and/or proliferation, we first analyzed cell survival using a TUNEL apoptosis detection assay. The percentages of TUNEL+ apoptotic cells in cTECs and mTECs were reduced by 64% and 62%, respectively, in CCR9-FOXN1-TAT protein-treated mice as compared to the control protein-treated mice (Supplementary Figure 5A). We then analyzed TEC proliferation by measuring Ki67+ cells via flow cytometry. CCR9-FOXN1-TAT protein did not significantly increase the percentage of Ki67+ cells in cTECs but increased the percentage of Ki67+ cells in mTECs 1.7-fold over control protein (Supplementary Figure 5B). Collectively, our data suggest that the rFOXN1 fusion protein increased the number of TECs by enhancing the survival of both cTECs and mTECs, as well as the proliferation of mTECs.
3.4 The rFOXN1 fusion protein increases the number of total thymocytes and thymocyte subsets including early thymic progenitors in old mice
We have previously shown that the increased number of TECs in the murine rFOXN1 protein treated mice that have undergone hematopoietic stem cell transplantation subsequently increased the number of thymocytes (26). We therefore determined whether CCR9-FOXN1-TAT protein has a similar effect on old mice. Like the effect on TECs, a parallel dose-dependent increase in the number of CD45+ total thymocytes was observed; the numbers of total thymocytes in 40, 80, and 160 µg CCR9-FOXN1-TAT fusion protein-treated mice were increased 3.3-, 4.3-, and 4.1-fold, respectively, above those in control CCR9-MyoD-TAT or control FOXN1-TAT-treated mice (Figure 4A). Again, the number of total thymocytes in 80 µg CCR9-FOXN1-TAT protein-treated old mice almost reached that in untreated 1-month-old young mice (Figure 4A).
Figure 4
Thymocytes can be divided into the following major subsets: CD4 and CD8 double negative (DN), double positive (DP), CD4 single positive (SP), and CD8 SP thymocytes. CCR9-FOXN1-TAT protein decreased the percentages of DN thymocytes but increased the percentages of DP and CD8 SP thymocyte subsets (Figure 4B; Supplementary Figure 6A). Because CCR9-FOXN1-TAT protein increased the number of total thymocytes, it increased the number in each of the thymocytes subsets including DN thymocytes (Figure 4C). DN thymocytes can be further divided into DN1, DN2, DN3 and DN4 subsets based on the expressions of CD44 and CD25. CCR9-FOXN1-TAT did not significantly change the percentage of the subsets but increased the cell numbers of each subset (Figures 4D, E; Supplementary Figure 6B). Since natural regulatory T cells (Tregs) also develop in the thymus (38), we analyzed these cells. CCR9-FOXN1-TAT protein treatment increased the percentage and number of CD4+CD25+FoxP3+ Tregs in the old mice (Figures 4F, G; Supplementary Figure 6C).
The early thymic progenitor (ETPs) (lin- c-kit+ IL-7Rα- CD44+CD25-) are considered to represent canonical intrathymic T-cell progenitors (39–41). CCR9-FOXN1-TAT protein treatment increased both the percentage and number of ETPs (Figures 4H, I; Supplementary Figure 6D). To determine whether the increased ETPs were due to CCR9-FOXN1-TAT induced-enhanced expression of chemokines that can attract T-cell precursors to the thymus, we analyzed the expression levels of CCL25 and CXCL12 that are the transcriptional targets of FOXN1 (24, 42, 43). We found that the expression levels of CCL25 and CXCL12 in CD45- thymic stromal cells were increased after CCR9-FOXN1-TAT protein treatment (Figure 4J). Since delta-like (Dll) 4 is also the target of FOXN1 and plays a critical role in T cell development (43, 44), we analyzed Dll4 and found that the expression level of this gene was also increased after CCR9-FOXN1-TAT treatment (Figure 4J). Taken together, our data suggests that the rFOXN1 fusion protein treatment increases the number in all thymocyte subsets including ETPs, which is related to increased expression of CCL25, CXCL12 and Dll4 in thymic stromal cells.
3.5 The rFOXN1 fusion protein-treated aged mice have increased the number of peripheral T cells
We also determined whether the enhanced thymopoiesis in the rFOXN1 fusion protein-treated aged mice resulted in an increased number of peripheral T cells. The spleens were harvested from the CCR9-FOXN1-TAT, control CCR9-MyoD-TAT or FOXN1-TAT-treated old mice 2 months later. CCR9-FOXN1-TAT protein treatment significantly increased the number of total CD4+ and CD8+ T cells; 40, 80, and 160 µg CCR9-FOXN1-TAT protein increased 2.2-, 3.5-, and 3.4-fold CD4+ T cells and CD8+ T cells, respectively, above those in control protein-treated mice (Figures 5A, B).
Figure 5
T cells can be divided into CD44loCD62Lhi naïve, CD44hiCD62Llo effector memory, and CD44hiCD62Lhi central memory T cells. CCR9-FOXN1-TAT protein significantly increased the percentages and numbers of CD4+ and CD8+ naïve T cells (Figures 5C–F; Supplementary Figure 7). Although CCR9-FOXN1-TAT protein decreased the percentages of CD4+ and CD8+ effector memory T cells, because CCR9-FOXN1-TAT increased the number of total CD4+ and CD8+ T cells, it also increased the numbers of these T cells (Figures 5C–F; Supplementary Figure 7).
We then analyzed CD4+CD25+FoxP3+ Tregs in the spleen. CCR9-FOXN1-TAT treatment increased the percentage and number of CD4+CD25+FoxP3+ Tregs in the old mice (Figures 5G, 6H; Supplementary Figure 7). The increased numbers of CD4 and CD8 T cells, as well as Tregs were also similarly observed in lymph nodes and blood (data not shown). Collectively, our results suggested that the enhanced thymopoiesis in the rFOXN1 fusion protein-treated old mice resulted in an increased number of peripheral T cells.
4 Discussion
Given CCR9’s stringent specificity for its ligand CCL25 and the abundant expression of CCL25 in thymic tissue, particularly within the thymic stroma (28–30), we fused the N-terminal of murine CCR9 to human FOXN1. We have shown here that the rFOXN1 fusion protein can enter the thymus, especially TECs, after injected peripherally. The results suggest that CCR9 can direct FOXN1 protein to move to the thymus (with preferentially to TECs) from the blood. Our data are consistent with the report that a fusion protein containing the N-terminal of CCR9 and IL-7, when injected peripherally, increased the content of IL-7 in the thymus, resulting in enhanced thymopoiesis (28). In addition to the thymus, the rFOXN1 fusion protein also enter the small intestine, which is consistent with the report that CCL25 is predominantly expressed by thymic and intestinal epithelial cells (45). We have shown that the rFOXN1 fusion protein preferentially enters TECs and fibroblasts; this probably because these cells express and produce CCL25, leading to higher CCL25 concentrations on the cell surface and surrounding areas. Although this small amount of the rFOXN1 fusion enters the small intestine, we did not observe obvious side effects after the rFOXN1 fusion protein treatment.
We have also shown that i.v. injection of the rFOXN1 fusion protein increased the number of TECs in old mice, which was due to enhanced survival of both cTECs and mTECs, as well as increased proliferation of mTECs. The results are consistent with our data that rFOXN1 fusion protein had more significant effects on mTECs (Figure 3G) and other reports that mTECs are more FOXN1-dependent than cTECs (16, 18, 24).
The increased number of TECs in rFOXN1 fusion protein-treated old mice resulted in enhanced T cell generation in the thymus, leading to increased numbers of T cells in the peripheral lymphoid organs. Although the rFOXN1 fusion protein increases the number of TECs and thymocytes in a dose-dependent manner, administration of the protein at a 160 µg does not have greater effect than the 80 µg does. The data are consistent with our own and other reports that the FOXN1 dosage needs to be tightly controlled (16, 18, 19, 21, 24, 26).
In our previous studies, we used murine FOXN1 protein (26). For future potential clinical applications, we generated human FOXN1 fusion protein in this study. We found that the human FOXN1 fusion protein could also affect mouse TECs similarly to murine FOXN1 protein (26), likely because mouse and human FOXN1 proteins have a high homology. It has been reported that 85% of amino acids in human FOXN1 protein are identical to the murine form and both proteins are also identical in length (648 aa) (46).
The rFOXN1 fusion protein-treated old mice had increased number of ETPs in the thymus (Figure 4I) and increased expression of chemokines CCL25 and CXCL12 in thymic stromal cells (Figure 4J). It has been reported that CCL25 and CXCL12 are the transcriptional targets of FOXN1 (24, 42, 43). It is possible that the increased expression of chemokines results in enhanced migration of T-cell precursors to the thymus. It is also possible that rFOXN1 directly acts on ETPS and/or the precursors for ETPs since it has been reported that not only the number of thymic ETPs, but also that of bone marrow hematopoietic stem cells and multipotent progenitors in aged FOXN1 transgenic mice was higher than in age-matched WT mice (19). The number of Tregs in the rFOXN1 fusion protein-treated old mice was also increased (Figure 5H), which was likely due to the increased generation of TECs that support the development of natural Tregs (47, 48). We cannot exclude the possibility that the rFOXN1 fusion protein affects bone marrow hematopoietic stem cells and progenitors. Our studies have limitations because we did not encompass the analysis of the percentage and number of bone marrow hematopoietic stem cells and multipotent progenitors in the bone marrow of the rFOXN1 fusion protein-treated mice.
Age-dependent thymic involution/atrophy can be caused by both TEC and ETP degeneration. rFOXN1 fusion protein treatment increases both TECs and ETPs in old mice. It has been reported that a reduced expression or the deletion of a single gene, FOXN1, results in phenotypes similar to age-dependent thymic involution. Furthermore, overexpression of FOXN1 attenuates age-associated thymic involution (19, 21, 24). Our results showing that administration of the rFOXN1 fusion protein increases the number of TECs and thymopoiesis are consistent with these reports, suggesting that FOXN1 plays a critical role in maintaining adult TECs.
5 Conclusions
We have shown that administration of the human rFOXN1 fusion protein in old mice can increase the number of TECs, resulting in enhanced T cell generation in the thymus, leading to an increased number of peripheral T cells. Our results suggest that the rFOXN1 fusion protein has the potential to be used in preventing and treating T cell immunodeficiency in older adults.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics statement
The animal study was approved by Institutional Animal Care and Use Committee of the University of Connecticut. The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
JZ: Data curation, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing. RH: Investigation, Methodology, Writing – review & editing. KL: Investigation, Writing – review & editing. ZZ: Investigation, Writing – review & editing. LL: Formal analysis, Funding acquisition, Supervision, Writing – original draft, Writing – review & editing.
Funding
The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by grants from NIH (R21AG072234, R33AG072234 and 1R01AI175087).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The handling editor NO declared a past co-authorship with one of the authors LL.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2024.1423488/full#supplementary-material
Abbreviations
TECs, thymic epithelial cells; rFOXN1, recombinant FOXN1 protein; TAT, transactivator of transcription; IPTG, isopropyl-β-D-1-thiogalactopyranoside; i.v. intravenously; i.t., intrathymic; ESC, embryonic stem cell; cTECs, cortical TECs; mTECs, medullary TECs; ETPs, early thymic progenitor; DN, double negative; DP, double positive; SP, single positive; Tregs, regulatory T cells.
References
1
DorshkindKSwainS. Age-associated declines in immune system development and function: causes, consequences, and reversal. Curr Opin Immunol. (2009) 21:404–7. doi: 10.1016/j.coi.2009.07.001
2
SwainSLNikolich-ZugichJ. Key research opportunities in immune system aging. J Gerontol Ser A Biol Sci Med Sci. (2009) 64:183–6. doi: 10.1093/gerona/gln068
3
TaubDDLongoDL. Insights into thymic aging and regeneration. Immunol Rev. (2005) 205:72–93. doi: 10.1111/j.0105-2896.2005.00275.x
4
LynchHEGoldbergGLChidgeyAVan den BrinkMRBoydRSempowskiGD. Thymic involution and immune reconstitution. Trends Immunol. (2009) 30:366–73. doi: 10.1016/j.it.2009.04.003
5
AspinallRPittsDLapennaAMitchellW. Immunity in the elderly: the role of the thymus. J Comp Pathol. (2010) 142 Suppl 1:S111–5. doi: 10.1016/j.jcpa.2009.10.022
6
ChidgeyADudakovJSeachNBoydR. Impact of niche aging on thymic regeneration and immune reconstitution. Semin Immunol. (2007) 19:331–40. doi: 10.1016/j.smim.2007.10.006
7
AndersonGTakahamaY. Thymic epithelial cells: working class heroes for T cell development and repertoire selection. Trends Immunol. (2012) 33:256–63. doi: 10.1016/j.it.2012.03.005
8
ZediakVPBhandoolaA. Aging and T cell development: interplay between progenitors and their environment. Semin Immunol. (2005) 17:337–46. doi: 10.1016/j.smim.2005.05.004
9
CiofaniMZuniga-PfluckerJC. The thymus as an inductive site for T lymphopoiesis. Annu Rev Cell Dev Biol. (2007) 23:463–93. doi: 10.1146/annurev.cellbio.23.090506.123547
10
MondinoAKhorutsAJenkinsMK. The anatomy of T-cell activation and tolerance. Proc Natl Acad Sci USA. (1996) 93:2245–52. doi: 10.1073/pnas.93.6.2245
11
GalloVCirilloEGiardinoGPignataC. FOXN1 deficiency: from the discovery to novel therapeutic approaches. J Clin Immunol. (2017) 37:751–8. doi: 10.1007/s10875-017-0445-z
12
ManleyNRCondieBG. Transcriptional regulation of thymus organogenesis and thymic epithelial cell differentiation. Prog Mol Biol Trans Sci. (2010) 92:103–20. doi: 10.1016/S1877-1173(10)92005-X
13
NehlsMPfeiferDSchorppMHedrichHBoehmT. New member of the winged-helix protein family disrupted in mouse and rat nude mutations. Nature. (1994) 372:103–7. doi: 10.1038/372103a0
14
RodewaldHR. Thymus organogenesis. Annu Rev Immunol. (2008) 26:355–88. doi: 10.1146/annurev.immunol.26.021607.090408
15
RotaIAHandelAEMaioSKleinFDhallaFDeadmanMEet al. FOXN1 forms higher-order nuclear condensates displaced by mutations causing immunodeficiency. Sci Adv. (2021) 7:eabj9247. doi: 10.1126/sciadv.abj9247
16
ZhangZBurnleyPCoderBSuDM. Insights on FoxN1 biological significance and usages of the "nude" mouse in studies of T-lymphopoiesis. Int J Biol Sci. (2012) 8:1156–67. doi: 10.7150/ijbs.5033
17
MosesABhallaPThompsonALaiLCoskunFSSeroogyCMet al. Comprehensive phenotypic analysis of diverse FOXN1 variants. J Allergy Clin Immunol. (2023) 152:1273–1291.e15. doi: 10.1016/j.jaci.2023.06.019
18
ChenLXiaoSManleyNR. Foxn1 is required to maintain the postnatal thymic microenvironment in a dosage-sensitive manner. Blood. (2009) 113:567–74. doi: 10.1182/blood-2008-05-156265
19
ZookECKrishackPAZhangSZeleznik-LeNJFirulliABWittePLet al. Overexpression of Foxn1 attenuates age-associated thymic involution and prevents the expansion of peripheral CD4 memory T cells. Blood. (2011) 118:5723–31. doi: 10.1182/blood-2011-03-342097
20
ChengLGuoJSunLFuJBarnesPFMetzgerDet al. Postnatal tissue-specific disruption of transcription factor FoxN1 triggers acute thymic atrophy. J Biol Chem. (2010) 285:5836–47. doi: 10.1074/jbc.M109.072124
21
SunLGuoJBrownRAmagaiTZhaoYSuDM. Declining expression of a single epithelial cell-autonomous gene accelerates age-related thymic involution. Aging Cell. (2010) 9:347–57. doi: 10.1111/j.1474-9726.2010.00559.x
22
ViglianoIGorreseMFuscoAVitielloLAmorosiSPanicoLet al. FOXN1 mutation abrogates prenatal T-cell development in humans. J Med Genet. (2011) 48:413–6. doi: 10.1136/jmg.2011.089532
23
CorbeauxTHessISwannJBKanzlerBHaas-AssenbaumABoehmT. Thymopoiesis in mice depends on a Foxn1-positive thymic epithelial cell lineage. Proc Natl Acad Sci USA. (2010) 107:16613–8. doi: 10.1073/pnas.1004623107
24
BredenkampNNowellCSBlackburnCC. Regeneration of the aged thymus by a single transcription factor. Development. (2014) 141:1627–37. doi: 10.1242/dev.103614
25
GarfinPMMinDBrysonJLSerwoldTEdrisBBlackburnCCet al. Inactivation of the RB family prevents thymus involution and promotes thymic function by direct control of Foxn1 expression. J Exp Med. (2013) 210:1087–97. doi: 10.1084/jem.20121716
26
SongYSuMZhuJDiWLiuYHuRet al. FOXN1 recombinant protein enhances T-cell regeneration after hematopoietic stem cell transplantation in mice. Eur J Immunol. (2016) 46:1518–28. doi: 10.1002/eji.201546196
27
ZhaoJZhangZLaiKCLaiL. Administration of recombinant FOXN1 protein attenuates Alzheimer's pathology in mice. Brain behavior Immun. (2023) 113:341–52. doi: 10.1016/j.bbi.2023.07.027
28
HensonSMSnelgroveRHussellTWellsDJAspinallR. An IL-7 fusion protein that shows increased thymopoietic ability. J Immunol (Baltimore Md. (2005) 1950) 175:4112–8. doi: 10.4049/jimmunol.175.6.4112
29
ZaballosAGutierrezJVaronaRArdavinCMarquezG. Cutting edge: identification of the orphan chemokine receptor GPR-9-6 as CCR9, the receptor for the chemokine TECK. J Immunol (Baltimore Md. 1950). (1999) 162:5671–5. doi: 10.4049/jimmunol.162.10.5671
30
YounBSKimCHSmithFOBroxmeyerHE. TECK, an efficacious chemoattractant for human thymocytes, uses GPR-9-6/CCR9 as a specific receptor. Blood. (1999) 94:2533–6. doi: 10.1182/blood.V94.7.2533.419k37_2533_2536
31
LaiLJinJ. Generation of thymic epithelial cell progenitors by mouse embryonic stem cells. Stem Cells (Dayton Ohio). (2009) 27:3012–20. doi: 10.1002/stem.238
32
SeachNWongKHammettMBoydRLChidgeyAP. Purified enzymes improve isolation and characterization of the adult thymic epithelium. J Immunol Methods. (2012) 385:23–34. doi: 10.1016/j.jim.2012.07.023
33
YanYSuMSongYTangYTianCRoodDet al. Tbx1 modulates endodermal and mesodermal differentiation from mouse induced pluripotent stem cells. Stem Cells Dev. (2014) 23:1491–500. doi: 10.1089/scd.2013.0488
34
LinYCuiCSuMTianXHuangYZhaoJet al. Skint8, a novel B7 family-related molecule, negatively regulates T cell responses. J Immunol (Baltimore Md. (2019) 1950) 203:400–7. doi: 10.4049/jimmunol.1800639
35
OsadaMJardineLMisirRAndlTMillarSEPezzanoM. DKK1 mediated inhibition of Wnt signaling in postnatal mice leads to loss of TEC progenitors and thymic degeneration. PloS One. (2010) 5:e9062. doi: 10.1371/journal.pone.0009062
36
GrayDAbramsonJBenoistCMathisD. Proliferative arrest and rapid turnover of thymic epithelial cells expressing Aire. J Exp Med. (2007) 204:2521–8. doi: 10.1084/jem.20070795
37
WongKListerNLBarsantiMLimJMHammettMVKhongDMet al. Multilineage potential and self-renewal define an epithelial progenitor cell population in the adult thymus. Cell Rep. (2014) 8:1198–209. doi: 10.1016/j.celrep.2014.07.029
38
SakaguchiSYamaguchiTNomuraTOnoM. Regulatory T cells and immune tolerance. Cell. (2008) 133:775–87. doi: 10.1016/j.cell.2008.05.009
39
PorrittHERumfeltLLTabrizifardSSchmittTMZuniga-PfluckerJCPetrieHT. Heterogeneity among DN1 prothymocytes reveals multiple progenitors with different capacities to generate T cell and non-T cell lineages. Immunity. (2004) 20:735–45. doi: 10.1016/j.immuni.2004.05.004
40
AllmanDSambandamAKimSMillerJPPaganAWellDet al. Thymopoiesis independent of common lymphoid progenitors. Nat Immunol. (2003) 4:168–74. doi: 10.1038/ni878
41
BhandoolaAvon BoehmerHPetrieHTZuniga-PfluckerJC. Commitment and developmental potential of extrathymic and intrathymic T cell precursors: plenty to choose from. Immunity. (2007) 26:678–89. doi: 10.1016/j.immuni.2007.05.009
42
CalderonLBoehmT. Synergistic, context-dependent, and hierarchical functions of epithelial components in thymic microenvironments. Cell. (2012) 149:159–72. doi: 10.1016/j.cell.2012.01.049
43
ZuklysSHandelAZhanybekovaSGovaniFKellerMMaioSet al. Foxn1 regulates key target genes essential for T cell development in postnatal thymic epithelial cells. Nat Immunol. (2016) 17:1206–15. doi: 10.1038/ni.3537
44
HozumiKMailhosCNegishiNHiranoKYahataTAndoKet al. Delta-like 4 is indispensable in thymic environment specific for T cell development. J Exp Med. (2008) 205:2507–13. doi: 10.1084/jem.20080134
45
WurbelMAPhilippeJMNguyenCVictoreroGFreemanTWoodingPet al. The chemokine TECK is expressed by thymic and intestinal epithelial cells and attracts double- and single-positive thymocytes expressing the TECK receptor CCR9. Eur J Immunol. (2000) 30:262–71. doi: 10.1002/(ISSN)1521-4141
46
SchorppMHofmannMDearTNBoehmT. Characterization of mouse and human nude genes. Immunogenetics. (1997) 46:509–15. doi: 10.1007/s002510050312
47
AschenbrennerKD'CruzLMVollmannEHHinterbergerMEmmerichJSweeLKet al. Selection of Foxp3+ regulatory T cells specific for self antigen expressed and presented by Aire+ medullary thymic epithelial cells. Nat Immunol. (2007) 8:351–8. doi: 10.1038/ni1444
48
SalaunJCorbelCLe-DouarinNM. Regulatory T cells in the establishment and maintenance of self-tolerance: role of the thymic epithelium. Int J Dev Biol. (2005) 49:137–42. doi: 10.1387/ijdb.041959js
Summary
Keywords
FOXN1, thymus, thymic epithelial cells, T cell generation, old mice
Citation
Zhao J, Hu R, Lai KC, Zhang Z and Lai L (2024) Recombinant FOXN1 fusion protein increases T cell generation in old mice. Front. Immunol. 15:1423488. doi: 10.3389/fimmu.2024.1423488
Received
25 April 2024
Accepted
02 July 2024
Published
12 July 2024
Volume
15 - 2024
Edited by
Nicolai Stanislas van Oers, University of Texas Southwestern Medical Center, United States
Reviewed by
Yousuke Takahama, National Institutes of Health (NIH), United States
Marco Rosichini, Fred Hutchinson Cancer Center, United States
Updates
Copyright
© 2024 Zhao, Hu, Lai, Zhang and Lai.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Laijun Lai, laijun.lai@uconn.edu
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.