ORIGINAL RESEARCH article

Front. Immunol., 07 March 2025

Sec. Microbial Immunology

Volume 16 - 2025 | https://doi.org/10.3389/fimmu.2025.1508584

The ability to detach from biofilms in the lung airways prior to transmission to another host is associated with the infectious phenotype of Mycobacterium abscessus

  • 1. Department of Biomedical Sciences, Carlson College of Veterinary Medicine, Oregon State University, Corvallis, OR, United States

  • 2. Department of Microbiology, College of Sciences, Oregon State University, Corvallis, OR, United States

Abstract

Introduction:

Mycobacterium abscessus is a pathogen recently associated with patients with chronic lung conditions such as bronchiectasis and cystic fibrosis. M. abscessus is an environmental bacterium but recent evidence suggests that the pathogen is also transmitted from host-to-host. Because M. abscessus is known to form biofilms on the respiratory mucosa the release of bacteria from the biofilm becomes an important aspect on the transmission of the infection.

Methods:

A biofilm releasing system was established. A transposon library of M. abscessus was then screened to identify genes associated with the release from biofilms.

Results:

Several enzymes and genes of unidentified function were linked with the ability to detach from the biofilm. It was also shown that detached bacteria were increased capable of establish a new biofilm, attach to epithelial cells, and infect macrophages. To determine the surface molecules linked with the ability to infect new hosts, a surface proteomic was performed, showing that detaching bacteria express many proteins do not present in biofilm bacteria.

Discussion:

Detached M. abscessus, one of the possible infectious phenotypes, contains specific proteins and lipids in the surface that facilitate the infection of new hosts. In addition, we identified many small proteins that have the likelihood to be associated with the release of the biofilm bacteria.

Introduction

Pulmonary infections caused by Mycobacterium abscessus have been increasingly identified in individuals with chronic lung pathologies, such as emphysema, bronchiectasis, and cystic fibrosis (). All three subspecies of M. abscessus, i.e., M. abscessus subsp. abscessus, M. abscessus subsp. Bolletii, and M. abscessus subsp. masssiliense, are resistant to the majority of available antibiotics, making the treatment of patients quite challenging (, ).

There is evidence that M. abscessus has evolved recently in order to adapt to the airway environment of humans harboring the risk factors (, ). Not only is the infection becoming more common, but additional evidence of genome evolution has also emerged (, ). A few clones of the pathogen have been isolated from infections in the respiratory tracts of patients, which suggests rapid evolution allowing for adaptation to the environment.

One of the strategies by which environmental bacteria adapt to mammalian host infections is the inherent ability to form a biofilm (BF). Studies and clinical experience have shown that M. abscessus uses that resource to initiate and maintain a niche or niches on the airway mucosal surface in patients with chronic lung pathologies (, ). To achieve this, the bacterium rapidly needs to establish and develop the biofilm structure before being challenged by the host immune cells or anti-bacterial products secreted by the host cells. We have previously described how M. abscessus responds to the environmental conditions of the airways with the efficient formation of biofilm (). It is apparent that the bacterium uses the magnesium concentration in the mucus of cystic fibrosis patients to quickly adhere to the respiratory mucosa and develop a robust biofilm (). It is also puzzling that the pathogen uses the host DNA existing in the airways as a carbon source, which apparently also has a role in the transition from the planktonic to the biofilm phenotype ().

Considering all the accumulated pieces of information and adding the recent evidence that M. abscessus can be also transmitted among cystic fibrosis patients, in many cases, within the shared environment of a clinic waiting room or other facilities (), we hypothesized the bacteria being released from airway biofilms would most likely represent an infectious phenotype of the pathogen. In fact, the ability to detach from biofilm can be linked with additional site seeding in the airways which would have implications in the extension of the disease. Understanding the pathogenic mechanisms associated with the infection will allow for the development of prevention measures or potentially the elimination of the disease in the at-risk population.

To address the question, we established an in vitro set of assays to identify detached organisms and the genes associated with the ability. Our findings identified many genetic components pointing to an association with genes and encoded proteins linked to surface structures and the transport mechanisms that exist to export these proteins to the bacterial surface. Further studies determined that some of these proteins participate in the attachment to bronchial epithelial cells.

Materials and methods

Bacterial strains and growth

Mycobacterium abscessus subsp. abscessus strain 19977 was obtained from the American Type Culture Collection (ATCC). M. abscessus subsp. abscessus strains 00103 and 01715 (obtained from patients with cystic fibrosis) were a gift from Jerry Nick and Charles Daley from the National Jewish Health Hospital. All three strains were of the in vitro smooth phenotype. Unless otherwise noted, bacteria for assays were grown and maintained on Middlebrook 7H10 agar supplemented with 10% oleic acid, albumin, dextrose, and catalase (OADC; Hardy Diagnostics), referred to as 7H10. For liquid cultures, bacteria were grown in 7H9 broth supplemented with Tween-80 and OADC, referred to as 7H9. All the cultures were grown at 37°C for 3 to 5 days. The bacteria used in the assays were of the planktonic phenotype initially. Every assay was controlled by microscopic observation so that the inoculum completely dispersed.

Host cell tissue culture

Human monocyte THP-1 (TIB-202) and HEp-2 (CCL-23) pharyngeal epithelial cells were obtained from the ATCC and grown in RMPI-1640 (RPMI) and DMEM sterile media containing L-glutamine, 25 mM HEPES (Corning Life Sciences), and 10% fetal bovine serum (FBS, Gemini Bio-products, Sacramento, CA). Both cell types were obtained from the ATCC and maintained at 37°C with 5% CO2.

Generation of secondary biofilms in either HBSS or SCFM media

M. abscessus biofilms were formed by generating a turbid suspension of the bacteria in HBSS. Turbidity was measured via O.D. using an EPOCH spectrophotometer (Biotex) at 595nm to obtain a concentration of 3 x 108 CFU/mL. SCFM media were prepared as described previously (, ) and utilized as a biofilm formation condition in tandem with HBSS biofilm formation. For the biofilms formed in SCFM, bacteria were diluted to obtain 1 x 106 CFU/200 µL and biofilms formed in HBSS were diluted to obtain 1 x 107 CFU/200 µL. Secondary biofilms were established by collecting the supernatant from primary biofilms during the replicative stage (day 2) or non-replicative stage (day 5) of biofilm formation and then placed in fresh SCFM or HBSS. SCFM and HBSS were replaced with fresh media every 24 h so that the supernatants mainly contained released bacteria during biofilm formation. Secondary biofilms were established for 7 and 14 days. The biomass of the primary and secondary biofilms was quantified using the crystal violet assay () and absorbance was measured at 550 nm. CFU quantitation for the biofilms was obtained by mechanically disrupting the biofilms via pipetting, followed by serial dilutions and plating on 7H10 agar. Planktonic bacteria at 1 x 105, 1 x 106, and 1 x 107 CFU/mL served as biofilm controls.

Generation of the M. abscessus 19977 mycomarT7 transposon library

The M. abscessus transposon library was generated as described previously (). MycomarT7 (mmT7) is a temperature-dependent transposon-containing phagemid and was kindly provided by Eric Rubin (Harvard T.H. Chan School of Public Health, Boston, MA). MmT7 was propagated and titers were generated using M. smegmatis strain mc2 155 as described previously (). M. abscessus was grown in 7H9 broth supplemented with 10% OADC and 0.1% Tween-80 at 37°C in a shaking incubator before transduction. Bacteria were then pelleted and washed with MP buffer (150 mM NaCl, 50 mM Tris-HCl, 10 mM Mg2SO4, 2 mM CaCl2) twice. Washed bacteria were resuspended in MP and buffered and infected with mmT7 at an MOI of 2. The transduction commenced at 37°C for 4 hours with intermittent mixing. Aliquots were plated on 7H10 containing 400 µg/mL kanamycin to obtain individual transposon mutants. A selection of mutants was screened for the presence of mmT7 by amplifying the kanamycin resistance gene with PCR.

Screening the M. abscessus transposon library for deficiency in secondary biofilm formation

The SCFM and HBSS biofilm conditions were screened to identify mutants unable to release bacteria to form secondary biofilms. For the SCFM biofilms, individual mmt7 mutants were selected and cultured in 7H9 broth containing 400 µg/mL kanamycin for 4 days at 37°C in a shaking incubator using a 96-deep-well plate format. After 4 days, bacteria were pelleted and resuspended in HBSS. Fresh SCFM was aliquoted into a flat bottom 96-well plate, and 50 µL of each mutant suspension was added to the plate. Biofilms were formed for 7 days in the dark at 25°C with supernatant replacement after 2 days and then the resulting supernatant was carefully removed to form a secondary biofilm. These secondary biofilms were allowed to form for another 7 days and then the O.D. of the supernatant was measured along with the biomass of the biofilm using the crystal violet assay. Mutants were selected based on diminished secondary biofilm biomass and low O.D. in the corresponding supernatant compared to the wild-type.

For HBSS biofilms, individual mmt7 mutant colonies were added to a 48-well plate containing 7H9 broth media and allowed to grow for 3-4 days. Once mutants had grown to 3 x 108 CFU/mL, 100 µL of the bacteria was placed in 900 µL of HBSS in a fresh 48-well plate to form biofilm for 7 days in the dark at 37°C with supernatant replacement after 2 days. After 7 days, the supernatant was carefully removed without disturbing the transposon mutant biofilm and placed in another fresh well containing HBSS. The supernatant of each of these mutants was allowed to form biofilm for another 7 days, and the O.D. at 595 nm was measured, along with a visual inspection for opaqueness. Wells that matched the O.D. of HBSS alone or had a low O.D. were considered deficient in release or secondary biofilm formation. These mutants were selected for Sanger sequencing using an ABI 3730 capillary sequence machine within the Center for Quantitative Life Sciences (CQLS) at Oregon State University.

Identifying transposon insertion location within M. abscessus mutants

Transposon mutants were reconfirmed in duplicate before sequencing as previously described (). Briefly, mutants selected from the biofilm detachment screen were sequenced utilizing a previously reported LM-PCR assay with some changes (). Cells were lysed using 1-mm-diameter glass beads in diH2O via mechanical homogenization. Lysates were centrifuged for 1 minute at 21,000 x g to pellet cell debris. DNA was purified from collected supernatant using a DNA clean and concentrate kit (Zymo Research) following the manufacturer’s protocol. Furthermore, 150 ng of purified DNA was utilized for single digestion with SalI (Thermo fast-digest enzyme) for 30 minutes at 37°C. LM-PCR adapter oligos were generated for SalI (Salgd+Salpt, see Table 1) by adding 45 mM of each oligonucleotide to 1x Taq DNase buffer plus MgCl2 and ligating by decreasing the temperature from 80°C to 4°C over an hour. After digestion, DNA for each mutant was ligated with the adapter oligos using T4 DNase ligase. The ligated product was used as the template in the LM-PCR reaction. The LM-PCR reaction utilized Gold 360 MasterMix (Applied Biosystems) and was performed using 97°C for 7 min, 40 cycles of 97°C for 30 s, 58°C for 1 min, and 72°C for 1 min 45 s, and then a final step of 72°C for 10 min. PCR products were visualized using gel electrophoresis and ethidium bromide. The bands of interest were excised and purified using a gel extraction kit (Thermo) and sequencing at the Center for Quantitative Life Sciences (CQLS) at Oregon State University. Sequencing results were blasted in the NCBI against M. abscessus to identify disrupted genes.

Table 1

PrimerSequence (5’ to 3’)
Saldg (for both adapters)TAGCTTATTCCTCAAGGCACGAGC
Salpt (for SalI adapter)TCGAGCTCGTGC
pSalg R (for LMPCR reaction)GCTTATTCCTCAAGGCACGA
pMyco F1 (for LMPCR reaction)CCGGGGACTTATCAGCCAAC
pMyco F2 (for LMPCR reaction)ACCCGTGATATTGCTGAAGAG
MAB_4706ccompFAAAAAAtctagaGCCACAATCCGAAATTTGTT
MAB_4706ccompRTTTTTTaagcttTTTGGGCGACTAGGAAGCTA
Kan FATGACTGGGCACAACAGAC
Kan RTCGTCAAGAAGGCGATAGA

Primers used in the PCR, LM-PCR, and complementation assays.

Complementation of M. abscessus mutant MAB_4706c

The MAB_4706c gene with native promoters was complemented by the use of the integrative pMV306 plasmid as previously described () with some changes. First, an apramycin-resistance gene was cloned into pMV306 to generate the pMV306-Apr plasmid. Genes were cloned into pMV306-Apr using primers designed for these specific regions. This product was then transformed into electrocompetent DH10β E. coli and grown on LB containing 400 µg/mL kanamycin and apramycin. Positive colonies were used for colony PCR to confirm apramycin resistance and gene of interest ligation. These constructs were extracted using a Qiagen Mini Prep kit as per the manufacturer’s protocol. Electrocompetent M. abscessus mutant cells were prepared by washing plate-grown bacteria four times via centrifugation at 2000 x g at 4°C for 10 minutes in an ice-cold 10% glycerol and 0.1% Tween-80 solution. Cells were stored at -80°C in 10% glycerol until use. Plasmids were electroporated into M. abscessus competent cells using a 0.2cm cuvette (BioRad) at 2500 V, 1000Ω, and 25µF. Bacteria were recovered in 7H9 for 2 to 3 hours and plated onto 7H10 containing 400 µg/mL of kanamycin and apramycin and positive colonies were screened via PCR as described above.

Addition of monocytes to M. abscessus biofilms

Biofilms were established for 7 days in either HBSS or SCFM as described above. THP-1 monocytes were stimulated with 100 ng/mL of IFN-γ for 24 h prior to biofilm contact. After biofilm maturation, supernatants were removed and replaced with stimulated THP-1 monocytes (1x105 cells/well) in RPMI media. The biofilms were mechanically lysed at days 1, 2, and 3 post THP-1 addition to determine macrophage activity against these biofilms as quantified by CFUs. Activated THP-1 cells were also added during the replicative stage and non-replicative stage of biofilm formation by replacing supernatants with RMPI media followed by CFU determination at days 1 and 3 post contact with monocytes via serial dilution.

Infection and binding of host cells with M. abscessus biofilm phenotypes

THP-1 cells were seeded at 3 x 105 cells/500 µL of RPMI supplemented with 10% FBS containing 50 ng/mL phorbol 12-myristate 13-acetate (PMA) and incubated at 37°C. After 24 hours, PMA was removed and replaced with fresh complete media and incubated overnight at 37°C. Biofilms were formed as previously described in either HBSS or SCFM. At day 7, the biofilms were disrupted to release bacteria and then THP-1 macrophages were infected with primary biofilm or secondary biofilm bacteria for 1 hour, including a 10-min synchronization step at 150 x g. To kill extracellular bacteria, 200 µg/mL of amikacin was added to the monolayers for 2 hours. Cells were lysed post antibiotic treatment, at 24 hours, and 72 hours post infection. Lysates were serial diluted and plated on 7H10 agar for intracellular CFU quantification.

HEp-2 cells were seeded with DMEM media containing 10% FBS and allowed to achieve 90% confluency. Cells were then overlayed with ice-cold culture medium containing 106 CFU/mL bacteria to prevent internalization of bacteria by the epithelial cells. Wild-type M. abscessus 19977, secondary biofilm mutants, and a complemented strain were utilized for infection. The M. abscessus strains were allowed to bind to epithelial cells for 30 min at 4°C. Monolayers were then washed with ice-cold HBSS twice and lysed with 0.01% TritonX-100 and serially diluted on 7H10 agar for CFU determination.

Isolation of bacterial surface proteins and proteomic identification

To isolate surface proteins from bacteria, we utilized biotinylation followed by streptavidin-bound magnetic bead purification. We compared planktonic bacteria, bacteria with the biofilm phenotype in HBSS (7-day biofilm), bacteria that formed secondary biofilms in HBSS, and bacteria that formed secondary biofilms in SCFM. First, bacteria cells were washed twice with HBSS. After the 2nd wash, bacteria pellets were resuspended in 1 mg Sulfo-NHS-LC-biotin (Thermo Scientific) reconstituted in 1mL HBSS and then incubated for 30 min at 4°C with gentle rotation. Leftover biotin reagent was quenched with 10 mM glycine in HBSS for 10 min at room temperature under gentle rotation. Bacteria cells were washed twice with 1mL HBSS. After washing, the pellets were resuspended with GLIB buffer (10 mM EDTA, 2 mM EGTA, 0.1% tween-20, 6 M guanidinium HCl in PBS, pH 7.2) and then transferred to a 2 mL bead-beating tube with <0.1 mm glass beads.

Bacteria samples were lysed using an Omni Bead Ruptor (Omni Intl.) set to speed 4 with three cycles of 30 s between each cycle samples and were placed on ice to prevent degradation. To clear, the lysate samples were centrifuged for 1 min at room temperature at 21,000 x g. The supernatant was collected and passed through a 0.2 µm syringe filter to remove DNA and any large debris from the protein extract. The supernatant was transferred to a 2 mL protein lo-bind (Eppendorf) tube. Streptavidin Dynabeads (Thermo Scientific) were added to the extract and incubated for 1 hour in a rotary shaker at room temperature. The protein mixture was transferred into a µMacs magnetic column (Miltenyi Biotec). The beads were washed twice with GLIB buffer with an incubation step in between for 5 mins on a rotary shaker. After second GLIB wash, the beads were washed twice with PBS (0.05% tween-20 in PBS, pH 7.2) in a new clean tube with an incubation of 30 min on a rotary shaker at room temperature. Beads containing surface proteins were eluted in resuspension buffer (1% SDS, 10 mM EDTA in H2O) and then incubated at 65°C for 10 min to denature proteins from the beads for mass spectrometry.

To reduce the disulfide bonds of the proteins, the samples were incubated at 56°C for 1 hour with 5 mM dithiothreitol (ThermoFisher). The samples were then incubated with 10 mM iodoacetamide (MilliPore Sigma) for 1 hour at room temperature in the dark in order to carbamidomethylate the cysteine residues. The samples were digested overnight at 37°C using Trypsin Gold (Mass Spectrometry Grade, Promega). After digestion, the samples were spun down at 12,000 x g for 30 s to collect the condensate, and the digestion was stopped by the addition of 0.5% (v/v) trifluoroacetic acid. The samples were centrifuged at 12,000 x g for 10 minutes and then transferred to LC vials.

A Waters nanoAcquityTM UPLC system (Waters, Milford, MA) was coupled to an Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher Scientific). Peptides were loaded onto a trap 2G nanoAcquity UPLC Trap Column (180um, 50mm, 5um) at a flow rate of 5 μL/min for 5 min. The results were obtained on a commercially available Acquity UPLC Peptide BEH C18 column (100um, 100mm, 1.7um). The column temperature was maintained at 37°C using the integrated column heater. Solvent A was 0.1% formic acid in LC-MS grade water and solvent B was 0.1% formic acid in LC-MS grade acetonitrile. The separation was performed at a flow rate of 0.5 μL/min, and using linear gradients of 3% to 10% B for 10 min, 10% to 30% B for 10 min, 30% to 70% B for 5 min, 70% to 95% B for 3 min, 95% to 3% B for 4 min, and 95% to 3% B for 3 min. Total method length was 35 min. The outlet of the column was connected to a Thermo Nanospray Flex ion source and +2300V were applied to the needle.

MS1 spectra were acquired at a resolution of 120,000 (at m/z 200) in the Orbitrap using a maximum IT of 50 ms and an automatic gain control (AGC) target value of 2E5. For MS2 spectra, up to 10 peptide precursors were isolated for fragmentation (isolation width of 1.6 Th, maximum IT of 10 ms, and AGC value of 2e4). Precursors were fragmented by HCD using 30% normalized collision energy (NCE) and analyzed in the Orbitrap at a resolution of 30,000. The dynamic exclusion duration of fragmented precursor ions was set to 30 s. Raw files were processed in Thermo Proteome Discoverer 2.3. Precursor ion mass tolerance was set to 5 ppm, while fragment ion mass tolerance was 0.02 Da. The SequestHT search engine was used to search against the Swissprot human and M. abscessus protein database. Only b and y ions were considered for peptide spectrum matching. MS1 precursor quantification was used for label-free quantitation of the peptides. Protein abundances were calculated as the sum of the abundances of unique peptides detected.

Statistics

Statistical analyses were performed using GraphPad Prism 9 software. The comparisons between the treatment groups were analyzed using either t-tests or analysis of variance (ANOVA) with multiple comparisons where appropriate. Specific statistical tests are named in the figure legends in which they were used. A P-value of < 0.05 was considered significant.

Results

M. abscessus is able to form secondary biofilms

A key aspect of the biofilm formation cycle is the bacteria’s ability to detach from the biofilm and establish a secondary or satellite biofilm. Growing evidence has been mounting of patient-to-patient transmission in hosts that have cystic fibrosis, but more information is needed to ascertain this infectious phenotype of M. abscessus. Previous work in our lab showed that M. abscessus can form robust biofilms in synthetic cystic fibrosis media (SCFM), and specifically that the colony forming units (CFUs) of the biofilm do not increase after day 4, while the matrix biomass continues to increase over time (). Based on this, the capability of bacteria released from replicative stage biofilms and non-replicative stage biofilms to re-form biofilms was investigated. Supernatants of bacteria forming biofilms were carefully removed from wells on day 2 (replicative stage) and day 5 (non-replicative stage) and utilized to form biofilms. These secondary biofilms were developed in either a 1:1 ratio of supernatant to fresh media or unaltered transferred supernatant (Figure 1). Secondary biofilms were established for 7 and 14 days in Hank’s balanced salt solution (HBSS) or SCFM. The biomass was determined at both time points, and matched primary biofilms of wild-type bacteria were included under SCFM and HBSS formation conditions. Released bacteria from both the replicative stage (Figures 1A, B) and non-replicative stage biofilms (Figures 1C, D) were able to form secondary biofilms, especially when introduced to fresh media. The biomass of the SCFM biofilms formed with non-replicative stage bacteria matched the biomass of wild-type bacteria when added into fresh SCFM at both time points (Figures 1C, D). The biomass of the secondary biofilms transferred without fresh media remained significantly lower than the control groups in all conditions. There did not appear to be differences in the biomass of secondary biofilms formed by released bacteria in HBSS compared to wild-type bacteria except at day 14 for the replicative stage supernatants and day 7 for the non-replicative stage supernatants compared to the 107 bacteria control (Figures 1B, C, respectively).

Figure 1

Next, assays were performed to determine whether the replicative stage biofilm-released bacteria had any advantage in establishing secondary biofilms more quickly than the wild-type bacteria in SCFM conditions. For CFU determination, both the disrupted biofilms and released biofilms into the supernatant were enumerated. Similarly, the replicative stage released bacteria were placed in either a 1:1 ratio of supernatant to fresh SCFM media or unaltered transferred supernatant and the biomass and CFUs were measured at days 2, 5, and 7 during biofilm formation (Figure 2). As seen previously, all the conditions established more robust biomass by day 5, with day 7 staining showing the highest biomass [Figure 2A ()]. Unaltered supernatants were significantly increased by day 2; however, by days 5 and 7, the secondary biofilm biomass was less than the primary wild-type biofilms (Figure 2A). The secondary biofilms, when given fresh media, had similar biomass accumulation to the wild-type. The CFU/well was obtained for the bacteria in the biofilm or detached phenotypes (Figure 2B). Bacteria replication (CFU/mL) in the secondary biofilm conditions increased on day 2 but plateaued by day 5 whereas the supernatant phenotypes dropped on day 2 but then increased by day 5, suggesting the bacteria were switching to biofilm-formation phenotypes between days 0 and 2 but increased biomass formation at later time points. Taken together, M. abscessus is able to release bacteria from biofilms, and these bacteria can form secondary biofilms similar to those formed by the wild-type.

Figure 2

Comparison between M. abscessus 19977 with other M. abscessus strains isolated from patients with cystic fibrosis

To verify whether the results obtained were only observed with the M. abscessus 19977 strain or were also seen with other strains isolated from patients with cystic fibrosis, the ability of the strain M. abscessus 00103 and M. abscessus 01715 were evaluated in comparison with the strain M. abscessus 19977 regarding the efficiency to form a new biofilm once it detaches from an existing biofilm. The results shown in Table 2 suggest that all three strains behaved similarly and that detaching from a biofilm is a more efficient manner to establish a new biofilm than when bacteria were obtained from an agar plate.

Table 2

Bacterial strains1Biofilm mass2
From plateDay 2Day 5Day 7
199770.313 + 0.0210.718 + 0.0520.751 + 0.037
MAB 001030.202 + 0.0470.722 + 0.0390.756 + 0.026
MAB 017150.250 + 0.0330.704 + 0.0550.743 + 0.021
Satellite
199770.323 + 00160.857 + 0.0660.895 + 0.049
MAB 001030.303 + 0.0290.894 + 0.0340.884 + 0.037
MAB 017150.309 + 0.0260.862 + 0.0230.865 + 0.042

Ability of the strains of M. abscessus to form new biofilms after detachment.

(1) M. abscessus strains 19977 (wildtype), 00103 (CF patient), and 01715 (CF patient).

(2) All statistical comparisons between strains and conditions tested were p > 0.05.

Genes identified to play a role in bacterial release from biofilms

To better understand the mechanisms underpinning the release of M. abscessus from primary biofilms, an mmt7 transposon library was screened for mutant clones that do not release from primary biofilms in both HBSS and SCFM conditions. The mutants in this system were defined as being unable to establish a secondary biofilm. A supernatant containing released bacteria was utilized to form another biofilm, and each clone’s secondary biofilm was compared to that of the wild-type. In SCFM conditions, eight mutants were identified via ligation-mediated PCR (LM-PCR) and sequencing identified transposon insertion (Table 3). The transposon was inserted directly into two genes encoding hypothetical proteins [MAB_0274c (GXWXG domain), MAB_1222], although probable neighboring genes were affected if in an operon. Three membrane proteins [MAB_4706c (membrane-associated oxidoreductase complex, DoxX), MAB_2480 (Transmembrane), MAB_2301 (MmpL lipoprotein), MAB_0525c (LpqG lipoprotein)]. A chaperonin [MAB_0650 (GroEL)] and an enzyme [MAB_1277 (glycosyltransferase, modifies lipopolysaccharide]. In HBSS conditions, 15 mutants were selected and sequenced (Table 4). The transposon inserted into two tRNA’s (MAB_0275 and MAB_t5030c), along with two lipoproteins [MAB_3785c (LppF), MAB_0307c] and a translation elongation factor [MAB_1310 (BipA)]. Two genes encoded oxidoreductases [MAB_2438 (molybdopterin) and MAB_4628c]. One gene was a monooxygenase enzyme (MAB_4050c). A chaperonin [MAB_0650 (GroEL)] and a probable carbon starvation protein [MAB_1260c (CstA)] were also found. Two genes had domains suggesting kinase activity [MAB_3538 (DAGKc-domain) and MAB_1507 (hypothetical protein)]. An alkyl mercury lyase (MAB_4789c), a membrane protein [MAB_1170 (transports anions)], and transcriptional regulator (MAB_2089) were found. Further characterization is needed to understand the role these genes play in bacterial release from biofilms.

Table 3

Gene DisruptedProbable OperonProteinFunctionGC content (%)
MAB_4706cMAB_4710cTranscriptional regulator, TetR familyDNA binding67.9
MAB_4709cTranscriptional regulator, AraC familyDNA binding/response to environmental stimuli62.4
MAB_4708cGlyoxalase/bleomycin resistance proteinMetalloenzymes62.8
MAB_4707cLipaseLipid catabolic process65.6
MAB_4706cDoxX family proteinMembrane-associated oxidoreductase complex (MRC)60.5
MAB_4705cProbable membrane protein, MmpSMembrane protein, biosynthesis and secretion of siderophores61.3
MAB_4704cProbable membrane protein, MmpLMMPL family, lipid transport58.6
MAB_4703cProbable membrane protein, MmpLMMPL family, lipid transport59.6
MAB_4702cLow molecular weight t-cell antigen tb8.4Binds free heme in mycobacterial cytoplasm and then delivers to the membrane61
MAB_2480MAB_2480Transmembrane protein66.7
MAB_2481Integral membrane transporterMajor Facilitator Superfamily; Sugar (and other) transporter65.6
MAB_2482Possible monooxygenaseLuciferase-like monooxygenase63.4
between MAB_2301 MAB_2302MAB_2300Membrane protein, MmpSMembrane protein, biosynthesis and secretion of siderophores59.5
MAB_2301Membrane protein, mmpLMMPL family, lipid transport60.7
MAB_2302Probable conserved membrane protein, MmpSMembrane protein, biosynthesis and secretion of siderophores55.6
MAB_2303Membrane protein, MmpLMMPL family, lipid transport59.5
MAB_0274cMAB_0274cConserved hypothetical proteinGXWXG protein61.6
MAB_0273cHypothetical Protein64.3
MAB_0650MAB_065060 kDa chaperonin 2 (Protein Cpn60 2) (GroEL)TCP-1/cpn60 chaperonin family, ATP binding66.3
MAB_0525cMAB_0529cCoenzyme Q (Ubiquinone) biosynthesis protein Coq4Coenzyme Q (ubiquinone) biosynthetic pathway62.8
MAB_0528cProbable epoxide hydrolase EphACatalytic activity64.7
MAB_0527cPossible monooxygenase (Luciferase-like)Flavin monooxygenase62.6
MAB_0526cHypothetical zinc-type alcohol dehydrogenaseOxidoreductase activity62.6
MAB_0525cProbable conserved lipoprotein LpqG26 kDa periplasmic immunogenic proteins66.7
MAB_0524cProbable conserved lipoprotein LpqG26 kDa periplasmic immunogenic proteins69
MAB_1277MAB_1277Glycosyltransferase RgtA/B/C/D-like domainModification of the lipopolysaccharide (LPS) inner core66.2
MAB_1278O-acyltransferase WSD1-like N-terminal domainWax ester synthase-like Acyl-CoA acyltransferase domain67.7
MAB_1279Probable 3-demethylubiquinone-9 3-methyltransferase61.4
MAB_1222MAB_1218Probable aldehyde dehydrogenase AldAOxidizes a wide variety of aliphatic and aromatic aldehydes65.1
MAB_1219Probable short-chain dehydrogenase/reductaseNAD- or NADP-dependent oxidoreductases62.8
MAB_1220Probable dehydrogenase/reductaseOxidoreductase activity66.3
MAB_1221Possible 4-carboxymuconolactone decarboxylaseDegradation of aromatic compounds58.7
MAB_1222Conserved hypothetical protein62
MAB_1223Probable carboxylesterase (LipT)Carboxylesterase family, active site serine63.1
MAB_1224Conserved hypothetical protein62.8
MAB_1225ABC transporter, permease proteinTransport of various osmoprotectants and nutrients62
MAB_1226ABC transporter, ATP-binding proteinABC transporter61.4
MAB_1227ABC transporter, permease proteinTransport of various osmoprotectants and nutrients67.3
MAB_1228ABC transporter, Glycine betaineTransport system involved in bacterial osmoregulation62.1
MAB_1229Transmembrane protein66

Genes identified as deficient in releasing bacteria from SCFM biofilms.

Table 4

Gene DisruptedProbable OperonProteinFunctionGC content (%)
MAB_1260cMAB_1260cProbable carbon starvation protein (CstA)Uptake and utilization of peptides, during carbon starvation66
MAB_1259cHypothetical ProteinSelenoprotein65
MAB_1258cHypothetical Protein (Transmembrane protein)69
In between MAB_t5030c MAB_2089MAB_2088Transposase-like proteinDNA binding, transposition of insertion sequences65.5
MAB_2087Transposase-like protein IS3/IS911DNA binding61.4
MAB_t5030cMAB_t5030c63.8
MAB_2089Transcriptional regulatorDNA binding65.5
MAB_2090Nucleotidyl transferase AbiEii/AbiGii toxin family proteinType IV TA system, protects from phage infection65.2
MAB_2091PNPLA domain-containing proteinLipase and transacylase properties, roles in lipid and energy homeostasis65
MAB_2092NucleotidyltransferaseSecond Messenger Oligonucleotide or Dinucleotide Synthetase domain59.4
MAB_2093UBA/THIF-type NAD/FAD-binding foldUbiquitin E1-like enzymes that contain the NAD/FAD-binding fold63.6
MAB_2094Hypothetical protein58.4
MAB_2095Metal-dependent phosphohydrolase, HD subdomainPhosphohydrolase activity66.7
MAB_3785cMAB_3786cUncharacterized protein66
MAB_3785cProbable conserved lipoprotein LppFHaloacid dehalogenase-like hydrolase66.8
MAB_3784cPreprotein translocase secY subunitPreprotein translocase pathway62.2
MAB_3783cAdenylate kinaseCatalyzes the reversible transfer of MgATP to AMP66.7
MAB_3782cMethionine aminopeptidase Map66.9
MAB_4789cMAB_4789cAlkylmercury lyaseDetoxify mercurial compounds62.3
MAB_4788cMycothiol-dependent maleylpyruvate isomerase metal-bindingMetal-ion binding65.2
MAB_4787cHypothetical regulatory protein, TetR familyControls the expression of MmpL lipid transporters65.6
MAB_4786cHypothetical protein (small)63.3
MAB_2438MAB_2438Probable oxidoreductaseMolybdopterin oxidoreductase64.6
MAB_2439Fluoride-specific ion channel FluCEfflux transporter which confers resistance to fluoride ion68.2
MAB_2440Fluoride-specific ion channel FluCEfflux transporter which confers resistance to fluoride ion63.2
MAB_2441UspA domain-containing proteinProvides a general “stress endurance” activity62.4
MAB_1310MAB_1310Large ribosomal subunit assembly factor BipA50S ribosomal subunit assembly protein66.6
MAB_1311VOC domain-containing proteinGlyoxalase-like domain64.8
MAB_1312Beta-lactamase-likeAlkyl sulfatase dimerization63.1
MAB_1313Probable transcriptional regulator, AraC familyDNA binding60
MAB_1314Mesocentin67.2
MAB_1315Putative lipoprotein LpqWActive transport of solutes68.2
MAB_1316MshBMycothiol biosynthesis protein MshB66.8
MAB_1317Integral membrane protein64.7
MAB_0650MAB_065060 kDa chaperonin 2 (Protein Cpn60 2) (GroEL)TCP-1/cpn60 chaperonin family, ATP binding66.3
MAB_3538MAB_3538DAGKc domain-containing proteinKinase activity67.3
MAB_3539Transcriptional regulator WhiB67.1
MAB_4050cMAB_4059cTranscriptional regulator/sugar kinaseTranscriptional repressors, sugar kinases67.8
MAB_4058cSRPBCC family proteinPolyketide synthesis62.8
MAB_4057cD-inositol 3-phosphate glycosyltransferaseGlycosyltransferase of mycothiol biosynthesis66.8
MAB_4056cYbjN domain-containing protein62.7
MAB_4055cAcyl-CoA synthetaseAMP binding64.6
MAB_4054cPyridoxamine 5’-phosphate oxidase putative domain-containing proteinde novo biosynthesis of PLP59.5
MAB_4053cShort chain dehydrogenase/reductaseNAD- or NADP-dependent oxidoreductases67.3
MAB_4052cLipase/esterase67.5
MAB_4051cReductaseFerritin-like superfamily60.3
MAB_4050cProbable monooxygenaseFAD, NAD binding65.1
MAB_4049c2,3-bisphosphoglycerate-dependent phosphoglycerate mutaseCatalytic activity64.2
MAB_4048cSensor-like histidine kinase senX3OmpR family65.9
MAB_4047cSensory transduction protein RegX3OmpR family64.5
MAB_4046cPutative transcriptional regulator, TetR familyDNA binding63.4
MAB_4045cProbable ATP-binding protein ABC transporterBiosynthesis of coenzyme Q64
MAB_4044cPutative hydrolase/esterase/lipase65.8
MAB_4043cProbable short-chain dehydrogenase/reductaseNAD- or NADP-dependent oxidoreductases65.2
MAB_4042cProbable monooxygenaseOxidoreductase activity61.5
MAB_4041cPolyketide cyclase/dehydrase and lipid transportPolyketide synthesis64.2
MAB_4040cConserved Hypothetical Protein61.3
MAB_4039cProbable monooxygenaseOxidoreductase activity62.5
MAB_4038cPolyketide cyclase/dehydrase and lipid transportPolyketide synthesis65.9
MAB_0275MAB_0275Queuine tRNA-ribosyltransferase (TGT)65.4
MAB_0276Probable cytochrome P450Superfamily of heme-containing mono-oxygenases63.1
MAB_0307cMAB_0306cLipoprotein64.2
MAB_0307cLipoprotein60.7
MAB_0308cLipoprotein LpqN63.2
MAB_1507MAB_1507Conserved hypothetical proteinKinase activity62.7
MAB_1170MAB_1170Probable membrane transporter proteinTauE, transport of anions across the cytoplasmic membrane67.8
MAB_1169Hydrolase, alpha/beta fold65.3
MAB_1168ExopolyphosphataseSugar kinase/actin/hsp70 superfamily67.5
MAB_1167Septum formation initiator subfamily protein67.9
MAB_1166Septum formation initiator71.7
MAB_1165Enolase66.9
MAB_1164Conserved lipoprotein LpqULysozyme-like domain superfamily68.1
MAB_4628cMAB_4628cLuciferase-like monooxygenaseOxidoreductase activity63.4

Genes identified as deficient in releasing bacteria from HBSS biofilms.

Released M. abscessus are able to bind and invade epithelial cells

M. abscessus lung infections are associated with biofilms, however, the infection likely originates with bacteria released from a biofilm in an environmental setting or from another patient. The bacteria encounter the lung epithelium and must be able to invade or establish a niche to form biofilms (). The ability of M. abscessus to bind to respiratory epithelial cells was assayed by utilizing the wild-type M. abscessus 19977 and secondary biofilm mutants from the previous section (Figure 3). Unfortunately, no secondary biofilm mutants from SCFM demonstrated a significant reduction in binding epithelial capacity compared to the wild-type (Figure 3A). Six HBSS secondary biofilm mutants had significantly inhibited binding compared to wild-type M. abscessus 19977 (Figure 3B). Three of these binding deficient mutants are hypothetical proteins [MAB_1170 (membrane transporter for anions), MAB_4789c (Alky mercury lyase in an operon with TetR gene for regulating MmpL transporters), and MAB_1507 (conserved hypothetical protein with kinase activity)]. The observation of kinases and more transporter regulation are also key factors in the binding to epithelial cells and not just for the release from biofilms. Other mutants may encode enzymes or signals that are involved in the interaction with epithelial cells. Next, released bacteria from both the SCFM and HBSS biofilms were collected 7 days after formation and utilized to infect epithelial cells. The bacteria released from the biofilms, whether formed in HBSS or SCFM, significantly increased the invasion of epithelial cells compared to planktonic M. abscessus after 1 hour of infection (Figure 4). This finding further supports the hypothesis that the released bacteria phenotype from established biofilms is an adaptation suited not only for reforming biofilms but also establishing an infection in the lungs.

Figure 3

Figure 4

Complementation of MAB_4706c restores the binding and secondary biofilm formation phenotype

MAB_4706c was cloned into pMV306 containing an apramycin-resistance gene and transformed into electrocompetent mutant MAB_4706c cells. Complemented MAB_4706c (ΔMAB_4706c) was tested against wild-type and mutant cells in its ability to form satellite biofilms and bind to epithelial cells (Figure 5). Secondary biofilms were formed in SCFM with wild-type, mutant 4706c, and ΔMAB_4706c, and absorbance readings were taken after 7 days (Figure 5A). ΔMAB_4706c had a similar optical density (O.D.) to wild-type M. abscessus 19977, while mutant 4706c biofilms had significantly decreased absorbance readings, suggesting complementation restores the bacteria’s ability to disperse from primary biofilms. The epithelial binding assay was repeated using the wild-type, mutant, and complemented bacteria (Figure 5B). ΔMAB_4706c had a similar binding capability to wild-type M. abscessus 19977, also restoring this phenotype. Taken together, the genes in the MAB_4706c operon play a major role in M. abscessus biofilm release and secondary attachment to the respiratory epithelium. MAB_4706c and MAB_4702c are both hypothetical proteins, while 4705c, 4704c, and 4703c are all membrane proteins in the MmpL family.

Figure 5

Primary biofilm and secondary biofilm formation phenotypes of M. abscessus are able to invade macrophages and evade killing mechanisms

Macrophages are the first immune cells that bacteria encounter in the lung environment, whether they are circulating airway macrophages or tissue macrophages after penetrating the epithelial layer. Mycobacteria are obligate intracellular pathogens and can disseminate the infection by infecting secondary macrophages in a transitionary manner. The ability of the bacteria collected from primary biofilms and those of released bacteria to form secondary biofilms means they are able to invade and replicate in macrophages (Figure 6). Disrupted primary biofilm bacteria were more efficient at invading macrophage monolayers compared to planktonic bacteria (Figure 6A). Both released bacteria and disrupted biofilm phenotypes were able to grow by day 3 within the macrophages (Figures 6B, D). Bacteria released from secondary biofilms had a similar uptake to plate bacteria but may not necessarily confer an advantage (Figure 6C). Overall, M. abscessus released from biofilms or in the biofilm phenotype were able to invade and grow intracellularly, regardless of whether the biofilms were made in SCFM or HBSS.

Figure 6

Next, IFN-γ-stimulated monocytes were added to mature biofilms in both SCFM and HBSS to determine whether the cells could eliminate biofilm CFUs (Figure 7). Monocytes did not decrease any of the biofilm CFUs at all time points: 24, 48, and 72 hours post addition (Figure 7A). Planktonic bacteria were significantly reduced by monocytes compared to the bacteria protected by biofilms. THP-1 monocytes were also added during the biofilm formation process in replicative stage biofilm (day 2) and non-replicative stage biofilm (day 5) (Figures 7B, C, respectively). The addition of phagocytic cells to biofilms did not contribute to a decrease in biofilm CFUs during the replication stage. However, during the stationary phase, biofilms established in HBSS were significantly reduced by day 3 compared to the HBSS or SCFM biofilm control. As before, the planktonic bacteria control had a significant reduction in CFUs compared to its biofilm counterparts. Taken together, bacteria released from biofilms or in the biofilm phenotype are able to combat macrophage killing but only confer an advantage if formed in SCFM and during the non-replicative stage of formation.

Figure 7

Bacterial surface proteins

The release of bacteria from biofilms may express a set of different proteins on the surface that then make them more capable of seeding and infecting different sites or hosts. We compared planktonic bacteria grown in 7H10 agar, bacteria with the biofilm phenotype (7 days biofilm), bacteria released from biofilm when in Middlebrook 7H9 broth, and bacteria released from biofilm in SCFM. The results, shown in a Venn diagram, demonstrated that bacteria released from biofilm expressed significantly more proteins than bacteria grown in plates (Figure 8). The bacteria found in biofilms accounted for 295 of the 380 proteins detected and are summarized in Tables 515. Planktonic bacteria accounted for 85 of the 380 proteins and are summarized in Tables 5, 6, 8, 15 and all the listed proteins overlapped with the other treatment groups examined. The bacteria released from biofilms expressed more proteins on their surface, suggesting a remarkable change in phenotype. It is notable that many of the proteins were different lipoproteins, of a small size, and uncharacterized, and there were many types of enzymes. We compared the transposon mutants that were found deficient in secondary biofilm formation to the surface proteins detected. Three mutants, MAB_0525c (all treatments), MAB_2301 [planktonic, secondary BF (7H9), secondary BF (SCFM), and primary BF (7H9)], and MAB_3538 [secondary BF (7H9) and secondary BF (SCFM)] were found in the proteomic lists. Interestingly, the latter mutant, MAB_3538, with kinase activity, was only found in the released biofilm groupings.

Figure 8

Table 5

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MFZ3NLPC_P60 domain-containing protein45044.3MAB_3664

Surface proteins unique to planktonic bacteria, primary biofilm (BF) (7H9), and secondary BF (7H9).

Table 6

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MNX2Uncharacterized protein24926.9MAB_1940c
2B1MKD0Probable membrane protein, MmpL981107.3MAB_1134c
3B1MAN4Conserved hypothetical membrane protein31733.6MAB_2224c
4B1MAW1Putative membrane protein, mmpL984107.9MAB_2301
5B1MB89Probable NADH dehydrogenase (NDH)48452MAB_2429c
6B1MCR7Uncharacterized protein68273.5MAB_2960
7B1MLX5Possible lipoprotein peptidase LpqM48452.4MAB_1466c
8B1MB39Hypothetical lipoprotein LpqH16215.6MAB_2379
9B1MGH4Uncharacterized protein (SHOCT domain-containing protein)26628.8MAB_3845c
10B1MMD6Probable cation-transporting ATPase G65366.6MAB_4853c
11B1MJ98Probable cation-transporting ATPase E80084.1MAB_0962
12B1MNZ9Cytochrome bc1 complex cytochrome c subunit29531.1MAB_1968c
13B1MMM0Uncharacterized protein1144118.4MAB_4937
14B1MDL5Uncharacterized protein24526.9MAB_3258c
15B1MG09Strictosidine synthase family protein34235.9MAB_3680
16B1MFL7MurNAc-LAA domain-containing protein27227.8MAB_0318c
17B1MKQ2Uncharacterized protein (lipid droplet-associated protein)23125.1MAB_1256c
18B1MEJ2Iron-sulfur cluster-binding protein, RIESKE family51758.1MAB_0156c
19B1MC44Probable macrolide ABC transporter, ATP-binding protein54258.6MAB_2736c
20B1MKK5Isoprenyl transferase26029.5MAB_1209
21B1MBM0Uncharacterized protein (LGFP repeat)20120.5MAB_2560
22B1MI34Uncharacterized protein (CAS/CSE protein)30632.7MAB_0760c
23B1MAY5Putative short-chain dehydrogenase/reductase31833.8MAB_2325
24B1MFL0FAD-binding PCMH-type domain-containing protein45651.2MAB_0311c

Surface proteins identified in planktonic bacteria, secondary biofilm (BF) (7H9), and secondary BF (SCFM).

Table 7

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MJ65Uncharacterized protein (p-aminobenzoate N-oxygenase AurF)35140.3MAB_0929
2B1MKG2Uncharacterized protein (Septum formation initiator)21322.4MAB_1166
3B1MAK0DUF4333 domain-containing protein27128.7MAB_2190
4B1MJ23Hypothetical lipoprotein lpqH15815.5MAB_0885c
5B1MAN6Conserved hypothetical transmembrane protein46247MAB_2226c
6B1MIZ5Putative Fe-S oxidoreductase976103.7MAB_4293
7B1MIG7Putative membrane protein, MmpL987107.6MAB_4115c
8B1MIS4Uncharacterized protein44247.3MAB_4222
9B1MK70Putative membrane protein, MmpL1001107.6MAB_4508
10B1MIW6Uncharacterized protein (secreted)24326.9MAB_4264c
11B1MB68Uncharacterized protein (von Willebrand factor, type A)61162.9MAB_2408c
12B1MMP0Uncharacterized protein788.4MAB_1516
13B1MII0Uncharacterized protein26327.8MAB_4128c
14B1ME75Possible serine/threonine phosphatase Ppp50152.3MAB_0037c
15B1MIG8Putative membrane protein, MmpL959104.1MAB_4116c
16B1MGJ6Uncharacterized protein (Inhibition of morphological differentiation protein)29331.2MAB_0431c
17B1MHK5Uncharacterized protein41844.5MAB_4012c
18B1MAP0Hypothetical PPE family protein52353.9MAB_2230c
19B1MAW3Putative membrane protein, MmpL997109.7MAB_2303
20B1MB23Uncharacterized protein (Channel-forming protein)31031.9MAB_2363
21B1MB79PknH_C domain-containing protein26928.6MAB_2419c
22B1ME72Putative serine/threonine-protein kinase PknA42044.2MAB_0034c
23B1MPH0NADH-quinone oxidoreductase79284MAB_2140
24B1MFV7Bifunctional membrane-associated penicillin-binding protein PonA2/glycosyl transferase81185.2MAB_0408c
25B1MGB9Possible protease IV SppA (Endopeptidase IV)58361.6MAB_3789c
26B1MIZ3Uncharacterized protein (Proline-rich protein)60562.8MAB_4291
27B1MMP8Uncharacterized protein (CBS domain-containing protein)42946.8MAB_1524c
28B1MIQ8Putative amino acid transporter51354.6MAB_4206
29B1ML01NAD(P) transhydrogenase subunit beta48149.7MAB_4577c
30B1MEW8UPF0182 protein MAB_3498c988107.1MAB_3498c
31B1MNZ8Probable ubiquinol-cytochrome c reductase iron-sulfur subunit (Rieske iron-sulfur protein)39142.9MAB_1967c
32B1MF58Lipoprotein LpqB58461.7MAB_3589c
33B1MEU5Cell division ATP-binding protein FtsE22925.6MAB_3475c
34B1MEM5Probable arabinosyltransferase C1085116.7MAB_0189c
35B1MPH3NADH-quinone oxidoreductase subunit J25927.1MAB_2143
36B1MGU8ATP-dependent zinc metalloprotease FtsH75080.5MAB_0533
37B1MJ91Probable sensor histidine kinase PrrB47050.6MAB_0955c
38B1MCV2Trk system potassium uptake protein CeoC21923.8MAB_2995
39B1MCI8Protein translocase subunit SecD58661.4MAB_2880c
40B1MB57Protein translocase subunit SecA77284.8MAB_2397
41B1MLG6Probable short-chain dehydrogenase/reductase26828.9MAB_1305
42B1MPE7Hypothetical short-chain dehydrogenase/reductase29331MAB_2117
43B1MHE0Possible oxidoreductase29531.9MAB_3947
44B1MDZ7Probable FeIII-dicitrate-binding periplasmic lipoprotein34636.2MAB_3390
45B1ML03Probable NAD(P) transhydrogenase, alpha1 subunit PntAA36237.4MAB_4579c
46B1MJQ0Putative short-chain dehydrogenase/reductase28329.6MAB_4335
47B1ME27Putative short-chain dehydrogenase/reductase29431.9MAB_3420c
48B1MJH3Putative short-chain dehydrogenase/reductase24926.2MAB_1039
49B1MEK1Putative acyltransferase26829.1MAB_0165
50B1MCE3Uncharacterized protein (Deazaflavin-dependent nitroreductase)14215.2MAB_2835
51B1MHK2Uncharacterized protein (Deazaflavin-dependent nitroreductase)15116.8MAB_4009c
52B1MJQ4Saccharopine_dehydrogenase_NADP domain-containing protein41544.3MAB_4339c
53B1MH29Putative acyl-CoA dehydrogenase38742.8MAB_0615
54B1MJI2Probable class II aldolase26829.3MAB_1048c
55B1MIL0Probable acyl-CoA dehydrogenase FadE39243.1MAB_4158
56B1MH42AAA_31 domain-containing protein1041109.9MAB_0628
57B1MJY6Putative succinate dehydrogenase, iron-sulfur subunit24828.4MAB_4423
58B1MNU9Diacylglycerol O-acyltransferase45749.5MAB_1917
59B1MNU7Probable fatty-acid-coa ligase FadD60065MAB_1915
60B1MB08Possible long-chain acyl-CoA synthase989105.5MAB_2348
61B1MKW1Uncharacterized protein (L,D-ATPase catalytic domain-containing protein)33335.7MAB_4537c
62B1MLH3Beta-lactamase-like63369.4MAB_1312
63B1MEL5Probable fatty-acid-CoA ligase FadD63768.9MAB_0179
64B1MGS2Diacylglycerol O-acyltransferase46150.3MAB_0507
65B1MFZ9Adenosine deaminase36239.4MAB_3670c
66B1MHH4Probable zinc metalloprotease69175.8MAB_3981c
67B1MEL2Antigen 85-A33335.8MAB_0176
68B1MEL3Antigen 85-A/B/C32534.9MAB_0177
69B1MB96Uncharacterized protein (Alanine and proline-rich secreted protein Apa)34434.8MAB_2436
70B1MEL1Antigen 85-C32434.7MAB_0175
71B1MDH6Chromosomal replication initiator protein DnaA49155MAB_0001

Surface proteins unique to primary biofilm (BF) (7H9), secondary BF (7H9), and secondary BF (SCFM).

Table 8

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MLS5Putative lipoprotein LprB19520.6MAB_1416

Unique proteins identified in planktonic bacteria and secondary biofilm (SCFM).

Table 9

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MID7Uncharacterized protein44749.5MAB_4085c
2B1MJV4Putative ABC transporter, periplasmic substrate-binding33034.7MAB_4390
3B1MK78Hypothetical porin (MspA)22323.4MAB_1080
4B1MJB0Uncharacterized protein (PE-PGRS family protein)60661.2MAB_0974

Surface proteins unique to primary biofilm (BF) (7H9) and secondary BF (7H9).

Table 10

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MAX9Lysylphosphatidylglycerol biosynthesis bifunctional protein LysX1110122.1MAB_2319c

Surface proteins unique to primary biofilm (BF) (7H9) and secondary BF (SCFM).

Table 11

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MM28Putative membrane protein, MmpS14715.2MAB_4745
2B1MGS5Probable non-ribosomal peptide synthase1342141.6MAB_0510c
3B1MKJ2Proline-rich antigen (36 kDa antigen)19019.5MAB_1196
4B1MEE6Conserved hypothetical membrane protein22223.3MAB_0110c
5B1MDT9Uncharacterized protein (DoxX family protein)26828.4MAB_3332c
6B1MC32VWFA domain-containing protein33635.9MAB_2724c
7B1MFX2Conserved hypothetical membrane protein17318.7MAB_0423c
8B1MEM8Probable oxidoreductase50755.1MAB_0192c
9B1MHI8Uncharacterized protein (hydrolase)30532.6MAB_3995
10B1MEF0Uncharacterized protein37140MAB_0114
11B1MKI6Uncharacterized protein28129MAB_1190
12B1MJG4Uncharacterized protein13615.7MAB_1030
13B1MP25Probable conserved lipoprotein LppM22624.1MAB_1994c
14B1MK66Uncharacterized protein48152.4MAB_4504c
15B1MHY2Uncharacterized protein60065.4MAB_0708
16B1MGV4Conserved hypothetical transmembrane protein49353.7MAB_0539
17B1MBP9Uncharacterized protein25728.9MAB_2589c
18B1MHR9Uncharacterized protein31332.4MAB_4077
19B1ML18Putative Mce family protein45247.6MAB_4594c
20B1MB71Uncharacterized protein (CBS domain-containing protein)45348.1MAB_2411c
21B1MJY4Putative succinate dehydrogenase26930.7MAB_4421
22B1MG85Putative FtsK/SpoIIIE family protein1311142.3MAB_3756c
23B1MJD8Uncharacterized protein22924.6MAB_1004c
24B1ML23Putative Mce family protein51052.6MAB_4599c
25B1MM24Putative terminal quinol oxidase, subunit I34137MAB_4741c
26B1MP49Uncharacterized protein15415.8MAB_2018
27B1ML20Putative Mce family protein37940.2MAB_4596c
28B1MCI2Probable peptidyl-prolyl cis-trans isomerase30732.3MAB_2874
29B1MEK9UbiA prenyltransferase family protein30432.8MAB_0173
30B1MKU5Uncharacterized protein (AI-2E family transporter)39941.8MAB_4521c
31B1ME28Uncharacterized protein29131MAB_3421
32B1MIY5Uncharacterized protein (Dynamin N-terminal domain-containing protein)62768.5MAB_4283c
33B1MNZ5Uncharacterized protein24024.2MAB_1964
34B1ME59DUF3566 domain-containing protein31333MAB_0020
35B1MJI6Uncharacterized protein27228.4MAB_1052c
36B1MB80PknH_C domain-containing protein25126.5MAB_2420c
37B1MNZ7Probable ubiquinol-cytochrome c reductase cytochrome b subunit54660.4MAB_1966c
38B1MPG9NADH-quinone oxidoreductase subunit F43446.7MAB_2139
39B1MAF6NADH-quinone oxidoreductase, M subunit NuoM53556.8MAB_2146
40B1MK76Putative serine protease43743.4MAB_1078
41B1MFX0Possible membrane-associated serine protease42143.3MAB_0421
42B1MH83Probable histidine kinase response regulator56760.1MAB_3890c
43B1MGH1Probable cationic amino acid transport integral membrane protein49151.3MAB_3842
44B1MM45DUF3533 domain-containing protein64868.5MAB_4762
45B1MEN9Probable o-antigen/lipopolysaccharide transport ATP-binding protein ABC transporter RfbE26328.7MAB_0203c
46B1MAS1Hypothetical ABC transporter ATP-binding protein58261.7MAB_2261c
47B1MF69Putative cation transporter30732.4MAB_3600c
48B1MN95Membrane protein OxaA36140.4MAB_4953c
49B1MPG7NADH-quinone oxidoreductase subunit D43247.6MAB_2137
50B1ML95Probable ABC transporter, permease protein36838.7MAB_4672c
51B1MP37UDP-N-acetylglucosamine–N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase38240.1MAB_2006
52B1MEU4Cell division protein FtsX30032.8MAB_3474c
53B1MEM2Probable arabinosyltransferase A1097116.5MAB_0186c
54B1MEH0Probable pyruvate dehydrogenase57962.1MAB_0134c
55B1MJH6Cytochrome c oxidase subunit 152057.7MAB_1042c
56B1MLV8ATP synthase subunit b17718.5MAB_1449
57B1MPG6NADH-quinone oxidoreductase subunit C22825.6MAB_2136
58B1MDZ6Cytochrome c oxidase subunit 156462.6MAB_3389c
59B1MAN5Probable peptidase46146.5MAB_2225c
60B1MF59Probable sensor histidine kinase MtrB57662.6MAB_3590c
61B1MNV9Putative sensor-type histidine kinase PrrB42945.8MAB_1927
62B1MEU7MscS Mechanosensitive ion channel35038MAB_3477c
63B1MIU8Putative Na+/H+ antiporter55559.1MAB_4246
64B1MGL4Probable copper-transporting ATPase64666.9MAB_0449
65B1MLN4Probable sugar ABC transporter, ATP-binding protein SugC39142MAB_1375
66B1MFQ4Ammonium transporter44145.6MAB_0355
67B1MAS2Hypothetical ABC transporter ATP-binding protein86293.9MAB_2262c
68B1MKF5Putative iron permease FTR168371.6MAB_1159
69B1MCU8Na(+)/H(+) antiporter NhaA44146.2MAB_2991c
70B1MGB4Protein translocase subunit SecY41945.6MAB_3784c
71B1MCI7Protein-export membrane protein SecF42445MAB_2879c
72B1MPD4Dihydroorotate dehydrogenase (quinone)35337.2MAB_2104c
73B1MHZ3Putative oligopeptide ABC transporter,solute-binding protein52858MAB_0719
74B1MFX5Probable peptide ABC transporter DppA53959.7MAB_0426
75B1MC01Uncharacterized protein (nitroreductase)14516.1MAB_2692c
76B1MEK2Putative acyltransferase25427.7MAB_0166
77B1ML94Probable ABC transporter, ATP-binding protein23825.1MAB_4671c
78B1MJE4Putative MCE family protein49852.1MAB_1010c
79B1MN49Isoprenyl transferase30234.6MAB_1676
80B1MDD7Probable lipoprotein LppI23524.1MAB_3181
81B1MLK3Probable fatty-acid-CoA ligase FadD59665MAB_1342
82B1MF08DAGKc domain-containing protein32534.7MAB_3538
83B1MH44CbiA domain-containing protein63867.9MAB_0630
84B1MCU4Uncharacterized protein (Outer membrane receptor protein)17518.7MAB_2987
85B1MNT8Pyridoxamine 5’-phosphate oxidase-related26728.2MAB_1906
86B1MD78Putative acyl-CoA dehydrogenase41344.6MAB_3122
87B1MGZ0Putative ABC transporter ATP-binding protein26128.3MAB_0576c
88B1MGW2Putative iron compound ABC transporter33035.8MAB_0547c
89B1MGE0Putative hydrolase, alpha/beta fold28631.5MAB_3810
90B1MGD1Uncharacterized protein (VCBS repeat-containing protein)17918.5MAB_3801c
91B1MPG8NADH-quinone oxidoreductase, E subunit NuoE24726.7MAB_2138
92B1MBT5Putative ABC transporter/extracellular ligand-binding receptor39440.9MAB_2626c
93B1MGY1Putative lipoprotein lpqE22723.2MAB_0567c
94B1MH09Probable acyl-CoA dehydrogenase FadE38642.5MAB_0595c
95B1MGC0Uncharacterized protein (Sensor domain-containing protein)52756.9MAB_3790
96B1MGM8Probable oxidase (Copper-binding protein)51254.1MAB_0463c
97B1MHH6Uncharacterized protein (Lipoprotein)19420.4MAB_3983c
98B1MH57Putative short-chain dehydrogenase/reductase30432.2MAB_0643
99B1MMK7Uncharacterized protein (proline rich 28 kDa antigen)32132MAB_4924
100B1MEX3Putative ABC transporter, ATP-binding protein47452.3MAB_3503
101B1MM44Uncharacterized protein (ABC transporter)24126MAB_4761
102B1MP15Probable 1-acylglycerol-3-phosphate O-acyltransferase24526.7MAB_1984
103B1MLZ8Probable acyl-CoA ligase FadD59864.2MAB_1489
104B1MJ71Putative fatty-acid–CoA ligase FadD57261.9MAB_0935c
105B1MDX4Putative fatty-acid-CoA ligase1163127.5MAB_3367
106B1MPF0Putative polyketide synthase MbtC44145.4MAB_2120c
107B1MCR9Probable fatty-acid-CoA ligase FadD1184127.8MAB_2962
108B1MB93Molybdenum ABC transporter ModA, periplasmic27327.4MAB_2433
109B1MG92Cutinase22823.5MAB_3763
110B1MNN1Neutral metalloproteinase34737.2MAB_1849
111B1MFL1Enolase42444.1MAB_0312c
112B1MN45GTPase Era30433.4MAB_1672
113B1MEI3Uncharacterized protein (ESX secretion-associated protein EspG)24726.5MAB_0147c

Surface proteins unique to secondary biofilm (BF) (7H9) and secondary BF (SCFM).

Table 12

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MN43Uncharacterized protein (VBS domain-containing protein)43546.9MAB_1670

Surface proteins unique to primary biofilm (7H9).

Table 13

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MP27Conserved hypothetical transmembrane protein13414.3MAB_1996
2B1MJD9Putative MCE family protein41644.3MAB_1005c
3B1MET1Uncharacterized protein (Nitroreductase)14216.1MAB_3461c
4B1MCG8Uncharacterized protein (Deazaflavin-dependent nitroreductase)14816.3MAB_2860c
5B1MF62Possible Mg2+ transport P-type ATPase C MgtC24025.4MAB_3593
6B1MPH1NADH-quinone oxidoreductase subunit H42245.3MAB_2141
7B1MJK950S ribosomal protein L32576.6MAB_1075
8B1MJL2Uncharacterized protein55455.4MAB_4296c
9B1MFZ2Uncharacterized protein (protein secretion)10810.7MAB_3663
10B1MGX74HBT domain-containing protein18219.2MAB_0563
11B1ME15Uncharacterized protein (Maleypyruvate isomerase family mycothiol-dependent enzyme, MDMPI)24526.7MAB_3408c
12B1MDU0Probable conserved lipoprotein LppZ38739.9MAB_3333
13B1MBY8Uncharacterized protein (PE-PGRS family protein)57657.9MAB_2679
14B1MPE9Putative polyketide synthase MbtD1010108.2MAB_2119c
15B1MCS0Probable fatty-acid-CoA ligase FadD1183128.2MAB_2963

Surface proteins unique to secondary biofilm (7H9).

Table 14

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MCA2Uncharacterized protein (low molecular weight protein antigen 6 PH domain-containing)15016.3MAB_2794c
2B1MLN0Conserved hypothetical transmembrane protein17318.3MAB_1371
3B1MJY7Uncharacterized protein (Polyketide cyclase/dehydrase and lipid transport)20221.6MAB_4424
4B1MDE2Phosphatidate cytidylyltransferase29230.5MAB_3186c
5B1MHG6Possible cytochrome C-type biogenesis protein CcsA32335.1MAB_3973c
6B1MJE2Putative MCE family protein34838.1MAB_1008c
7B1ML21Putative Mce family protein34638.3MAB_4597c
8B1MDC6Probable protease/peptidase41544.4MAB_3170c
9B1MMW0Probable fatty acid desaturase40346MAB_1587c
10B1MP19Probable serine/threonine protein kinase43446.6MAB_1988c
11B1MKM5Uncharacterized protein46549.4MAB_1229
12B1ME36Putative integral membrane protein46750.7MAB_3429
13B1MMK9Uncharacterized protein45851.8MAB_4926
14B1MG86Uncharacterized protein (EccD-like transmembrane domain-containing protein)51152.2MAB_3757
15B1MHG7Putative cytochrome C biogenesis protein ResB53558.5MAB_3974c
16B1MDA0Putative ABC transporter, ATP-binding protein65267.3MAB_3144
17B1ME06Probable ABC transporter, ATP-binding62370.4MAB_3399
18B1MEP1Uncharacterized protein (alanine and leucing rich)66271.2MAB_0205c
19B1MJG5Divalent metal cation transporter MntH40943MAB_1031c
20B1MAL6Apolipoprotein N-acyltransferase60264MAB_2206
21B1MDK8Sensor protein KdpD83588.6MAB_3251c
22B1MEM1Probable arabinosyltransferase B1071116.2MAB_0185c
23B1MLS6Putative lipoprotein LprC18519.4MAB_1417
24B1MBT2Branched-chain amino acid ABC transporter (LivG)31434.4MAB_2623c
25B1MBT2SGNHhydro domain-containing protein33535.1MAB_1193c
26B1MIS5Probable glutamine-binding protein GlnH32735.9MAB_4223
27B1ML22Putative Mce family protein35037.8MAB_4598c
28B1MKW8Diacylglycerol O-acyltransferase45749.5MAB_4544c

Surface proteins unique to secondary biofilm (SCFM).

Table 15

AccessionDescription# AAsMW [kDa]Ensembl Gene ID
1B1MLV9ATP synthase subunit b-delta44847.6MAB_1450
2B1MLW0ATP synthase subunit alpha54858.8MAB_1451
3B1MLW3ATP synthase epsilon chain12113.1MAB_1454
4B1ME62Cell wall synthesis protein CwsA13413.6MAB_0024c
5B1MAP3Conserved hypothetical membrane protein52154.6MAB_2233c
6B1MN13Elongation factor 461768MAB_1640
7B1MLW1ATP synthase gamma chain30833.1MAB_1452
8B1ME71Probable serine/threonine-protein kinase PknB62867MAB_0033c
9B1MH53Phosphatidylserine decarboxylase proenzyme23725MAB_0639c
10B1MLW2ATP synthase subunit beta47651.7MAB_1453
11B1MG88Uncharacterized protein (Type VII secretion protein EccB)49352MAB_3759c
12B1MDJ8Signal recognition particle receptor FtsY45847.8MAB_3241c
13B1MF49Protein translocase subunit SecA929103.9MAB_3580c
14B1MEY4Possible transmembrane cation transporter36138.6MAB_3514c
15B1MF02Uncharacterized protein40642.8MAB_3532
16B1MM29Putative membrane protein, MmpL965104.2MAB_4746
17B1MB81PknH_C domain-containing protein25126.5MAB_2421c
18B1MG27Putative ABC transporter, ATP-binding protein86191.1MAB_3698
19B1MEL4Hypothetical cutinase33635.7MAB_0178
20B1MNZ2Probable cytochrome c oxidase subunit 234938.7MAB_1961
21B1MCB4Lipoprotein LprG (27 kDa lipoprotein)22523.2MAB_2806
22B1MDM6Thioredoxin-like_fold domain-containing protein25727.9MAB_3269c
23B1MG04Succinate dehydrogenase flavoprotein subunit58864.8MAB_3675
24B1MK36Uncharacterized protein39342.8MAB_4474
25B1MC26PHB domain-containing protein38041.1MAB_2718c
26B1MAP2Putative FtsK/SpoIIIE family protein1343146.7MAB_2232c
27B1MN79TPM_phosphatase domain-containing protein67170.8MAB_1706c
28B1MLM3Probable serine protease HtrA49250.6MAB_1364
29B1MEE1Probable oxidoreductase41245.3MAB_0105c
30B1MMI4Penicillin-binding protein79383.2MAB_4901c
31B1MJY5Putative succinate dehydrogenase, flavoprotein subunit64170.1MAB_4422
32B1MEL6Polyketide synthase PKS131782189.7MAB_0180
33B1MAM2Probable polyketide synthase2121226.9MAB_2212
34B1MGU0Probable conserved lipoprotein LpqG24925.7MAB_0525c
35B1MCI6SBP_bac_5 domain-containing protein55858.9MAB_2878c
36B1MEV1Probable acyl-CoA dehydrogenase FadE58264.6MAB_3481
37B1MLJ1Probable pyrroline-5-carboxylate dehydrogenase RocA54458.6MAB_1330
38B1MKD6Putative polyketide synthase Pks1654959MAB_1140
39B1MKF8Uncharacterized protein (Efem/EfeO family lipoprotein)38441.3MAB_1162c
40B1MJ75Probable polyketide synthase3697393.6MAB_0939
41B1MGZ4Probable acyl-CoA dehydrogenase FadE71574.8MAB_0580
42B1MCV1Trk system potassium uptake protein CeoB22924.2MAB_2994
43B1MP09Probable long-chain-fatty-acid–CoA ligase FadD60363.8MAB_1978c
44B1MGG3Possible L-lactate dehydrogenase (Cytochrome) LldD139241.9MAB_3834c
45B1MLD7Probable fatty-acid-coa ligase FadD1178128.6MAB_4714c
46B1MJQ1Probable acyl-CoA dehydrogenase FadE72777MAB_4336
47B1MD56Alanine dehydrogenase37138.7MAB_3100
48B1MK00Probable acyl-CoA dehydrogenase FadE61467.1MAB_4437
49B1ML19Putative Mce family protein39340.4MAB_4595c
50B1ME12Putative short chain dehydrogenase/reductase28429.6MAB_3405
51B1MKE0Probable short-chain dehydrogenase/reductase29431MAB_1144c
52B1MG05Probable succinate dehydrogenase SdhB26029MAB_3676
53B1MJK2Uncharacterized protein20021.7MAB_1068c
54B1MM89Uncharacterized protein (LysM domain-containing protein)44949MAB_4806c
55B1MJG0DUF1942 domain-containing protein (MPT63-like domain)31030.1MAB_1026c
56B1MKG1Enolase43045MAB_1165
57B1MNW5Glutamine synthetase47853.4MAB_1933c
58B1MAY1Translation initiation factor IF-317619.5MAB_2321
59B1MG6060 kDa chaperonin53956MAB_3731c

Surface proteins shared across all treatment groups.

Discussion

The intrinsic resistance of M. abscessus to available antimicrobials creates a major challenge for the treatment of the disease in high-risk populations (, ). Therefore, improving our understanding of the pathogenesis of infection in these populations is needed to develop alternative ways to prevent or treat the infectious condition.

M. abscessus, like other environmental microorganisms, has the ability to form biofilms on surfaces, which has been shown as a strategy used by the pathogen to establish a niche on the airway mucosa (, ). Past observations in both animal models and humans have demonstrated that M. abscessus biofilm is part of the pathogenesis of lung infections (, ). Recent studies have determined that M. abscessus cultured in SCFM, which mimics the mucus environment in the airways of patients with cystic fibrosis, forms a biofilm that differs from biofilms formed under water or in buffer conditions (, ), which indicates that in the presence of sputum contents in the airways M. abscessus differentiates and acquires a new phenotype. In addition, the biofilm’s extracellular matrix is formed by eDNA and glycol-phospholipids (), which, in the case of Mycobacterium avium, has been shown to protect the bacteria against the action of phagocytic cells ().

In this work, we demonstrate that bacteria in M. abscessus biofilm at some point are able to release from the initial biofilm mass and probably seed in an adjacent site in the airway. This information is important since in our model it was observed that bacteria in biofilms formed under SCFM sputum conditions, once detached, can establish another biofilm with significantly greater efficiency than bacteria in biofilm developed under phosphate buffer conditions. In fact, previous studies in the laboratory have determined that M. abscessus is capable of utilizing the magnesium concentration in the cystic fibrosis medium environment to quickly establish a niche and develop a robust biofilm (). Furthermore, bacteria released from biofilms in the airways can be expelled in the sputum, which increases the chance of transmission by aerosols in the airway of a second individual. In fact, recent observations by diverse groups have suggested that non-tuberculous mycobacteria can be transmitted from an individual to a recipient, most likely in the environment of clinics that assist patients belonging to at-risk groups (, , ). The hypotheses and the observations in studies on necropsy in animals or lung transplantation in humans suggest that bacteria released from biofilms may be transported upward or downward depending on the flow of the air either leaving or entering the airways. A limitation of our study is that despite the hypothesis and the previous observations, we do not provide visual proof in this study. A previous study demonstrated the possibility that environmental mycobacteria can be transmitted from person to person, although the prolonged time between infection and disease makes the epidemiological connection very difficult. Using Caenorhabditis elegans as a model, M. avium infection could be transmitted directly from one host to another without the environmental step that was previously thought to be required (, ). A clear consequence of these findings is that an infection can be transmitted from host to host without the environmental step, which makes the bacterial phenotype released from the biofilm one of the potential phenotypes that transmit the infection.

Bacteria released from biofilm in cystic fibrosis medium were shown to be able to establish a secondary biofilm at the same rate as the primary biofilm (Figure 2). The SCFM biomass was more robust than the biofilm formed by bacteria released from HBSS-established biofilm, showing that bacteria in the presence of a cystic fibrosis environment can still efficiently seed in another location in the airways. In addition, detached M. abscessus invades epithelial cells more efficiently than planktonic bacteria, indicating that the process of binding to establish a primary biofilm and then the subsequent release and formation of a secondary biofilm is associated with bacterial structural modifications, most likely on the bacterial surface. The number of different proteins expressed by the bacterial surface released from biofilms in comparison with bacteria attached to the biofilm is striking. When comparing proteins uniquely expressed by the released bacteria that were not expressed in the other conditions, several uncharacterized proteins, an Mg++ transport, and a few lipoproteins and polyketide synthases were identified. Matching the mutant MAB_3538, which has kinase activity, in the detached biofilm groupings is an interesting finding. A definitive analysis of the function of these proteins is warranted.

Although the changes on the bacterial surface described in this study and in recent publications (, ) are responsible for the different interactions between the pathogen and host cells, an increased uptake by the phagocyte could be a plausible outcome. Our results also demonstrated that the ingested bacteria are not killed by macrophages and grow inside the phagocytic cells at a higher rate than planktonic bacteria. The question of why bacteria uptake is increased with better survival outcomes is pertinent here. Since significant changes occur during intracellular survival, one may hypothesize that the presence of adherent molecules on the bacterial surface is advantageous for disease progression. More research needs to be conducted to understand the effects of the identified genes during infections.

The ability of several different bacterial species to detach from biofilms seems to be dictated by a quorum-sensing mechanism (). Quorum sensing is well-described for Gram-negative bacteria, mostly Pseudomonas aeruginosa, Vibrio sp. and Gram-positive bacteria such as Bacillus cereus and Staphylococcus aureus (). There are three known quorum-sensing types. Type I utilizes N-acyl homoserine lactone, while the other two (types II and III) are regulated by other autoinducers, many of them peptides (). Autoinducers accumulate in the environment as the bacteria population increases and stimulate the expression of membrane transporters and activation of histidine kinases inside the bacterium. P. aeruginosa has several interconnected quorum-sensing circuits that collectively regulate hundreds of genes (). Pseudomonas has three major circuits that regulate approximately 10% of the bacterial genes (). Two circuits respond to N-acyl homoserine lactone signals and a third one, the Pseudomonas quinolone signal system, uses the quinolone signal to interact with RHI receptors which also recognize homoserine lactone signals. These signals are detected by receptors present in the cytoplasm or in the membrane. Gram-positive bacteria, in contrast, use peptides as signaling molecules. They usually bind to membrane histidine kinase receptors that autophosphorylate, although, in some cases, the peptides are transported in the cytoplasm where they interact with the transcription factors (). Mycobacterial proteins do not share any homology with known quorum-sensing-linked proteins of different bacteria. However, several of the small proteins identified in our work as being expressed under biofilm in SCFM and detachment phenotypes have signal peptides and are potentially exported in the biofilm setting. Other researchers are currently addressing this hypothesis regarding the function of surface proteins and their potential participation as signal proteins (, , ).

One should consider that detachment from biofilms may depend on the type and the status of the patient’s immune system, which can interfere with the dissemination of the pathogen in their lungs. It is also important to take into account the pathogen’s phenotype which can be influenced by the lung environment ().

In summary, this work shows that M. abscessus can release from biofilms on the surface of mucosal epithelial cells and these released bacteria are very efficient in developing a new biofilm to bind to mucosal epithelial cells and infect macrophages. Based on the findings that M. abscessus can infect patients directly, the released bacteria can be considered an infectious phenotype. The proteomic sequences of the released bacterial surface proteins identified potential candidates involved in the detachment from biofilm and these need to be studied further.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.

Ethics statement

Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.

Author contributions

BK: Data curation, Formal analysis, Investigation, Methodology, Validation, Writing – original draft. AL: Data curation, Formal analysis, Investigation, Methodology, Validation, Writing – review & editing. LB: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Writing – review & editing.

Funding

The author(s) declare financial support was received for the research, authorship, and/or publication of this article. The reported work was funded by NIH grant AI152258, and San Francisco Microbiology Foundation grant # 102.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1

    FlotoRAHaworthCS. The growing threat of nontuberculous mycobacteria in CF. J Cyst Fibros. (2015) 14:12. doi: 10.1016/j.jcf.2014.12.002

  • 2

    MartinianoSLNickJADaleyCL. Nontuberculous mycobacterial infections in cystic fibrosis. Clin Chest Med. (2022) 43:697716. doi: 10.1016/j.ccm.2022.06.010

  • 3

    JohansenMDHerrmannJ-LKremerL. Non-tuberculous mycobacteria and the rise of Mycobacterium abscessus. 7. Nat Rev Microbiol. (2020) 18:392407. doi: 10.1038/s41579-020-0331-1

  • 4

    RyanKByrdTF. Mycobacterium abscessus: shapeshifter of the mycobacterial world. Front Microbiol. (2018) 9:2642. doi: 10.3389/fmicb.2018.02642

  • 5

    DaleyCLIaccarinoJMLangeCCambauEWallaceRJAndrejakCet al. Treatment of nontuberculous mycobacterial pulmonary disease: an official ATS/ERS/ESCMID/IDSA clinical practice guideline. Eur Respir J. (2020) 56:2000535. doi: 10.1183/13993003.00535-2020

  • 6

    BryantJMBrownKPBurbaudSEverallIBelardinelliJMRodriguez-RinconDet al. Stepwise pathogenic evolution of Mycobacterium abscessus. Science. (2021) 372:eabb8699. doi: 10.1126/science.abb8699

  • 7

    RuisCBryantJMBellSCThomsonRDavidsonRMHasanNAet al. Dissemination of Mycobacterium abscessus via global transmission networks. Nat Microbiol. (2021) 6:1279–88. doi: 10.1038/s41564-021-00963-3

  • 8

    Miranda-CasoLuengoAAStauntonPMDinanAMLohanAJLoftusBJ. Functional characterization of the Mycobacterium abscessus genome coupled with condition specific transcriptomics reveals conserved molecular strategies for host adaptation and persistence. BMC Genomics. (2016) 17:553. doi: 10.1186/s12864-016-2868-y

  • 9

    KeefeBFBermudezLE. Environment in the lung of cystic fibrosis patients stimulates the expression of biofilm phenotype in Mycobacterium abscessus. J Med Microbiol. (2022) 71:001467. doi: 10.1099/jmm.0.001467

  • 10

    FennellyKPOjano-DirainCYangQLiuLLuLProgulske-FoxAet al. Biofilm formation by mycobacterium abscessus in a lung cavity. Am J Respir Crit Care Med. (2016) 193:692–3. doi: 10.1164/rccm.201508-1586IM

  • 11

    BelardinelliJMLiWAvanziCAngalaSKLianEWiersmaCJet al. Unique features of mycobacterium abscessus biofilms formed in synthetic cystic fibrosis medium. Front Microbiol. (2021) 12:743126. doi: 10.3389/fmicb.2021.743126

  • 12

    RoseSJBabrakLMBermudezLE. Mycobacterium avium possesses extracellular DNA that contributes to biofilm formation, structural integrity, and tolerance to antibiotics. PloS One. (2015) 10:e0128772. doi: 10.1371/journal.pone.0128772

  • 13

    PalmerKLMashburnLMSinghPKWhiteleyM. Cystic fibrosis sputum supports growth and cues key aspects of Pseudomonas aeruginosa physiology. J Bacteriol. (2005) 187:5267–77. doi: 10.1128/JB.187.15.5267-5277.2005

  • 14

    RoseSJBermudezLE. Identification of bicarbonate as a trigger and genes involved with extracellular DNA export in mycobacterial biofilms. mBio. (2016) 7:e01597–16. doi: 10.1128/mBio.01597-16

  • 15

    Leestemaker-PalmerALBermudezLE. Mycobacterium abscessus infection results in decrease of oxidative metabolism of lung airways cells and relaxation of the epithelial mucosal tight junctions. Tuberculosis (Edinb). (2023) 138:102303. doi: 10.1016/j.tube.2023.102303

  • 16

    LewisMSDanelishviliLRoseSJBermudezLE. MAV_4644 Interaction with the Host Cathepsin Z Protects Mycobacterium avium subsp. hominissuis from Rapid Macrophage Killing. Microorganisms. (2019) 7:144. doi: 10.3390/microorganisms7050144

  • 17

    DanelishviliLRojonyRCarsonKLPalmerALRoseSJBermudezLE. Mycobacterium avium subsp. hominissuis effector MAVA5_06970 promotes rapid apoptosis in secondary-infected macrophages during cell-to-cell spread. Virulence. (2018) 9:1287–300. doi: 10.1080/21505594.2018.1504559

  • 18

    GriffithDEGirardWMWallaceRJ. Clinical features of pulmonary disease caused by rapidly growing mycobacteria. An analysis of 154 patients. Am Rev Respir Dis. (1993) 147:1271–8. doi: 10.1164/ajrccm/147.5.1271

  • 19

    NessarRCambauEReyratJMMurrayAGicquelB. Mycobacterium abscessus: a new antibiotic nightmare. J Antimicrob Chemother. (2012) 67:810–8. doi: 10.1093/jac/dkr578

  • 20

    EstebanJGarcía-CocaM. Mycobacterium biofilms. Front Microbiol. (2017) 8:2651. doi: 10.3389/fmicb.2017.02651

  • 21

    BlanchardJDEliasVCipollaDGondaIBermudezLE. Effective Treatment of Mycobacterium avium subsp. hominissuis and Mycobacterium abscessus Species Infections in Macrophages, Biofilm, and Mice by Using Liposomal Ciprofloxacin. Antimicrob Agents Chemother. (2018) 62:e00440–18.

  • 22

    WiersmaCJBelardinelliJMAvanziCAngalaSKEverallIAngalaBet al. Cell Surface Remodeling of Mycobacterium abscessus under Cystic Fibrosis Airway Growth Conditions. ACS Infect Dis. (2020) 6:2143–54. doi: 10.1021/acsinfecdis.0c00214

  • 23

    Leestemaker-PalmerAOngTBermudezLE. Exposure of Mycobacteriodes abscessus to mucin affects bacterial phenotype. Sci Rep. (2024) 15:393.

  • 24

    RoseSJBermudezLE. Mycobacterium avium biofilm attenuates mononuclear phagocyte function by triggering hyperstimulation and apoptosis during early infection. Infect Immun. (2014) 82:405–12. doi: 10.1128/IAI.00820-13

  • 25

    KreutzfeldtKMMcAdamPRClaxtonPHolmesASeagarALLaurensonIFet al. Molecular longitudinal tracking of Mycobacterium abscessus spp. during chronic infection of the human lung. PloS One. (2013) 8:e63237.

  • 26

    EvermanJLZiaieNRBechlerJBermudezLE. Establishing Caenorhabditis elegans as a model for Mycobacterium avium subspecies hominissuis infection and intestinal colonization. Biol Open. (2015) 4:1330–5. doi: 10.1242/bio.012260

  • 27

    BermudezLERoseSJEvermanJLZiaieNR. Establishment of a Host-to-Host Transmission Model for Mycobacterium avium subsp. hominissuis Using Caenorhabditis elegans and Identification of Colonization-Associated Genes. Front Cell Infect Microbiol. (2018) 8:123. doi: 10.3389/fcimb.2018.00123

  • 28

    RutherfordSTBasslerBL. Bacterial quorum sensing: its role in virulence and possibilities for its control. Cold Spring Harb Perspect Med. (2012) 2:a012427. doi: 10.1101/cshperspect.a012427

  • 29

    BolesBRHorswillAR. Agr-mediated dispersal of Staphylococcus aureus biofilms. PloS Pathog. (2008) 4:e1000052. doi: 10.1371/journal.ppat.1000052

  • 30

    BorleeBRGeskeGDBlackwellHEHandelsmanJ. Identification of synthetic inducers and inhibitors of the quorum-sensing regulator LasR in Pseudomonas aeruginosa by high-throughput screening. Appl Environ Microbiol. (2010) 76:8255–8. doi: 10.1128/AEM.00499-10

  • 31

    LazarV. Quorum sensing in biofilms -How to destroy the bacterial citadels or their cohesion/power? Anaerobe. (2011) 117:280–5.

  • 32

    MattmanMEBlackwellHE. Small molecules that modulate quorum sensing and control virulence in Pseudomonas aeruginosa. J Org Chem. (2010) 75:67376746. doi: 10.1021/jo101237e

  • 33

    JiGBeavisRCNovickRP. Cell density control of staphylococcal virulence mediated by an octapeptide pheromone. Proc Natl Acad Sci USA. (1995) 92:12055–9. doi: 10.1073/pnas.92.26.12055

  • 34

    MagnusonRSolomonJGrossmanAD. Biochemical and genetic characterization of a competence pheromone from B. subtilis. Cell. (1994) 77:207–16. doi: 10.1016/0092-8674(94)90313-1

  • 35

    LilleyBNBasslerBL. Regulation of quorum sensing in Vibrio harveyi by LuxO and sigma-54. Mol Microbiol. (2000) 36:940–54. doi: 10.1046/j.1365-2958.2000.01913.x

  • 36

    Leestemaker-PalmerAOngTBermudezLE. Environmental conditions encountered in the lung are associated with changes in Mycobacterioides abscessus phenotypes over time. Sci Rep. (2025) 15:393. doi: 10.1038/s41598-024-84451-8

Summary

Keywords

mycobacterium abscessus, biofilm, detachment, infectious phenotype, host bacterial surface, macrophages, uptake

Citation

Keefe B, Leestemaker-Palmer A and Bermudez LE (2025) The ability to detach from biofilms in the lung airways prior to transmission to another host is associated with the infectious phenotype of Mycobacterium abscessus. Front. Immunol. 16:1508584. doi: 10.3389/fimmu.2025.1508584

Received

09 October 2024

Accepted

17 January 2025

Published

07 March 2025

Volume

16 - 2025

Edited by

Veronica Schmitz, Oswaldo Cruz Foundation (Fiocruz), Brazil

Reviewed by

Juan José Valdez Alarcón, Universidad Michoacana de San Nicolás de Hidalgo, Mexico

John Jairo Aguilera-Correa, UMR9004 Institut de Recherche en Infectiologie de Montpellier (IRIM), France

Updates

Copyright

*Correspondence: Luiz E. Bermudez,

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics