Abstract
Phages of the P335 species infect Lactococcus lactis and have been particularly studied because of their association with strains of L. lactis subsp. cremoris used as dairy starter cultures. Unlike other lactococcal phages, those of the P335 species may have a temperate or lytic lifestyle, and are believed to originate from the starter cultures themselves. We have sequenced the genome of L. lactis subsp. cremoris KW2 isolated from fermented corn and found that it contains an integrated P335 species prophage. This 41 kb prophage (Φ KW2) has a mosaic structure with functional modules that are highly similar to several other phages of the P335 species associated with dairy starter cultures. Comparison of the genomes of 26 phages of the P335 species, with either a lytic or temperate lifestyle, shows that they can be divided into three groups and that the morphogenesis gene region is the most conserved. Analysis of these phage genomes in conjunction with the genomes of several L. lactis strains shows that prophage insertion is site specific and occurs at seven different chromosomal locations. Exactly how induced or lytic phages of the P335 species interact with carbohydrate cell surface receptors in the host cell envelope remains to be determined. Genes for the biosynthesis of a variable cell surface polysaccharide and for lipoteichoic acids (LTAs) are found in L. lactis and are the main candidates for phage receptors, as the genes for other cell surface carbohydrates have been lost from dairy starter strains. Overall, phages of the P335 species appear to have had only a minor role in the adaptation of L. lactis subsp. cremoris strains to the dairy environment, and instead they appear to be an integral part of the L. lactis chromosome. There remains a great deal to be discovered about their role, and their contribution to the evolution of the bacterial genome.
Introduction
The role of Lactococcus lactis as the key organism in the initiation of milk fermentation has been known since the work of Joseph Lister in the 1870s when Bacterium lactis was the first bacterium to be isolated in pure culture (Santer, ). Today this species is the main constituent of cultures used for the manufacture of a vast range of fermented dairy products, including fermented milks, sour cream, soft and hard cheeses, and lactic casein. The taxonomy of L. lactis is confused by discrepancies between phenotypic and genotypic descriptions but it is apparent that two subspecies exist that correlate with genotype and are known as L. lactis subsp. cremoris and L. lactis subsp. lactis (Kelly et al., ). Both subspecies are used as starters by the dairy industry but the strains with the L. lactis subsp. cremoris genotype cluster closely together (Rademaker et al., ), and are particularly favored for use as defined strain starter cultures for Cheddar cheese production.
The use of defined strain starters began in New Zealand in the 1930s using bacteria selected from mixed strain cultures, and studies of bacteriophages that infect dairy cultures began around the same time (Whitehead and Cox, ), as fermentations using single strain starters quickly proved to be susceptible to phage attack. Subsequently, phage resistance and the selection and characterization of phage-unrelated strains, became the major focus of dairy starter culture research (Lawrence et al., ), and it was concluded that a relatively small number of significantly different L. lactis subsp. cremoris starter strains exist (Whitehead and Bush, ; Lawrence et al., ; Kelly et al., ). Initial studies investigated whether phages originated from the dairy environment or from the cultures themselves, but eventually the environmental origin came to be regarded as the most significant and a range of measures were developed to control phage attack (Whitehead, ). Nevertheless, phage attack, leading to slow or dead vats, remains the leading cause of fermentation problems in the dairy industry. It was also discovered that most starter strains were lysogenized by one or more bacteriophage, and that these temperate phages could be induced, although it was difficult to find strains that they could be propagated on (Huggins and Sandine, ; Terzaghi and Sandine, ).
Bacteriophages from L. lactis were originally divided into 12 species within the Siphoviridae and Podoviridae based on morphology and DNA homology, and type phages were selected to represent each species (Jarvis et al., ). Subsequent studies have refined the number of species to 10 (Deveau et al., ), with most of the phage problems encountered in dairy fermentations ascribed to just three species. These are the small isometric-headed 936 and P335 species, and the prolate-headed c2 species. The 936 and c2 species are lytic whereas phages from the P335 species may have a temperate or lytic lifestyle (Braun et al., ). Phages of all three species have now had their genomes sequenced and while phages from the 936 and c2 species form distinct but homogeneous groups, the phages from the P335 species are much more heterogeneous and their genomes appear to be mosaic in structure similar to the lambdoid phages. Most studies of phages of the P335 species have focused on their lytic or temperate relationship with L. lactis subsp. cremoris dairy starter strains. Here we describe a prophage from the genome of a non-dairy L. lactis subsp. cremoris culture and compare its genome organization with a range of other phages of the P335 species from L. lactis.
Materials and methods
Genome sequencing
L. lactis subsp. cremoris KW2 was originally isolated from kaanga wai (fermented corn) and was chosen for sequencing because in studies comparing multiple L. lactis cultures (Rademaker et al., ) it grouped with the L. lactis subsp. cremoris dairy starter cultures. Its genome sequence was determined using pyrosequencing of 3 kb mate paired-end sequence libraries on a 454 GS FLX platform with titanium chemistry (Macrogen, South Korea). Pyrosequencing reads were assembled using the Newbler assembler version 2.5.3 (Roche 454 Life Sciences, USA) resulting in 22 contigs across a single scaffold. Gap closure was managed using the Staden package (Staden et al., ), and gaps were closed using additional Sanger sequencing by standard PCR-based techniques. Protein-encoding genes were identified by Glimmer (Delcher et al., ) and a GAMOLA/ARTEMIS (Rutherford et al., ; Altermann and Klaenhammer, ) software suite was used to manage genome annotation. Assignment of protein function to ORFs was performed manually using results from BLASTP, and the COG (Clusters of Orthologous Groups, Tatusov et al., ), Pfam (Punta et al., ), and TIGRFAM (Haft et al., ) databases.
Lactococcus lactis genomes
Complete sequences are available for the chromosomes of eight L. lactis strains. For L. lactis subsp. cremoris these are the cheese starter cultures A76 (isolated in France, Bolotin et al., ), SK11 (isolated in New Zealand, Makarova et al., ) and UC509.9 (isolated in Ireland, Ainsworth et al., ), and the plasmid-free reference strain MG1363 (Wegmann et al., ). All of these strains originally derive from mixed strain dairy starter cultures. A feature of the three cheese starter cultures is that they harbor several plasmids which enable these strains to metabolize lactose and casein efficiently, and that their chromosomes contain a large number of transposases and pseudogenes. For L. lactis subsp. lactis there are genomes for the plasmid-free reference strain IL1403 which is of dairy origin (Bolotin et al., ), and three non-dairy strains, KF147 (Siezen et al., ), CV56 (Gao et al., ), and IO-1 (Kato et al., ).
P335 phage genomes
Table 1 lists the phages belonging to the P335 species for which genome information is available. Three genomes are of lytic phages; P335 (Labrie et al., ), 4268 (Trotter et al., ), and ul36 (Labrie and Moineau, ), with partial genome sequence information also available for an additional lytic phage, Φ 31 (Madsen et al., ). Six genomes are from temperate phages that have been induced from their host strain and propagated, usually on either a closely related strain (strain H2 for BK5-T) or a prophage-cured derivative (cured derivative of strain R1 for r1t). Publically available temperate phage genomes are: TP901-1 (Brøndsted et al., ), Tuc2009 (NCBI Reference Sequence: NC_002703), r1t (van Sinderen et al., ), BK5-T (Desiere et al., ), Φ LC3 (Blatny et al., ), and Φ smq86 (Labrie and Moineau, ). All of these phages have been studied because of their ability to lyse dairy starter strains, although most have a relatively narrow host range.
Table 1
| Phage | Status | Host1 | Size (kb) | Host origin | Accession no.2 |
|---|---|---|---|---|---|
| P335 | Lytic | L. lactis subsp. lactis biovar diacetylactis F7/2 | 34 | Dairy starter | DQ838728 |
| 4268 | Lytic | L. lactis subsp. lactis DPC4268 | 37 | Dairy starter | NC_004746 |
| ul36 | Lytic | L. lactis subsp. cremoris SMQ-86 | 37 | Dairy starter | NC_004066 |
| Φ 31 (fragment) | Lytic | L. lactis subsp. lactis NCK203 | Dairy starter | AJ292531 | |
| TP901-1 | Temperate/Induced | L. lactis subsp. cremoris 901-1 | 38 | Dairy starter | NC_002747 |
| Tuc2009 | Temperate/Induced | L. lactis subsp. cremoris UC509 | 38 | Dairy starter | NC_002703 |
| r1t | Temperate/Induced | L. lactis subsp. cremoris R1 | 33 | Dairy starter | NC_004302 |
| BK5-T | Temperate/Induced | L. lactis subsp. cremoris BK5 | 40 | Dairy starter | NC_002796 |
| Φ LC3 | Temperate/Induced | L. lactis subsp. cremoris IMN-C3 | 32 | Dairy starter | NC_005822 |
| Φ smq86 | Temperate/Induced | L. lactis subsp. cremoris SMQ-86 | 34 | Dairy starter | DQ394810 |
| bIL285 | Prophage | L. lactis subsp. lactis IL1403 | 36 | Dairy starter | AF323668 |
| bIL286 | Prophage | L. lactis subsp. lactis IL1403 | 42 | AF323669 | |
| bIL309 | Prophage | L. lactis subsp. lactis IL1403 | 37 | AF323670 | |
| SK11-2 | Prophage | L. lactis subsp. cremoris SK11 | 37 | Dairy starter | NC_008527 |
| SK11-3 | Prophage | L. lactis subsp. cremoris SK11 | 32 | ||
| SK11-4 | Prophage | L. lactis subsp. cremoris SK11 | 40 | ||
| t712 | Prophage | L. lactis subsp. cremoris MG1363 | 42 | Dairy starter | NC_009004 |
| MG-3 | Prophage | L. lactis subsp. cremoris MG1363 | 44 | ||
| A76-1 | Prophage | L. lactis subsp. cremoris A76 | 36 | Dairy starter | NC_017492 |
| A76-2 | Prophage | L. lactis subsp. cremoris A76 | 38 | ||
| pp1 | Prophage | L. lactis subsp. lactis KF147 | 35 | Bean sprouts | NC_013656 |
| pp2 | Prophage | L. lactis subsp. lactis KF147 | 54 | ||
| pi1 | Prophage | L. lactis subsp. lactis CV56 | 35 | Human vagina | NC_017486 |
| pi2 | Prophage | L. lactis subsp. lactis CV56 | 37 | ||
| pi3 | Prophage | L. lactis subsp. lactis CV56 | 34 | ||
| ps3 | Prophage | L. lactis subsp. lactis IO-1 | 36 | Kitchen drain | AP012281 |
| Φ KW2 | Prophage | L. lactis subsp. cremoris KW2 | 41 | Fermented corn | CP004884 |
Genomes from lytic and induced P335 species phages, and from P335 prophages located in chromosomes of L. lactis strains.
For lytic phages the host is the strain used for phage propagation; for temperate/induced phages the host is the strain the phage was induced from with propagation on a closely related strain or a cured derivative of the host; for prophages the host is the strain containing the integrated phage genome and these have not been propagated.
Accession numbers are for the phage genome where that is separately available, or for the bacterial genome containing the integrated prophage.
Seventeen complete prophages were identified in L. lactis genomes, and with the exception of UC509.9 (a derivative of UC509 that has been cured of the Tuc2009 prophage, Ainsworth et al., ), all of the sequenced L. lactis strains have at least one full-length P335 species prophage integrated into their chromosome (Table 1). The prophages from strains IL1403, MG1363, and SK11 have been described in detail previously (Chopin et al., ; Ventura et al., ). Phage remnants are also found in these chromosomes, but were not included in the analysis as they have been shown to form a separate subgroup (Ventura et al., ).
Functional genome distribution of 26 Lactococcus lactis P335 phages
Publicly available phage genomes were downloaded in Genbank format from the NCBI genome database. Similarly, publicly available Lactococcus lactis genomes were downloaded in Genbank format, and integrated prophage genomes identified. All phage genomes were then automatically annotated using GAMOLA (Altermann and Klaenhammer, ). Predicted ORFeomes of all genomes were subjected to a functional genome distribution analysis (Altermann, ) and the resulting distance matrix was imported into MEGA5 (Tamura et al., ). The functional distribution was visualized using the UPGMA method (Sneath and Sokal, ).
Results
Lactococcus lactis subsp. cremoris KW2 genome sequence
The genome of L. lactis subsp. cremoris KW2 consists of a 2,427,048 bp circular chromosome, with a G + C content of 36.65%. KW2 has 61 tRNA genes and 2278 coding sequences (CDS) were predicted. The chromosomal gene content of KW2 is highly similar to L. lactis subsp. cremoris dairy starter strains, but KW2 has no plasmids, and the chromosome has no transposases and few pseudogenes. The genome sequence of L. lactis subsp. cremoris KW2 has been deposited in the GenBank database under the accession number CP004884.
Prophage ϕKW2 genome organization
The KW2 chromosome contains an integrated 41 kb prophage genome (Φ KW2, kw2_1785 to _1841). The consolidated gene model (Figure 1) shows that Φ KW2 harbors 57 ORFs, for 22 of which a predicted function could be assigned. A further 28 ORFs could be linked to phage-related homologs without a described function. All ORFs are on the same strand except for a single hypothetical protein (kw2_1822) and the ORFs involved in establishment and maintenance of lysogeny. The phage ORFs are flanked by 22-bp sequences indicative of attL and attR sites. A full list of the predicted proteins that are encoded by the Φ KW2 genome is shown in Table 2.
Figure 1
Table 2
| ORF | Annotation | Size (aa) | Best blast match | aa id/sim (%) |
|---|---|---|---|---|
| attR aaaggggcaaaaaaggggcata | ||||
| 1785 | Phage lysin glycoside hydrolase GH25 family | 287 | MG1363. MG-3 llmg_2082 | 99/99 |
| 1786 | Phage holin | 150 | MG1363. MG-3 llmg_2083 | 97/98 |
| 1787 | Phage-related protein | 116 | MG1363. MG-3 llmg_2084 | 89/96 |
| 1788 | Phage-related protein | 78 | MG1363. MG-3 llmg_2085 | 92/97 |
| 1789 | Phage tail fiber protein1 | 881 | MG1363. MG-3 llmg_2086 | 85/92 |
| 1790 | Phage distal tail protein | 548 | BK5-Tp16 | 96/97 |
| 1791 | Phage tail tape measure protein | 1719 | MG1363. MG-3 llmg_2089 | 89/94 |
| 1792 | Phage-related protein | 225 | KF147. pp2 pp224 | 99/99 |
| 1793 | Phage tail protein | 138 | MG1363. MG-3 llmg_2090 | 99/99 |
| 1794 | Phage tail protein | 211 | KF147. pp2 pp226 | 92/94 |
| 1795 | Phage tail protein | 131 | KF147. pp2 pp227 | 98/99 |
| 1796 | Phage-related protein | 168 | MG1363. MG-3 llmg_2093 | 100 |
| 1797 | Phage head-tail joining protein | 116 | IL1403. bIL286 Orf47 | 97/97 |
| 1798 | Phage-related protein | 107 | IL1403. bIL286 Orf46 | 93/97 |
| 1799 | Phage-related protein | 288 | IL1403. bIL285 Orf45 | 92/96 |
| 1800 | Phage major capsid protein | 419 | KF147. pp2, pp231 | 90/95 |
| 1801 | Phage atp-dependent endopeptidase | 234 | MG1363. MG-3 llmg_2097 | 99/99 |
| 1802 | Phage portal protein | 390 | MG1363. MG-3 llmg_2098 | 100 |
| 1803 | Phage terminase large subunit | 636 | 4268 | 97/99 |
| 1804 | Phage terminase small subunit | 151 | 4268 | 99/99 |
| 1805 | Phage-related protein | 172 | BK5-Tp63 | 99/99 |
| 1806 | Phage-related protein | 58 | IL1403. bIL286 Orf38 | 95/95 |
| 1807 | Phage-related protein | 141 | MG1363. t712 llmg_0821 | 98/100 |
| 1808 | Hypothetical protein | 53 | CV56. pi3 CVCAS_2130 | 92/98 |
| 1809 | Phage-related protein | 115 | MG1363. MG-3 llmg_2107 | 36/63 |
| 1810 | Hypothetical protein | 71 | LLCRE1631_01453 | 93/99 |
| 1811 | Phage-related protein | 60 | 4268 | 80/87 |
| 1812 | Phage-related protein | 61 | IL1403. bIL309 Orf28 | 79/87 |
| 1813 | Phage-related HNH endonuclease family protein | 147 | Enterococcus phage EFRM31 | 59/69 |
| 1814 | Phage-related protein | 57 | Lactococcus garvieae DCC43 | 75/90 |
| 1815 | Phage-related protein | 142 | KF147. pp1 pp123 | 40/57 |
| 1816 | Hypothetical protein | 66 | Lactococcus garvieae DCC43 | 90/92 |
| 1817 | Phage-related protein | 117 | 4268 | 62/72 |
| 1818 | Phage-related HNH endonuclease family protein | 151 | Enterococcus phage EFRM31 | 60/70 |
| 1819 | Phage-related protein | 175 | A76. A76-1 llh_3320 | 50/61 |
| 1820 | Phage-related protein | 93 | IL1403. bIL285 Orf26 | 96/98 |
| 1821 | Hypothetical protein | 60 | unknown | |
| 1822 | Hypothetical protein | 210 | Geobacter metallireducens GS-15 | 32/57 |
| 1823 | Hypothetical protein | 63 | MG1363. MG-3 | 95/95 |
| 1824 | Phage-related protein | 65 | MG1363. MG-3 llmg_2117 | 100 |
| 1825 | Phage-related protein | 56 | IL1403. bIL285 Orf24 | 86/89 |
| 1826 | Phage-related protein | 57 | IL1403. bIL285 Orf22 | 84/96 |
| 1827 | Phage-related protein | 103 | Φ 31 | 89/93 |
| 1828 | Phage-related DNA primase | 487 | Φ 31 | 98/99 |
| 1829 | Phage-related protein | 268 | Φ 31 | 98/99 |
| 1830 | Phage-related protein | 150 | Φ 31 | 99/99 |
| 1831 | Phage DNA/RNA helicase | 448 | Φ 31 | 98/99 |
| 1832 | Phage nucleotide-binding protein | 239 | Streptococcus porcinus str. Jelinkova 176 | 90/96 |
| 1833 | Phage-related protein | 169 | Φ 31 | 98/99 |
| 1834 | Phage-related protein | 56 | IL1403. bIL309 Orf10 | 95/98 |
| 1835 | Excisionase | 86 | A76. A76-1 llh_3245 | 98/100 |
| 1836 | Phage-related protein | 63 | IL1403. bIL312 Orf6 | 98/100 |
| 1837 | Phage repressor | 122 | IL1403. bIL312 Orf5 | 90/96 |
| 1838 | Phage-related protein | 195 | IL1403. bIL312 Orf4 | 90/95 |
| 1839 | Phage-related protein | 98 | IL1403. bIL312 Orf3 | 99/100 |
| 1840 | Hypothetical protein | 364 | Streptococcus oralis SK304 | 59/80 |
| 1841 | Phage integrase | 379 | A76. A76-1 llh_3210 | 99/99 |
| attL aaaggggcactaaaggggcata |
Predicted proteins encoded by the prophage ϕKW2.
This is much smaller than the corresponding protein predicted from MG-3 (881 vs. 1617 aa).
Comparison of P335 phage genomes
Functional genome distribution was used to compare the genomes of the phages belonging to the P335 species. The results of this analysis are shown in Figure 2. The 26 phage genomes fall into three broad groups which show a close resemblance to those previously described by others (Trotter et al., ; Ventura et al., ; Samson and Moineau, ). Recently two lytic phages isolated in North America have been sequenced and assigned to a fourth P335 phage group (Mahoney et al., ). The region of the genome devoted to morphogenesis genes is the most conserved (Labrie et al., ). From current sequence data the only gene that is conserved among most phages of the P335 species is that for a dUTPase (Labrie and Moineau, ). The phage dUTPase is highly conserved at nucleotide and amino acid levels, but differs significantly from the chromosomal dut gene. A phage-like dUTPase is found in each prophage from the dairy L. lactis subsp. cremoris strains but is not part of the Φ KW2 genome, suggesting that its acquisition may be associated with adaptation to the dairy environment. The role of the phage dUTPase is not known, but it is hypothesized that dUTPases are involved in controlling various cellular processes (Penadés et al., ).
Figure 2
Chromosomal integration
Analysis of the sequenced L. lactis genomes shows that prophage integration is not random but occurs at a limited number of specific sites on the host chromosome. Currently seven different sites have been identified (Figure 3) and each is associated with a highly conserved integrase. The most common location for phage integration is site 4 between the rex and radC genes. There is no relationship between the three groups of phages belonging to the P335 species and the integrase that is present (Figure 2).
Figure 3
Host specificity and phage receptors
Phage infection requires the recognition of receptors on the bacterial cell surface by receptor-binding proteins (RBPs) that are part of the phage tail structure. The RBP from TP901-1 has been characterized and forms part of a complex baseplate structure (Spinelli et al.,
L. lactis strains all contain a cluster of >20 genes (kw2_0186-_0208) which together determine the biosynthesis of a CWP that forms a pellicle on the cell surface, and is believed to have a role as a bacteriophage receptor for 936 phages (Mahoney et al.,
It is reported that the most likely receptors are believed to be glycerol- or phosphoglycerol-containing wall teichoic acids (WTA) or lipoteichoic acids (LTAs), as their likely variable structures could determine strain specificity (Spinelli et al.,
Analysis of L. lactis genomes shows that genes for the biosynthesis of WTA occur as a large cluster in the plant L. lactis strain KF147 (Siezen et al.,
Genes encoding the biosynthesis of LTA have been determined for some Gram positive bacteria (Reichmann and Gründling,
Phages of the P335 species as agents of gene transfer and chromosomal rearrangement
Transduction of genetic information by temperate phages has been described for lactococci and used to study plasmid-associated lactose and proteinase phenotypes in NCDO712 and related strains (Gasson,
Analysis of the L. lactis subsp. cremoris genomes shows that P335 species prophages can be involved in mediating significant changes to chromosomal architecture. In L. lactis subsp. cremoris A76 the prophage integration sites 1 and 6 are found at the ends of a chromosomal rearrangement. The chromosome of strain A76 has truncated integrase, repressor and phage lysin genes adjacent to the lytR gene (llh_2555, site 1). This region also contains several transposases and then joins to the ribosomal RNA small subunit methyltransferase B gene (sunL, llh_2615, site 6). Phage A76-2 is located at the other end of the chromosomal rearrangement. The phage integrase (llh_10885) is adjacent to the A76 homolog of llmg_2143 (llh_10890, site 6), while the lysin gene (llh_10615) is separated from truA (llh_10580, site 1) by a transposase and other hypothetical proteins. A similar situation possibly applies with other L. lactis subsp. cremoris strains HP and FG2 (Kelly et al.,
Discussion
Phages that attack Lactococcus lactis dairy starter cultures remain the largest single cause of industrial milk fermentation problems and result in significant economic losses. While most problems result from infection by virulent 936 and c2 species phages, (Madera et al.,
Most studies of phages belonging to the P335 species have been in the context of their association with dairy strains of L. lactis subsp. cremoris, and here we report the genome sequence of L. lactis subsp. cremoris KW2 that was isolated from fermented corn. The most notable feature of the KW2 chromosome is that it does not show the high numbers of transposases and pseudogenes characteristic of L. lactis subsp. cremoris dairy starters, but it does contain a single integrated prophage (Φ KW2). Phage evolution occurs by the rearrangement of functional modules, and it seems clear that phages are able to mix-and-match these modules to produce a variety of different combinations. Φ KW2 serves as an example of this as its mosaic structure appears little different from the prophages found in dairy starters, and its various functional modules show very high homology to known dairy phages. The integrase and excisionase (which both match to the A76-1 prophage), the early gene control module including the phage repressors (matches to the P335 phage remnant bIL312 found in the IL1403 genome), and the DNA replication module (matches to the replication genes from the lytic phage Φ 31) are located at one end of the genome. The proteins predicted to be encoded by the central region of the genome show only weak homology mainly to proteins from various phage genomes, and this is typical of other phages from the P335 species. The remaining three modules for DNA packaging, phage structural components (including head and tail morphogenesis and host specificity), and cell lysis are found at the other end of the genome and almost all of the genes in this region show high homology to phage MG-3 from the MG1363 genome and to other phages that make up Group 3 in Figure 2.
The ability of phages of the P335 species to shuffle their various modules means that no L. lactis subsp. cremoris strains can be said to be truely phage-unrelated. The integrases are a good example as they enable phages to insert at a limited number of specific sites and yet can be partnered with a diversity of different modules as shown in Figure 2. Using conserved primer sequences from four P335 phages that insert at integration site 4 (Tuc2009, r1t, BK5-T, and Φ LC3), O'Sullivan et al. (
It can be concluded from this that P335 species prophages are an integral part of the Lactococcus lactis genome, and their interaction can take several different forms. The prophage may be induced from the genome and in some cases become a lytic phage that is unable to relysogenize. Prophages may also mediate chromosomal rearrangement as appears to be the case for L. lactis subsp. cremoris A76, or acquire lysogenic conversion genes that modify bacterial properties. In the case of dairy starter cultures prophages may also influence important industrial properties of the strains such as phage resistance and autolysis. Overall it is difficult to quantify the effect of prophage genomes, and it appears most likely that they have co-evolved together with the bacterial genome. The observation that many of the prophages in dairy strains of L. lactis subsp. cremoris contain transposases suggests that prophage genomes are exposed to the same selection as the host genome, and that prophages may have had only a minor role in the adaptation of Lactococcus lactis strains to the dairy environment.
Conflict of interest statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Statements
Acknowledgments
This work was supported by the AgResearch Curiosity Fund.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
References
1
AinsworthS.ZomerA.de JagerV.BottaciniF.van HijumS. A. F. T.MahoneyJ.et al. (2013). Complete genome of Lactococcus lactis subsp. cremoris UC509.9, host for a model lactococcal P335 bacteriophage. Genome Announc. 1, e00119–e00112. 10.1128/genomeA.00119-12
2
AltermannE. (2012). Tracing lifestyle adaptation in prokaryotic genomes. Front. Microbiol. 3:48. 10.3389/fmicb.2012.00048
3
AltermannE.KlaenhammerT. (2003). GAMOLA: a new local solution for sequence annotation and analyzing draft and finished prokaryotic genomes. Omics7, 161–169. 10.1089/153623103322246557
4
BebeacuaC.BronP.LaiL.VeggeC. S.BrøndstedL.SpinelliS.et al. (2010). Structure and molecular assignment of lactococcal phage TP901-1 baseplate. J. Biol. Chem. 285, 39079–39086. 10.1074/jbc.M110.175646
5
BebeacuaC.LaiL.VeggeC. S.BrøndstedL.van HeelM.VeeslerD.et al. (2013). Visualizing a complete Siphoviridae member by single-particle electron microscopy: the structure of lactococcal phage TP901-901. J. Virol. 87, 1061–1068. 10.1128/JVI.02836-12
6
BlatnyJ. M.GodagerL.LundeM.NesI. F. (2004). Complete genome sequence of the Lactococcus lactis temperate phage Φ LC3: comparative analysis of Φ LC3 and its relatives in lactococci and streptococci. Virology318, 231–244. 10.1016/j.virol.2003.09.019
7
BolotinA.QuinquisB.EhrlichD. S.SorokinA. (2012). Complete genome sequence of Lactococcus lactis subsp. cremoris A76. J. Bacteriol. 194, 1241–1242. 10.1128/JB.06629-11
8
BolotinA.WinckerP.MaugerS.JaillonO.MalarmeK.WeissenbachJ.et al. (2001). The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 11, 731–753. 10.1101/gr.GR-1697R
9
BraunV.HertwigS.NeveH.GeisA.TeuberM. (1989). Taxonomic differentiation of bacteriophages of Lactococcus lactis by electron microscopy, DNA-DNA hybridization, and protein profiles. J. Gen. Microbiol. 135, 2551–2560.
10
BrøndstedL.ØstergaardS.PedersenM.HammerK.VogensenF. K. (2001). Analysis of the complete DNA sequence of the temperate bacteriophage TP901-1: evolution, structure, and genome organization of lactococcal bacteriophages. Virology283, 93–109. 10.1006/viro.2001.0871
11
ChopinA.BolotinA.SorokinA.EhrlichS. D.ChopinM.-C. (2001). Analysis of six prophages in Lactococcus lactis IL1403: different genetic structure of temperate and virulent phage populations. Nucleic Acids Res. 29, 644–651. 10.1093/nar/29.3.644
12
DelcherA.HarmonD.KasifS.WhiteO.SalzbergS. (1999). Improved microbial gene identification with GLIMMER. Nucleic Acids Res. 27, 4636–4641. 10.1093/nar/27.23.4636
13
DesiereF.MahanivongC.HillierA. J.ChandryP. S.DavidsonB. E.BrüssowH. (2001). Comparative genomics of lactococcal phages: insight from the complete genome sequence of Lactococcus lactis phage BK5-T. Virology283, 240–252. 10.1006/viro.2001.0857
14
DeveauH.LabrieS. J.ChopinM. C.MoineauS. (2006). Biodiversity and classification of lactococcal phages. Appl. Environ. Microbiol. 72, 4338–4346. 10.1128/AEM.02517-05
15
FischerK.SteinK.UlmerA. J.LindnerB.HeineH.HolstO. (2011). Cytokine-inducing lipoteichoic acids of the allergy-protective bacterium Lactococcus lactis G121 do not activate via Toll-like receptor 2. Glycobiology21, 1588–1595. 10.1093/glycob/cwr071
16
FischerK.VinogradovE.LindnerB.HeineH.HolstO. (2012). The structure of the extracellular teichoic acids from the allergy-protective bacterium Lactococcus lactis G121. Biol. Chem. 393, 749–755. 10.1515/hsz-2012-0142
17
GaoY.LuY.TengK.-L.ChenM.-L.ZhengH.-J.ZhuY.-Q.et al. (2011). Complete genome sequence of Lactococcus lactis subsp. lactis CV56, a probiotic strain isolated from the vagina of healthy women. J. Bacteriol. 193, 2886–2887. 10.1128/JB.00358-11
18
GassonM. J. (1990). In vivo genetic systems in lactic acid bacteria. FEMS Microbiol. Rev. 87, 43–60. 10.1111/j.1574-6968.1990.tb04878.x
19
GiaourisE.BriandetR.MeyrandM.CourtinP.Chapot-ChartierM.-P. (2008). Variations in the degree of D-alanylation of teichoic acids in Lactococcus lactis alter resistance to cationic antimicrobials but have no effect on bacterial surface hydrophobicity and charge. Appl. Environ. Microbiol. 74, 4764–4767. 10.1128/AEM.00078-08
20
HaftD. H.SelengutJ. D.RichterR. A.HarkinsD.BasuM. K.BeckE. (2013). TIGRFAMs and Genome properties in 2013. Nucleic Acids Res. 41, D387–D395. 10.1093/nar/gks1234
21
HugginsA. R.SandineW. E. (1977). Incidence and properties of temperate bacteriophages induced from lactic streptococci. Appl. Environ. Microbiol. 33, 184–191.
22
JarvisA. W.FitzgeraldG. F.MataM.MercenierA.NeveH.PowellI. B.et al. (1991). Species and type phages of lactococcal bacteriophages. Intervirology32, 2–9.
23
KatoH.ShiwaY.OshimaK.MachiiM.Araya-KojimaT.ZendoT.et al. (2012). Complete genome sequence of Lactococcus lactis IO-1, a lactic acid bacterium that utilizes xylose and produces high levels of L-lactic acid. J. Bacteriol. 194, 2102–2103. 10.1128/JB.00074-12
24
KellyW. J.WardL. J. H.LeahyS. C. (2010). Chromosomal diversity in Lactococcus lactis and the origin of dairy starter cultures. Genome Biol. Evol. 2, 729–744.
25
LabrieS.MoineauS. (2002). Complete genomic sequence of bacteriophage ul36: demonstration of phage heterogeneity within the P335 quasi-species of lactococcal phages. Virology296, 308–320. 10.1006/viro.2002.1401
26
LabrieS. J.JosephsenJ.NeveH.VogensenF. K.MoineauS. (2008). Morphology, genome sequence, and structural proteome of type phage P335 from Lactococcus lactis. Appl. Environ. Microbiol. 74, 4636–4644. 10.1128/AEM.00118-08
27
LabrieS. J.MoineauS. (2007). Abortive infection mechanisms and prophage sequences significantly influence the genetic makeup of emerging lytic lactococcal phages. J. Bacteriol. 189, 1482–1487. 10.1128/JB.01111-06
28
LawrenceR. C.HeapH. A.LimsowtinG.JarvisA. W. (1978). Cheddar cheese starters: current knowledge and practices of phage characteristics and strain selection. J. Dairy Sci. 61, 1181–1191. 10.3168/jds.S0022-0302(78)83703-5
29
Le BourgeoisP.Daveran-MingotM.-L.RitzenthalerP. (2000). Genome plasticity among related Lactococcus strains: identification of genetic events associated with macrorestriction polymorphisms. J. Bacteriol. 182, 2481–2491. 10.1128/JB.182.9.2481-2491.2000
30
MaderaC.MonjardínC.SuárezJ. E. (2004). Milk contamination and resistance to processing conditions determine the fate of Lactococcus lactis bacteriophages in dairies. Appl. Environ. Microbiol. 70, 7365–7371. 10.1128/AEM.70.12.7365-7371.2004
31
MadsenS. M.MillsD.DjordjevicG.IsraelsenH.KlaenhammerT. R. (2001). Analysis of the genetic switch and replication region of a P335-type bacteriophage with an obligate lytic lifestyle on Lactococcus lactis. Appl. Environ. Microbiol. 67, 1128–1139. 10.1128/AEM.67.3.1128-1139.2001
32
MahoneyJ.KotW.MurphyJ.AinsworthS.NeveH.HansenL. H.et al. (2013a). Investigation of the relationship between lactococcal cell wall polysaccharide genotype and 936 phage receptor binding protein phylogeny. Appl. Environ. Microbiol. 79, 4385–4392. 10.1128/AEM.00653-13
33
MahoneyJ.MartelB.TremblayD. M.NeveH.HellerK. J.MoineauS.et al. (2013b). Identification of a new P335 subgroup through molecular analysis of lactococcal phages Q33 and BM13. Appl. Environ. Microbiol. 79, 4401–4409. 10.1128/AEM.00832-13
34
MakarovaK.SlesarevA.WolfY.SorokinA.MirkinB.KooninE.et al. (2006). Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. U.S.A. 103, 15611–15616. 10.1073/pnas.0607117103
35
MoineauS.BorkaevM.HollerB. J.WalkerS. A.KondoJ. K.VedamuthuE. R.et al. (1996). Isolation and characterization of lactococcal bacteriophages from cultured buttermilk plants in the United States. J. Dairy Sci. 79, 2104–2111. 10.3168/jds.S0022-0302(96)76584-0
36
O'SullivanD.RossR. P.FitzgeraldG. F.CoffeyA. (2000). Investigation of the relationship between lysogeny and lysis of Lactococcus lactis in cheese using prophage-targeted PCR. Appl. Environ. Microbiol. 66, 2192–2198. 10.1128/AEM.66.5.2192-2198.2000
37
PenadésJ. R.DonderisJ.García-CaballerM.Tormo-MásM. Á.MarinaA. (2013). dUTPases, the unexplored family of signalling molecules. Curr. Opin. Microbiol. 16, 163–170. 10.1016/j.mib.2013.02.005
38
PuntaM.CoggillP. C.EberhardtR. Y.MistryJ.TateJ.BoursnellC.et al. (2012). The Pfam protein families database. Nucleic Acids Res. 40, D290–D301. 10.1093/nar/gkr1065
39
RademakerJ. L. W.HerbertH.StarrenburgM. J. C.NaserS. M.GeversD.KellyW. J.et al. (2007). Diversity analysis of dairy and nondairy Lactococcus lactis isolates, using a novel multilocus sequence analysis scheme and (GTG)5-PCR fingerprinting. Appl. Environ. Microbiol. 73, 7128–7137. 10.1128/AEM.01017-07
40
ReichmannN. T.GründlingA. (2011). Location, synthesis and function of glycolipids and polyglycerolphosphate lipoteichoic acid in Gram-positive bacteria of the phylum Firmicutes. FEMS Microbiol. Lett. 319, 97–105. 10.1111/j.1574-6968.2011.02260.x
41
RutherfordK.ParkhillJ.CrookJ.HorsnellT.RiceP.RanjandreamM.-A.et al. (2000). Artemis: sequence visualization and annotation. Bioinformatics16, 944–945. 10.1093/bioinformatics/16.10.944
42
SamsonJ. E.MoineauS. (2010). Characterization of Lactococcus lactis phage 949 and comparison with other lactococcal phages. Appl. Environ. Microbiol. 76, 6843–6852. 10.1128/AEM.00796-10
43
SanterM. (2010). Joseph Lister: first use of a bacterium as a ‘model organism’ to illustrate the cause of infectious disease of humans. Notes Rec. R. Soc. Lond. 64, 59–65. 10.1098/rsnr.2009.0029
44
SiezenR. J.BayjanovJ.RenckensB.WelsM.van HijumS. A. F. T.MolenaarD.et al. (2010). Complete genome sequence of Lactococcus lactis subsp. lactis KF147, a plant-associated lactic acid bacterium. J. Bacteriol. 192, 2649–2650. 10.1128/JB.00276-10
45
SiezenR. J.BayjanovJ. R.FelisG. E.van der SijdeM. R.StarrenburgM.MolenaarD.et al. (2011). Genome-scale diversity and niche adaptation analysis of Lactococcus lactis by comparative genome hybridization using multi-strain arrays. Microb. Biotechnol. 4, 383–402. 10.1111/j.1751-7915.2011.00247.x
46
SneathP. H.SokalR. R. (1962). Numerical taxonomy. Nature193, 855–860. 10.1038/193855a0
47
SpinelliS.CampanacciV.BlangyS.MoineauS.TegoniM.CambillauC. (2006). Modular structure of the receptor binding proteins of Lactococcus lactis phages. The RBP structure of the temperate phage TP901-901. J. Biol. Chem. 281, 14256–14262. 10.1074/jbc.M600666200
48
StadenR.BealK. F.BonfieldJ. K. (2000). The Staden package, 1998. Methods Mol. Biol. 132, 115–130.
49
TamuraK.PetersonD.PetersonN.StecherG.NeiM.KumarS. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. 10.1093/molbev/msr121
50
TatusovR.GalperinM.NataleD.KooninE. (2000). The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 28, 33–36. 10.1093/nar/28.1.33
51
TerzaghiB. E.SandineW. E. (1981). Bacteriophage production following exposure of lactic streptococci to ultraviolet radiation. J. Gen. Microbiol. 122, 305–311.
52
TrotterM.McAuliffeO.CallananM.EdwardsR.FitzgeraldG. F.CoffeyA.et al. (2006). Genome analysis of the obligately lytic bacteriophage 4268 of Lactococcus lactis provides insight into its adaptable nature. Gene366, 189–199. 10.1016/j.gene.2005.09.022
53
van SinderenD.KarsensH.KokJ.TerpstraP.RuitersM. H.VenemaG.et al. (2006). Sequence analysis and molecular characterization of the temperate lactococcal bacteriophage r1t. Mol. Microbiol. 19, 1343–1355. 10.1111/j.1365-2958.1996.tb02478.x
54
VeggeC. S.VogensenF. K.McGrathS.NeveH.van SinderenD.BrøndstedL. (2006). Identification of the lower baseplate protein as the antireceptor of the temperate lactococcal bacteriophages TP901-1 and Tuc2009. J. Bacteriol. 188, 55–63. 10.1128/JB.188.1.55-63.2006
55
VenturaM.ZomerA.CanchayaC.O'Connell-MotherwayM.KuipersO.TurroniF.et al. (2007). Comparative analyses of prophage-like elements present in two Lactococcus lactis strains. Appl. Environ. Microbiol. 73, 7771–7780. 10.1128/AEM.01273-07
56
WegmannU.O'Connell-MotherwayM.ZomerA.BuistG.ShearmanC.CanchayaC.et al. (2007). Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J. Bacteriol. 189, 3256–3270. 10.1128/JB.01768-06
57
WegmannU.OverwegK.JeansonS.GassonM.ShearmanC. (2012). Molecular characterization and structural instability of the industrially important composite metabolic plasmid pLP712. Microbiology158, 2936–2945. 10.1099/mic.0.062554-0
58
WhiteheadH. R. (1953). Bacteriophage in cheese manufacture. Bacteriol. Rev. 17, 109–123.
59
WhiteheadH. R.BushE. J. (1957). Phage-organism relationships among strains of Streptococus cremoris: the selection of strains as cheese starters. J. Dairy Res. 24, 381–386. 10.1017/S0022029900008931
60
WhiteheadH. R.CoxG. A. (1936). Phage phenomena in cultures of lactic streptococci. J. Dairy Res. 7, 55–62. 10.1017/S0022029900001655
Summary
Keywords
phage, Lactococcus lactis subsp. cremoris, dairy, starter culture, genome, integrase, cell wall polysaccharides
Citation
Kelly WJ, Altermann E, Lambie SC and Leahy SC (2013) Interaction between the genomes of Lactococcus lactis and phages of the P335 species. Front. Microbiol. 4:257. doi: 10.3389/fmicb.2013.00257
Received
07 July 2013
Accepted
13 August 2013
Published
30 August 2013
Volume
4 - 2013
Edited by
Andrea Del Luján Quiberoni, Consejo Nacional de Investigaciones Científicas y Técnicas - Universidad Nacional del Litoral, Argentina
Reviewed by
Mariángeles B. Marcó, Instituto de Lactología Industrial, Argentina; Diego J. Mercanti, Instituto de Lactología Industrial (Universidad Nacional del Litoral - Consejo Nacional de Investigaciones Científicas y Técnicas), Argentina
Copyright
© 2013 Kelly, Altermann, Lambie and Leahy.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: William J. Kelly, AgResearch Limited, Grasslands Research Centre, Tennent Drive, Private Bag 11008, Palmerston North 4442, New Zealand e-mail: bill.kelly@agresearch.co.nz
This article was submitted to Food Microbiology, a section of the journal Frontiers in Microbiology.
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.