ORIGINAL RESEARCH article

Front. Microbiol., 28 September 2016

Sec. Antimicrobials, Resistance and Chemotherapy

Volume 7 - 2016 | https://doi.org/10.3389/fmicb.2016.01556

Dynamics of a Class 1 Integron Located on Plasmid or Chromosome in Two Aeromonas spp. Strains

  • 1. Department of Biochemistry, Escuela Nacional de Ciencias Biológicas, del Instituto Politécnico Nacional Mexico City, Mexico

  • 2. Molecular Genetics Laboratory, Medical Research Unit, Pediatric Hospital, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social Mexico City, Mexico

Abstract

Integrons are non-mobile bacterial genetic elements that carry different cassettes conferring antibiotic resistance. Cassettes can excise or integrate by action of an integron-encoded integrase, enabling bacteria to face environmental challenges. In this work, the functionality and dynamics of two integrons carrying the same cassette arrangement (dfrA12–orfF–aadA2), but located on plasmid or chromosome in two different strains were studied. In order to demonstrate the functionality of the Class 1 integrase, circular cassette integration intermediaries were PCR amplified by PCR using extrachromosomal DNA extracted from bacteria grown in the presence or absence of cassette-encoded antibiotics. Circular aadA2 and dfrA12–orfF–aadA2 cassettes were detected in cultures grown either in the presence or absence of antibiotics in both strains. No dfrA12–orfF circular intermediates could be detected under any culture conditions. These results show that both integrons are functional. However, these elements show different dynamics and functionality since the presence of streptomycin led to detectable gene rearrangements in the variable region only in the strain with the plasmid-born integron. In addition, complete integration products were demonstrated using a receptor molecule carrying an empty integron. In this case, integration products were observed in both strains even in the absence of antibiotics, but they were more evident in the strain with the plasmid-located integron when streptomycin was present in the culture medium. This suggests that integrons in the two strains respond differently to streptomycin even though DNA sequences upstream the intI1 gene, including the lexA boxes of both integrons are identical.

Introduction

Bacteria from the genus Aeromonas contain a variety of genetic elements including plasmids, transposons, bacteriophages, and integrons that contribute to the spread of antibiotic resistance determinants (Piotrowska and Popowska, 2015). Previous studies have found integrons in Aeromonas predominantly belonging to Class 1-carrying gene cassettes conferring resistance to several antibiotic groups. The most often found are different aminoglycoside resistance genes (aadA family) and trimethoprim-resistance genes (dfr family; Deng et al., 2016).

Integrons are genetic platforms that allow bacteria to acquire, excise, and reorder gene cassettes, which enables them to face environmental stress (Escudero et al., 2015). Integrons are unable to move by themselves. Platform components are the intI gene encoding a site-specific tyrosine-recombinase (IntI), which catalyzes the excision and integration of gene elements frequently encoding antibiotic resistance known as cassettes. A primary recombination attI site is found upstream the intI gene. Between these two elements a region carrying two divergent promoters is found. One of these promoters (PintI) controls the intI gene expression, whereas the Pc promoter is responsible for the expression of gene cassettes located in the variable region, which generally lack a promoter of their own (Mazel, 2006). Cassettes in the variable region are spaced by attC sequences, which are recognized by the integrase IntI to be excised or integrated. Excised genes move to other positions in the variable region via covalently closed circular intermediaries (Partridge et al., 2009). This cassette shuffling has a crucial effect on gene expression since genes closer to Pc are usually more expressed than those located farther away. Cassette rearrangements depend on the integrase activity, which is often regulated by the SOS response. Several antibiotic families are able to trigger this type of response, allowing bacteria to adapt to different selective pressures (Strugeon et al., 2016).

Integrons are classified in two groups depending on their location: mobile integrons (MIs), intimately associated to plasmids and transposons, which are the main vehicles of multiresistance in bacteria (Stalder et al., 2012), or chromosomal integrons (CIs), which are large and sedentary elements compared to mobile integrons. Superintegrons are a subgroup of CIs whose variable region exhibits more than 20 gene cassettes (Rowe-Magnus et al., 1999).

In this work, we aimed to study the dynamics and functionality of two identical Class 1 integrons with the cassette arrangement dfrA12–orfF–aadA2, found in Aeromonas dhakensis 3430-1 and A. hydrophila 6479 and differing in their localization (chromosome versus plasmid, respectively; Pérez-Valdespino et al., 2009).

Materials and Methods

Bacterial Strains and Plasmid

The two Aeromonas strains analyzed in this study were isolated from stool samples of patients who attended the Public Health Service at Hidalgo State, Mexico in 2005. The samples were provided by the patients in order to establish a diagnostic, and were not obtained directly from the patients themselves. Therefore, informed written consent was not necessary for this study. Strains were assigned to the Aeromonas genus through amplification of the GCAT (glycerophospholipid cholesterol acyl transferase) gene. For species confirmation the rpoD (RNA polymerase σ70 factor) gene was PCR amplified and sequenced (Figueras et al., 2009; Beaz-Hidalgo et al., 2010). The same Class 1 integron with different localization (chromosomal in strain 3430-1 and plasmid in strain 6479) was studied (Pérez-Valdespino et al., 2009). Acceptor pICV8 plasmid contains an attI site for cassette capture, an interrupted integrase gene, a Pc promoter, an incomplete aadA1 gene, and a zeocin-resistance gene (Shearer and Summers, 2009). This plasmid was transformed in Escherichia coli S17-1 λpir for mating experiments.

Determination of Minimal Inhibitory Concentrations

The minimum inhibitory concentration (MIC) for two antibiotics (trimethoprim and streptomycin) was established by the broth macrodilution method (Wikler, 2007).

Isolation of Circular Covalently Closed Integration Intermediaries

Extrachromosomal DNA was isolated using the Wizard Plasmid Miniprep Kit (Promega, Fitchburg, WI, USA) from overnight cultures grown in the presence or absence of antibiotics. After extraction, the recovered 50 μL extrachromosomal DNA was concentrated 10 times in order to increase the concentration of the integration intermediaries.

PCR Amplification of Circular Integration Intermediaries

Extrachromosomal DNA (1 μL) was used as a template to search for circular integration intermediaries through polymerase chain reaction. For this purpose, outward primers (aadA2 amino, aadA2 carboxy, dfr12 amino, dfr12 carboxy, and orfF carboxy), aimed to amplify single, double or triple excision intermediaries were designed (Table 1). Amplifications were performed in an Eppendorf Mastercycler® gradient thermal cycler (Eppendorf, Hamburg, Germany). Reactions included 12.5 μL PCR Master Mix 2X (Fermentas, Vilnius, Lithuania), 3 μL (200–300 ng) template DNA from cultures grown with or without antibiotic and 10 pmol/μL of each primer to a final volume of 25 μL. Amplification consisted of DNA denaturation at 94°C for 5 min followed by 30 PCR cycles (DNA denaturation at 94°C for 0.5 min, primer annealing at 53°C for 0.5 min, and DNA extension at 72°C for 1.0 min), and a final extension step at 72°C for 7 min. Amplicons were reamplified and sequenced to confirm the identity of PCR products.

Table 1

Primer nameSequence 5′–3′TemplateReference
aadA2 aminoGCCATCCACTGCGGAGCircular excisionThis study
aadA2 carboxyGCCCGTCTTACTTGAAGCIntermediaries
dfr12 aminoTTTCCCTCAGTGAGTCTGC
dfr12 carboxyATACACTCTGGCACTACCTCAC
orfF carboxyGCTTACCTCGCCCGTTAG
IntPcFwAACCCAGTGGACATAAGCClexA box
dfr12 amino QCGTACTGATTCCGAGTTCAT
in-FGGCATCCAAGCAGCAAGCIntegron variableSchmidt et al., 2001
in-BAAGCAGACTTGACCTGAT
8E-U1CCTCGTTλGGACAAGGACCTGAGpICV8 derivativesShearer and Summers, 2009
aadA2-L2GCGAGCTGCAATTTGGAGAATGG
4E-L2GCCTATGCCTACAGCATCCAGGGTGAC
dfrA12 U1GCCTGλAGCTλTGCCGTTTG
Int1_upλCCGAGGATGCGAACCACTTmRNASoler et al., 2004
Int1_dwCAACCTTGGGCAGCAGCGAA
GCAT fwCTCCTGGAATCCCAAGTATCAG
GCAT rvGGCAGGTTGAACAGCAGTATCT

Sequence of primers used in this study.

PCR Amplification of Variable Integron Regions

Cells grown overnight at 37°C in Luria Broth supplemented with streptomycin (32 or 256 μg/mL), trimethoprim (128 μg/mL), or in the absence of antibiotics. DNA was extracted (Sambrook and Russell, 2001) and used to amplify the integron variable regions. Amplifications were performed with the previously reported primers in-F and in-B (Schmidt et al., 2001). PCR conditions were as above, except the annealing temperature was 56°C and the extension time was 1.5 min.

Assay to Assess the Mobility of Cassettes from Chromosome or Plasmid

Mating experiments using E. coli S17-1 λ pir (PICV8) as a donor and strains 3430-1 and 6479 as recipients were performed to assess gene cassette mobility. Transconjugants were selected on LB plates containing 50 μg/mL ampicillin plus 75 μg/mL zeocin. After selection strains were grown in antibiotic-free medium and plasmid DNA was isolated in order to confirm the presence of pICV8. Plasmids extracted from transconjugants grown overnight in the presence of 32 and 256 μg/mL streptomycin or in absence of antibiotic were used as templates for PCR amplification reactions. Primers to amplify the pICV8/cassette junctions (Shearer and Summers, 2009 and this work) were used for these experiments (Table 1).

Real Time RT-PCR

intI1 expression levels were evaluated through real-time RT-PCR from cultures grown in the presence of 32 or 256 μg/mL streptomycin or in the absence of antibiotics. Total RNA from cultured cells was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). RNA was reverse transcribed and amplified using the SuperScriptTM III Platinum® SYBR® Green One-Step qRT-PCR Kit, supplemented with ROX dye (Life Technologies, Carlsbad, CA, USA). Each experimental condition was repeated three times in assays performed in triplicate. Expression values were normalized using the GCAT gene and relative expression levels were calculated using the 2-ΔΔCT method (Yuan et al., 2008). The primers used in real time RT-PCR assays are shown in Table 1.

PCR Amplification of lexA Boxes

PCR was performed with primers IntPcFw and dfr12 amino Q that were designed for this work (Table 1). The amplification was performed as above. Amplicons were sequenced to analyze the lexA boxes.

Results

Strains Identification

Strains were assigned to the genus Aeromonas through PCR amplification of GCAT gene. Species were assessed by amplification and sequencing of the rpoD gene. Strains 3430-1 and 6479 were classified as A. dhakensis, previously A. caviae (Pérez-Valdespino et al., 2009) and A. hydrophila, respectively.

Determination of Minimal Inhibitory Concentrations

The MIC values for streptomycin and trimethoprim for both strains were 32 μg/mL and 128, respectively.

Study of Integration Intermediaries through PCR

Circular excision products corresponding to the individual aadA2 cassette and to the entire variable region including cassettes dfrA12–orfF–aadA2 were detected in cultures grown either in the presence or absence of antibiotics in both strains (data not shown). Covalently closed circular cassette dfrA12–orfF was not detected under any experimental conditions. Identity of circular intermediaries was confirmed by sequencing.

Amplification of the Integron Variable Regions from Cultures Grown in the Presence or Absence of Antibiotics

The integron variable regions were amplified from total DNA extracted from cells cultured in medium with or without antibiotics. Changes in the variable region were observed in strain 6479 but no in strain 3430-1 grown in the presence of streptomycin. Trimethoprim did not induce any changes in the integron variable regions. Each amplification band was sequenced to characterize the different arrangements of the variable region (Figure 1).

FIGURE 1

Assessment of Cassette Mobility from Plasmid or Chromosome DNA to the Acceptor Plasmid

In order to substantiate whether Class 1 integron-encoded IntI1 could mediate the excision and subsequent integration of gene cassettes to an empty integron, the acceptor plasmid (pICV8) was introduced by conjugation to both Aeromonas strains. After mating, plasmid DNA was extracted from transconjugants and cassettes inserted into pICV8 were amplified by PCR. It was observed that IntI1 was able to mediate the movement of the entire dfrA12–orfF–aadA2 region to pICV8 in A. hydrophila 6479 and A. dhakensis 3430-1. These cassette movements were observed even in the absence of streptomycin. Streptomycin addition led to the occurrence of two additional integration products in strain 6479 (aadA2–dfrA12–orfF and orfF–aadA2–dfrA12). Figure 2 shows the amplicons produced as well as the primers employed. Structures of these new arrangements show that integration in pICV8 was accompanied with cassette reorganization. It is important to emphasize that the product from the variable region maintaining the original gene arrangement was always more abundant than those resulting from cassette switching. These integration events were more evident at the highest streptomycin concentration used (Figure 2).

FIGURE 2

Analysis of Integrase Expression

Quantitative RT-PCR assays evidenced changes in the intI1 transcript levels in the presence of 256 μg/mL streptomycin in A. hydrophila 6479 (Figure 3), resulting in increased cassette rearrangements in this strain (Figure 2). No change in integrase mRNA levels could be documented in A. dhakensis 3430-1 in the presence of streptomycin.

FIGURE 3

Amplification of the lexA Box

In order to determine if both integrons are potentially regulated by the SOS response, we amplified a 286-bp long region upstream of the intI1 gene. Analysis of the sequences showed identical lexA boxes in both strains (Figure 4).

FIGURE 4

Discussion

Integrons are genetic systems that help prokaryotes adapt to different environments, acting as gene reservoirs located in both mobile and non-mobile genetic elements (Stokes and Gillings, 2011). The presence of integrons in environmental and clinical Aeromonas strains has been documented (Chang et al., 2007; Jacobs and Chenia, 2007). No obvious differences in the gene arrangements between these types of strains seem to exist. Literature reports that Class 1 integrons are mainly associated to plasmids, which contributes to their dissemination. It is important to point out that the genus Aeromonas has a low incidence of plasmids (Brown et al., 1997; Lee et al., 2008). Additionally, it has been described that some plasmids are unable to establish in some A. hydrophila strains (Bello-López et al., 2012). In this work, we aimed to investigate the functionality and dynamics of two Class 1 integrons with the same variable region but different localization (Pérez-Valdespino et al., 2009). The occurrence of identical variable regions in integrons from different strains could indicate that such elements are unable of exchanging cassettes and are thus inactive. This work shows that both integrons are functional, as evidenced by the detection of circular integration intermediaries. We could detect the formation of an aadA2 circular cassette and even a circular intermediate corresponding to the entire variable region in both strains. To this end, we used highly concentrated extrachromosomal DNA as a template. Others have reported the excision of single gene cassettes, but only using hosts that overexpress the integrase gene (Collis et al., 2001; Dubois et al., 2007). These data confirm the extraordinary low abundance of circular cassettes. To our knowledge, no other reports detecting circular intermediaries bearing more than one cassette exist.

Selective pressure with streptomycin led also to detectable modifications of the integron variable regions. Changes in the variable region identical to those expected to result from the excision of the circular intermediaries were detected only in the strain carrying the plasmid version of the integron (Figure 1). Results reveal that integrons from these two different localizations respond differently to streptomycin. One of the rearrangements lacks the aadA2 cassette. Excision and reintegration of the cassette in the first position of the array, closer to the Pc promoter, would increase the streptomycin resistance. The faint band around 2000 bp in Figure 2B lane 4–6 could result from this rearrangement. In this way, excision and integration of cassettes would help bacteria to cope with the selective pressure posed by streptomycin (Mazel, 2006; Michael and Labbate, 2010). Literature reports show that trimethoprim, which inhibits DNA synthesis, induces the expression of integrase in E. coli and Vibrio sp. (Guerin et al., 2009). In contrast, our data show no integrase induction by trimethoprim. Baharoglu et al. (2013) reported that streptomycin induces SOS response in Vibrio cholerae but not in E. coli. In this work, we demonstrate that this antibiotic acts as an integrase inducer only in strain 6479 (Figure 1).

Shearer and Summers (2009) quantified the integrase activity by measuring the integrase-mediated plasmid recombination products. To determine if plasmid or chromosomal localization influence the integrase ability to transfer gene cassettes to a recipient plasmid, we introduced pICV8 to strains 3430-1 and 6479 and searched for integration products. We found that the original cassette array (dfrA12–orfF–aadA2) was successfully integrated into pICV8 regardless of its plasmid or chromosomal origin. We conclude that normal integrase levels are sufficient to complete the cassette integration event. It is also possible that integration was due to increased integrase levels triggered by the entrance of single stranded DNA during conjugation (Baharoglu et al., 2010). Transconjugant Aeromonas bearing pICV8::dfrA12–orfF–aadA2 were grown in the presence of streptomycin. Strain 6479 yielded a higher number of arrangements than strain 3430-1, suggesting that IntI1 is more expressed in the first strain (Figure 2). This was confirmed by qRT-PCR (Figure 3).

Recent reports indicate that integrase expression is regulated by the SOS system, that activates in response to DNA damage or to a stop in DNA replication, which leads to the accumulation of single strand DNA that in turn induces the expression of multiple genes related to recombination, repair and cell division (Foster, 2005; Erill et al., 2007). Our results suggest that streptomycin-induced stress leads to activation of the SOS system, which increases the expression of the integrase, resulting in the gene rearrangements observed in the plasmid-born integron. However, we could document cassette excision in both strains, which suggests that another type of regulation could be involved in the expression of the chromosomal intI1 gene of strain 3430-1. A higher intI1 gene dosage from the plasmid located integron could have contributed to the increased cassette rearrangements observed.

Not all Class 1 integrons are SOS-regulated since some of them contain a secondary promoter Pc2 that is activated by a GGG insertion that disrupts the lexA box, relieving the intI gene from SOS control (Cambray et al., 2010). Analysis of the upstream region of intI1 did not reveal a second promoter. Sequences also revealed identical lexA boxes in both strains, which contrasts with the lack of integrase induction in strain 3430-1. This apparent SOS independence would contribute to the production of basal levels of transcripts of antibiotic resistance genes, which would stabilize the integron in its chromosomal location.

Conclusion

Our experiments show that identical integrons in two Aeromonas strains show a different behavior in response to streptomycin, which might result from differences in the host background.

Statements

Author contributions

All authors listed, have made substantial, direct and intellectual contribution to the work, and approved it for publication.

Acknowledgments

This work was supported by SIP grant 20141312. We are grateful to Dr. Julie Shearer, Department of Microbiology, University of Georgia, Athens, GA, USA for the generous gift of strain CB454 bearing plasmid pICV8. AL-M is a graduate CONACYT scholarship recipient. EC-Q is a COFAA and EDI fellow.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer PL-F and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review.

References

  • 1

    BaharogluZ.BabosanA.MazelD. (2013). Identification of genes involved in low aminoglycoside-induced SOS response in Vibrio 8holera: a role for transcription stalling and Mfd helicase.Nucleic Acids Res.4223662379. 10.1093/nar/gkt1259

  • 2

    BaharogluZ.BikardD.MazelD. (2010). Conjugative DNA transfer induces the bacterial SOS response and promotes antibiotic resistance development through integron activation.PloS Genet.6:e1001165. 10.1371/journal.pgen.1001165

  • 3

    Beaz-HidalgoR.AlperiA.BujánN.RomaldeJ. L.FiguerasM. J. (2010). Comparison of phenotypical and genetic identification of Aeromonas strains isolated from diseased fish.Syst. Appl. Microbiol.33149153. 10.1016/j.syapm.2010.02.002.a

  • 4

    Bello-LópezJ. M.Vázquez-OcampoN. J.Fernández-RendónE.Curiel-QuesadaE. (2012). Inability of some Aeromonas hydrophila strains to act as recipients of plasmid pRAS1 in conjugal transfer experiments.Curr. Microbiol.64332337. 10.1007/s00284-011-0076-1

  • 5

    BrownR. L.SandersonK.KirovS. M. (1997). Plasmids and Aeromonas virulence.FEMS Immunol. Med. Microbiol.17217223. 10.1111/j.1574-695x.1997.tb01015.x

  • 6

    CambrayG.GueroutA. M.MazelD. (2010). Integrons.Annu. Rev. Genet.44141166. 10.1146/annurev-genet-102209-163504

  • 7

    ChangY.-C.ShihD. Y.-C.WangJ.-Y.YangS.-S. (2007). Molecular characterization of class 1 integrons and antimicrobial resistance in Aeromonas strains from foodborne outbreak-suspect samples and environmental sources in Taiwan.Diagn. Microbiol. Infect. Dis.59191197. 10.1016/j.diagmicrobio.2007.04.007

  • 8

    CollisC. M.RecchiaG. D.KimM.-J.StokesH. W.HallR. M. (2001). Efficiency of recombination reactions catalyzed by class 1 integron integrase Inti1.J. Bacteriol.18325352542. 10.1128/jb.183.8.2535-2542.2001

  • 9

    DengY.WuY.JiangL.TanA.ZhangR.LuoL. (2016). Multi-drug resistance mediated by class 1 integrons in Aeromonas isolated from farmed freshwater animals.Front. Microbiol.7:935. 10.3389/fmicb.2016.00935

  • 10

    DuboisV.DebreyerC.LitvakS.QuentinC.ParissiV. (2007). A new in vitro strand transfer assay for monitoring bacterial class 1 integron recombinase IntI1 activity.PLoS ONE2:e1315. 10.1371/journal.pone.0001315

  • 11

    ErillI.CampoyS.BarbéJ. (2007). Aeons of distress: an evolutionary perspective on the bacterial SOS response.FEMS Microbiol. Rev.31637656. 10.1111/j.1574-6976.2007.00082.x

  • 12

    EscuderoJ. A.MazelD.NivinaA.LootC. (2015). The integron: adaptation on demand.Microbiol. Spectr.3:MDNA3-0019-2014. 10.1128/microbiolspec.mdna3-0019-2014

  • 13

    FiguerasM. J.AlperiA.SaavedraM. J.KoW.-C.GonzaloN.NavarroM.et al (2009). Clinical relevance of the recently described species Aeromonas aquariorum.J. Clin. Microbiol.4737423746. 10.1128/jcm.02216-08

  • 14

    FosterP. L. (2005). Stress responses and genetic variation in bacteria.Mutat. Res.569311. 10.1016/j.mrfmmm.2004.07.017

  • 15

    GuerinE.CambrayG.Sanchez-AlberolaN.CampoyS.ErillI.ReS. D.et al (2009). The SOS response controls integron recombination.Science32410341034. 10.1126/science.1172914

  • 16

    JacobsL.CheniaH. Y. (2007). Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. Isolated from South African aquaculture systems.Int. J. Food Microbiol.114295306. 10.1016/j.ijfoodmicro.2006.09.030

  • 17

    LeeM. F.PengC. F.LinY. H.LinS. R.ChenY. H. (2008). Molecular diversity of class 1 integrons in human isolates of Aeromonas spp. From southern Taiwan.Jpn. J. Infect.61343349.

  • 18

    MazelD. (2006). Integrons: agents of bacterial evolution.Nat. Rev. Microbiol.4608620. 10.1038/nrmicro1462

  • 19

    MichaelC. A.LabbateM. (2010). Gene cassette transcription in a large integron-associated array.BMC Genet.11:82. 10.1186/1471-2156-11-82

  • 20

    PartridgeS. R.TsafnatG.CoieraE.IredellJ. R. (2009). Gene cassettes and cassette arrays in mobile resistance integrons.FEMS Microbiol. Rev.33757784. 10.1111/j.1574-6976.2009.00175.x

  • 21

    Pérez-ValdespinoA.Fernandez-RendonE.Curiel-QuesadaE. (2009). Detection and characterization of class 1 integrons in Aeromonas spp. Isolated from human diarrheic stool in Mexico.J. Basic Microbiol.49572578. 10.1002/jobm.200900095

  • 22

    PiotrowskaM.PopowskaM. (2015). Insight into the mobilome of Aeromonas strains.Front. Microbiol.6:494. 10.3389/fmicb.2015.00494

  • 23

    Rowe-MagnusD. A.GuéroutA.-M.MazelD. (1999). Super-integrons.Res. Microbiol.150641651. 10.1016/s0923-2508(99)00127-8

  • 24

    SambrookJ.RussellD. W. (2001). Molecular Cloning: A Laboratory Manual.Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

  • 25

    SchmidtA. S.BruunM. S.LarsenJ. L.DalsgaardI. (2001). Characterization of class 1 integrons associated with R-plasmids in clinical Aeromonas salmonicida isolates from various geographical areas.J. Antimicrob. Chemother.47735743. 10.1093/jac/47.6.735

  • 26

    ShearerJ. E.SummersA. O. (2009). Intracellular steady-state concentration of integron recombination products varies with integrase level and growth phase.J. Mol. Biol.386316331. 10.1016/j.jmb.2008.12.041

  • 27

    SolerL.YáñezM. A.ChaconM. R.Aguilera-ArreolaM. G.CatalánV.FiguerasM. J.et al (2004). Phylogenetic analysis of the genus Aeromonas based on two housekeeping genes.Int. J. Syst. Evol. Microbiol.5415111519. 10.1099/ijs.0.03048-0

  • 28

    StalderT.BarraudO.CasellasM.DagotC.PloyM.-C. (2012). Integron involvement in environmental spread of antibiotic resistance.Front. Microbiol.3:119. 10.3389/fmicb.2012.00119

  • 29

    StokesH. W.GillingsM. R. (2011). Gene flow, mobile genetic elements and the recruitment of antibiotic resistance genes into gram-negative pathogens.FEMS Microbiol. Rev.35790819. 10.1111/j.1574-6976.2011.00273.x

  • 30

    StrugeonE.TilloyV.PloyM.-C.Da ReS. (2016). The stringent response promotes antibiotic resistance dissemination by regulating integron integrase expression in biofilms.MBio7:e00868-16. 10.1128/mBio.00868-16

  • 31

    WiklerM. A. (2007). Performance Standards for Antimicrobial Susceptibility Testing: Seventeenth Informational Supplement.Wayne, PA: Clinical and Laboratory Standards Institute.

  • 32

    YuanJ. S.WangD.StewartC. N. (2008). Statistical methods for efficiency adjusted real-time PCR quantification.Biotechnol. J.3112123. 10.1002/biot.200700169

Summary

Keywords

Aeromonas, Class 1 integrons, streptomycin, integrase expression, SOS response

Citation

Pérez-Valdespino A, Lazarini-Martínez A, Rivera-González AX, García-Hernández N and Curiel-Quesada E (2016) Dynamics of a Class 1 Integron Located on Plasmid or Chromosome in Two Aeromonas spp. Strains. Front. Microbiol. 7:1556. doi: 10.3389/fmicb.2016.01556

Received

15 June 2016

Accepted

16 September 2016

Published

28 September 2016

Volume

7 - 2016

Edited by

Estelle Jumas-Bilak, University of Montpellier 1, France

Reviewed by

Durg Vijai Singh, Institute of Life Sciences, India; Vishvanath Tiwari, Central University of Rajasthan, India; Patricia Licznar-Fajardo, University of Montpellier 1, France

Updates

Copyright

*Correspondence: Everardo Curiel-Quesada,

This article was submitted to Antimicrobials, Resistance and Chemotherapy, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics