ORIGINAL RESEARCH article

Front. Microbiol., 08 November 2016

Sec. Food Microbiology

Volume 7 - 2016 | https://doi.org/10.3389/fmicb.2016.01769

Distribution of Native Lactic Acid Bacteria in Wineries of Queretaro, Mexico and Their Resistance to Wine-Like Conditions

  • Departamento de Investigación y Posgrado en Alimentos, Facultad de Química, Universidad Autónoma de Querétaro Santiago de Querétaro, Mexico

Abstract

Native lactic acid bacteria (LAB) are capable of growing during winemaking, thereby strongly affecting wine quality. The species of LAB present in musts, wines during malolactic fermentation (MLF), and barrels/filters were investigated in wineries from the emerging wine region of Queretaro, México using multiplex PCR and culture. The resistance to wine-like conditions (WLC): ethanol (10, 12, and 13%), SO2 (30 mg⋅l-1), and low pH (3.5) of native LAB strains was also studied. Five species were detected within 61 samples obtained: Oenococcus oeni, Lactobacillus plantarum, Pediococcus parvulus, Lactobacillus hilgardi, and Lactobacillus brevis. Four species (excepting L. brevis) were found in must; O. oeni and P. parvulus were ubiquitous in wine and L. plantarum and L. brevis were mainly present at the initial stage of MLF, while L. hilgardii was mostly detected at the advanced stage. Furthermore, some species detected in barrel/filter, prove them to be hazardous reservoirs. From 822 LAB isolates, only 119 resisted WLC with 10% ethanol; the number of strains able to grow in WLC with 13% ethanol decreased approximately by 50%, O. oeni being the most versatile species with 65% of resistant isolates, while Lactobacillus spp. and P. parvulus were the most strongly affected, especially those recovered from barrel/filter, with less than 10% of resistant isolates. This study evidences the presence of local strains able to be used as starter cultures, and also enabled the assessment of the risks derived from the presence of spoilage LAB strains resistant to WLC.

Introduction

The conversion from grape must into wine is a complex process that involves the development of various microorganisms, including lactic acid bacteria (LAB). However, wine is considered an unsuitable environment for microbial growth due to its low pH, high concentrations of ethanol and sulfur dioxide (SO2), and other limiting factors (). The LAB capable of overcoming these conditions mainly belong to Oenococcus, Lactobacillus, Pediococcus, and Leuconostoc genera ().

In order to have any effect on wine quality, LAB should be able to not only survive, but also to grow within wine (), and the effect produced therein will depend on the major species present and their ability to overcome the harsh environment of winemaking (). The specie Oenococcus oeni is known as the main one responsible for malolactic fermentation (MLF), a process in which L-malic acid is decarboxylated into L-lactic acid, causing a partial deacidification, conferring microbial stability, and improving wine flavor profile (). However, some other LAB, such as Pediococcus spp. and some species of Lactobacillus, are widely associated with wine spoilage, often producing biogenic amines, off-odors, and other undesirable metabolites ().

Moreover, LAB can enter wine from vineyard or winery equipment (), and their diversity is influenced by grape variety and geographic region (). Therefore, it is advisable to study the autochthonous LAB of a particular winemaking area in order to detect potential starter cultures or species that represent risks of wine spoilage (). The use of molecular techniques to achieve this porpoise is currently preferred; some of them, such as ARDRA (), DGGE (), or new generation sequencing (), display all the diversity of bacteria present in a sample. Meanwhile, other techniques, such as multiplex PCR described by , are aimed at those bacteria of particular interest in winemaking. This particular technique allows the identification of 13 of the principal LAB associated with winemaking in a simple PCR assay, facilitating data processing or subsequent analyses to complete the identification of an amplicon.

Several studies intending to elucidate the presence, distribution, and adaptation of wine associated LAB have already been performed in wineries from regions with an extensive winemaking tradition, such as Mentrida (), La Rioja (), Patagonia (), and Apulia (). However, this kind of studies are missing in areas where the development of this industry is recent, like Queretaro State in Mexico. This region is considered nowadays the second most important within the Mexican territory. Located in the central area of the country, the climate is semi dry and temperate, the soils are deep with either a clayey loam texture or lightly calcareous. In 2013, above 350 ha of vineyards were censed and wine production was estimated in 1.5 millions of liters (). To date, the main varieties established are ‘Merlot,’ ‘Cabernet Sauvignon,’ ‘Syrah,’ and ‘Tempranillo’ as well as the white varieties ‘Macabeo’ and ‘Chardonnay’ (). Wines possess low ethanol contents (from 9 to 12%) and a total titratable acidity around 7 g/L tartaric acid (). Wineries usually use commercial yeasts to guarantee an optimal alcoholic fermentation, but MLF is almost always carried out spontaneously, which makes it very unpredictable.

The aim of this research was to elucidate the principal LAB species present in strategic materials in wineries established in Queretaro and to determine their resistance to wine-like conditions (WLC), including high ethanol concentrations and low pH, in order to assess risks and detect possible starter cultures within local strains.

Materials and Methods

Experimental Site and Sampling

This study was conducted in four wineries named A, B, C, and D, located in Queretaro State, Mexico. Wineries A, B, and C have the respective vineyards and are located in the municipality of Ezequiel Montes, approximately 205 km from Mexico City. Winery D lacks a vineyard and is located 21 km from the others, in the municipality of Tequisquiapan. At winery C commercial cultures of LAB are used to induce MLF after finishing alcoholic fermentation; at winery B a commercial inoculum of LAB was used for the first time the year of the study, and at wineries A and D, MLF is left to occur spontaneously.

Depending on the availability at the wineries, different types of samples were collected, their characteristics are described in Table 1. Must, wine and barrel/filter samples were taken at winery A; must and wine at winery B; only must at winery C and only wine at winery D. Each type of sample was collected in triplicate as follows:

Table 1

WinerySample typeN1Sugar content (°Bx)pHEthanol (%, v/v)SO2 Total (mg⋅L-1)
AMust12233.8--
Wine-i353.412.131.5
Wine-m353.612.131.5
Wine-a353.712.131.5
Barrel/filter4----
BMust15223.8--
Wine-i353.411.929.8
CMust9213.7--
DWine-i344.112.633.1
Wine-m343.712.633.1
Wine-a343.812.633.1

Principal characteristics of the samples collected.

1Total number of samples.

Data reported as mean of three replicates per sample analyzed.

  • (i)

    Must: Four mature bunches of grapes from the varieties: ‘Cabernet Sauvignon,’ ‘Tempranillo,’ and ‘Syrah’ at wineries A and B, and only ‘Macabeo’ at C, were randomly sampled in triplicates using plastic bags (20 cm × 30 cm). Also, 500 ml of must were taken from the stemmer of wineries A and B (one and two batches, respectively). Once they reached the laboratory, bunches were manually crushed inside their bags, the musts obtained from grapes and those collected from the stemmers were transferred to sterile flasks (500 ml) and left to spontaneously ferment at 25°C. For 15 days, aliquots of fermenting must were obtained every 5 days for molecular and microbial analyses.

  • (ii)

    Wine: Samples were taken once the alcoholic fermentation had ended. At wineries A and D, 100 ml of wine were sampled from three fermentation tanks, in three stages of MLF: (a) beginning, (b) intermediate, and (c) advance. At winery B, only the beginning stage was sampled, before a commercial strain inoculation. At each winery three types of wines were collected: two single-variety, one ‘Cabernet Sauvignon,’ another ‘Tempranillo,’ and the third a blend of ‘Grenache,’ ‘Carignan,’ ‘Syrah,’ and ‘Nebbiolo.’

  • (iii)

    Barrel/filter: The inside of a barrel was rinsed with 500 ml of peptone diluent (0.1%, pH 5), which was swirled five times; afterward the diluent was recovered in a sterile flask. Three filters were also individually collected in plastic bags. Once they reached the laboratory, 100 ml of peptone diluent was added to each filter and then homogenized in a Stomacher® 400 (Seward Ltd.) at medium speed for 1 min.

LAB Enumeration and Isolation

Must, wine and barrel/filter rinse aliquots (1 mL) were taken for serial dilutions and plated in three culture media: Man Rogosa Sharpe (MRS; DIBICO), MRS added to tomato juice (10%, v/v; ) or to apple juice (15%, v/v; ). All media were adjusted to pH 4.8 and supplemented with natamycin (100 mg⋅l-1) and sodium azide (50 mg⋅l-1) to prevent yeast and acetic acid bacteria growth, respectively (). Incubation was carried out at 30°C for 8 days. As bacterial population is a non-normal data, the results were statistically analyzed using the non-parametric Kruskal – Wallis with Dunn’s post hoc test using the software JMP 9.0.

From culture plates, approximately 5% of the colonies were isolated and purified. Gram stain and catalase tests were performed to confirm the isolates belonging to LAB group. Isolates were preserved in MRS broth with glycerol 20% at -80°C until subsequent identification and resistance tests.

Isolates Resistance to Wine-Like Conditions

The isolates’ ability to grow in the presence of ethanol, SO2, and low pH (WLC) was assessed through automatic readings of optical density (OD; every 20 min, for 72 h, at 30°C) using a Bioscreen© analyzer (). Approximately 5 Log CFU⋅ml-1 (OD = 0.2) of each LAB isolate were inoculated in individual wells containing 200 μL of synthetic medium similar to wine (SW, ) added to 53 mg⋅l-1 of potassium metabisulfite (equivalent to 30 mg⋅l-1 SO2), pH 3.5, and ethanol (10, 12, and 13%). As positive control, the isolates were also inoculated in the SW medium (pH 4) without the inhibitors. Detection time (DT), an indirect measure of the lag phase, was used as a response variable, considering the strain to be resistant to each condition when its DT value was lower than the total incubation time (72 h).

Detection of LAB Species in Wineries

The detection of species present in the wineries’ samples (must, wine, and barrel/filter) and the identification of LAB isolates capable of growing in WLC were both carried out using a multiplex PCR ().

DNA Extraction

Must, wine, and barrel/filter rinse aliquots (15 mL) were centrifuged (5000 × g, 10 min). From a cell pellet, DNA was extracted using the commercial kit Powersoil (MoBio Laboratories, Inc.) and the bench bead-top homogenizer PowerLyzer (MoBio Laboratories, Inc.) at 4500 rpm for 4 min, following the manufacturer’s instructions.

DNA extraction of LAB isolates was performed as follows: The strains were grown in 1 ml of MRS broth at 30°C for 3 days. The cell pellet obtained through centrifugation (13000 × g, 2 min) was re-suspended in 300 μl of lysis buffer (200 mM Tris–HCl, pH 8.5, 250 mM NaCl, 25 mM EDTA, 0.5% w/v SDS) with powdered glass (0.2 g). The suspension was shaken in a PowerLyzer (MoBio) at 4500 rpm for 1 min. After centrifugation at 13000 × g for 5 min, 150 μl of 3 M sodium acetate (pH 5.2) was added to the supernatant, which was stored at -20°C for 30 min and then centrifuged (13 000 × g, 10 min). The supernatant was transferred to a new tube and nucleic acids were precipitated with 400 μl of isopropanol and then washed with ethanol (70%). Finally, the DNA was re-suspended in 25 μl of TE buffer ().

Multiplex PCR

The multiplex PCR was done using Multiplex Mastermix (Qiagen) with 1 μL of sample DNA, following the procedure described by with some modifications: 95°C for 15 min for initial denaturation, six cycles consisting of 30 s at 94°C, annealing for 3 min beginning at 69°C with a reduction of 1°C each cycle and an elongation step of 1.5 min at 72°C; then 25 cycles of 30 s at 94°C, 3 min at 62°C, and 1.5 min at 72°C, followed by a final extension step of 10 min at 72°C. The primers used are listed in Table 2. The PCR products were analyzed by electrophoresis on 1.8% agarose gels with TBE buffer (90 V for 45 min). Gels were stained with ethidium bromide (0.5 μg⋅ml-1) and visualized with an EDAS 290 digital imaging system (Kodak). TrackitTM 100 bp (Invitrogen) was used as the standard molecular weight marker.

Table 2

PrimerSequenceTarget
Primer mixture I
SCAR-OENI-FGGTAGATTAACCCGCGACGO. oeni
SCAR-OENI-RGGAATCGGTAGCATCCTG
SCAR-LBR-FGGAAGATCAAGAATATCGGTGL. brevis
SCAR-LBR-RGCGTCTCTAATTCACTGAGC
SCAR-LPL-FGAAGATTTGCCCATCGGTGL. plantarum
SCAR-LPL-RCGTTTGATGGTAGCGTTGC
SCAR-LEU-FGTGGTCATGGGTCTTAGCLeuconostoc
SCAR-LEU-RGGATCAAGACTAGCCAATGGmesenteroides
SCAR-WPA-FGCTGATGAACCCATACCTCWeissella paramesenteroides
SCAR-WPA-RGACCTGATTCGCTCGTTG
SCAR-PDA-FGTCTAAACTGGTGGTTAAACGP. damnosus
SCAR-PDA-RATCGCACCTGGTTCAATGC
SCAR-PPA-FGCATGAATCACTTTTCGCTCP. parvulus
SCAR-PPA-RCAAAGATTGTGACCCAGTTG
Primer mixture II
SCAR-LBU-FCTATCTTTAACCGCATTGCCGL. buchneri
SCAR-LBU-RGACACGCTTCTCATGATTGTC
SCAR-PAC-FATGATGGACAGACTCCCTGP. acidilactici
SCAR-PAC-RCGAGCTGCGTAGATATGTC
SCAR-LBH-FTTCCTTGGTAATGTGCTTGCL. hilgardii
SCAR-LBH-RAATGGCAATCGCAATGGACG
SCAR-PIN-FCTATCCTTACAATGTGCATCGP. inopinatus
SCAR-PIN-RTGGTGCGTCAGTAAATGTAAG
SCAR-LCU-FCCAGATCCATCAGAAGATACGL. curvatus
SCAR-LCU-RGCTAACTTACCACTAACGACC
SCAR-PPE-FGGGAACGGTTTTAGTTTTATACGP. pentosaceus
SCAR-PPE-RCTAAGAGCGGTGATGATAAG

Primers used for the identification of lactic acid bacteria (LAB) by multiplex PCR.

Results

Enumeration and Isolation of LAB in Different Samples and Stages of MLF

A total of 822 isolates were recovered from the counting plates of the 61 samples collected at the four wineries (Table 3). Three culture media were used in this study to improve LAB recovery; however, contrary to previous reports (; ), the population, the morphology of the colonies observed and species identified were very similar in the different media (Supplementary Figure S1). Therefore, in Figure 1, the LAB populations are shown, independent of culture media, involving six replicates of each sample analyzed (two per culture media). The LAB counts in musts from wineries A and B were rather low (101–103 CFU⋅ml-1) and no bacterial growth (<10 CFU⋅ml-1) was observed in several samples (5/12 in A and 6/15 in B). By contrast, higher counts (104–105 CFU⋅ml-1) were observed in musts from winery C, being this winery the one with the highest populations observed. In wine, the LAB populations ranged from 102 CFU⋅ml-1 at the beginning of the process, to 109 CFU⋅ml-1 at the second stage (climax of MLF), with intermediate values at the advanced stage. Finally, in barrel/filters rinse, the LAB population was around 108 CFU⋅ml-1 being superior comparing to must but similar to the populations observed in wine.

Table 3

WinerySample typeTotal samplesTotal isolates
AMust1223
Wine9213
Barrel/filter4156
BMust1596
Wine389
CMust9103
DWine9142
Total61822

Number of samples handled and isolates obtained from the four wineries located in Queretaro, Mexico.

FIGURE 1

Detection and Distribution of LAB Species through the Wineries

Five species (O. oeni, Pediococcus parvulus, Lactobacillus plantarum, Lactobacillus hilgardii, and Lactobacillus brevis) were detected among the wineries’ samples (Table 4). In most of the cases, the detection by culture confirmed what was observed with the molecular detection (culture-independent). However, some discrepancies between detection approaches were observed: L. brevis in wines (from A and B) and barrel/filter was only detected by culture. Conversely, the presence of O. oeni at winery C was only determined by direct multiplex PCR.

Table 4

WinerySample typeN1O. oeni
P. parvulus
L. plantarum
L. hilgardii
L. brevis
MC2MCMCMCMC
AMust12000058170000
Wine-i3100100100100676700033
Wine-m3100100100100000000
Wine-a310010010010000676700
Barrel/filter4100100100100050100100050
BMust1506708000000
Wine-i31001001001000100000100
CMust95600010010002200
DWine-i3100010010010000000
Wine-m3100331001006700000
Wine-a310033100100000000

Percentage of incidence of LAB species detected by culture (C) and molecular assay (M) in samples of must, wine in three stages of malolactic fermentation (MLF): Initial (i), middle (m), and advanced (a) and barrel/filter; obtained in wineries A, B, C, and D.

1N: number of samples analyzed.

2Culture-dependent approach: identifying isolates resistant to wine-like conditions (WLC) with 10% ethanol.

In several must samples (18/33), the LAB species investigated were not detected, and in the remaining ones, L. plantarum was widely detected at wineries A (58%) and C (100%). O. oeni was found in 67% of the samples from B and 56% from C. Finally, P. parvulus was only found in 8% of the samples from winery B and L. hilgardii only in 22% from C.

In wine samples, the five species were detected and O. oeni and P. parvulus were found in all samples. L. plantarum was detected in several samples from three wineries (22–56%). L. hilgardii was only found at winery A (22%), whereas, L. brevis was present at wineries A and B at 11 and 33%, respectively. Additionally, L. brevis and L. plantarum were mainly detected at the first stage of MLF, and L. hilgardii predominated at the advanced stage. Finally, in barrel/filter samples, all the five species were found. Winery A showed the greatest diversity of LAB species and at winery B the presence of O. oeni was remarkable.

LAB Resistance to Increasing Ethanol Concentrations with SO2 and pH of 3.5

As expected, the number of resistant isolates falls as ethanol concentration increases (Figure 2). In some samples (must from C; wine from A and D), the diversity of resistant species remained, with fewer individual ones capable of growing with 13% ethanol, evidencing strain variation. Moreover, the number of resistant O. oeni isolates remained unchanged, even with higher ethanol concentrations, which is particularly notable at winery B. Conversely, P. parvulus was strongly affected by higher ethanol levels, particularly those isolates obtained from barrel/filter, of which around 90% did not resist 13% ethanol. The Lactobacillus spp. in this study were also affected by 13% ethanol, with only 37% of the isolates being resistant to this condition. Finally, the high number of isolates (10 of 19) from must from winery C resistant to 13% ethanol is remarkable, given their origin.

FIGURE 2

Discussion

LAB Populations

The low LAB populations found in musts are consistent with the fact that they are minor constituents of grape microbiota, the populations usually reported being around 102 CFU⋅g-1 (). Meanwhile, higher populations found in must from winery C could be associated with grape variety; must from winery C was obtained from a white variety (‘Macabeo’), while musts from wineries A and B derived from red varieties (‘Tempranillo,’ ‘Syrah,’ and ‘Cabernet Sauvignon’). Higher numbers of LAB obtained from white varieties compared to red ones were also reported by , which has been attributed to the fact that some phenolic compounds only present in red varieties can produce a toxic effect on bacteria (). The fluctuating populations of LAB observed in wine at different stages of MLF coincides with and , who reported that lower counts of LAB at the beginning of MLF increased throughout the process, reaching up to 8 Log CFU⋅ml-1.

Furthermore, barrel/filter samples were considered together in this study since the barrel contained the wine in which the filters were used, and only a few samples of each material could be collected. In particular, the LAB population found in barrels (103 CFU⋅ml-1) was similar to that reported by . Barrels are recognized as microbial reservoirs in cellars, since they offer shelter where microorganisms can remain. However, this material also represents a stressful environment, which could explain the low populations encountered therein (; ).

Detection and Distribution of LAB Species

The multiplex PCR assay was efficient in detecting the principal LAB species in the winery samples (Figure 3), however, it was hampered when low LAB populations were present, as in musts and wines at the first stage of MLF. The detection limit reported for this technique is 104 CFU⋅ml-1 (), and the samples were concentrated 15 times, therefore, populations under 103 were not detectable in this study. This detection limit could also explain the lack of recognition of L. hilgardii, L. plantarum, and L. brevis through this approach in some samples. Another known bias that could explain the lack of detection of certain species is preferential amplification, in which the abundance of certain species, such as O. oeni and P. parvulus, may have caused reagents to exhaust without amplifying scarce species ().

FIGURE 3

).

The species mainly detected in musts (L. plantarum, P. parvulus, and L. hilgardii) are widely associated with wine grapes (; ; ). The last two are known to produce off-odors () and biogenic amines in wine (), while L. plantarum has been recently regarded as starter culture for MLF (; ), and has even shown additional advantages due to its capacity of degradation of biogenic amines () as well as better performance in co-inoculation with Saccharomyces cerevisiae (). Moreover, the detection of O. oeni in musts is remarkable, given its importance in MLF and since this species is rarely found therein (; ).

In wine, the fact that O. oeni and P. parvulus were frequently found together suggests some type of association between them, as has been previously posited by and . Nevertheless, it is important to point out that P. parvulus is the species most often involved in ropiness, a major bacterial alteration in wines (). Moreover, the detection of L. brevis and L. plantarum only at the beginning of MLF shows a decrease in their populations at advanced stages, probably due to a low resistance to the modified medium. Finally, the fact that L. hilgardii was only found at the advanced stages of MLF suggests a contamination of the wine, probably through the barrels where this bacterium was also found; this emphasizes the need to implement effective disinfection methods during the winemaking process ().

Even if the presence of some of these species can lead to wine spoilage, this problem has not been perceived in the local wines; only certain delays or inhibitions of the MLF are apparent. The spoilage features of these bacteria are usually strain-dependent, and for spoilage phenotypes to be produced, not only is the presence of the responsible bacteria required, but also the conducive environmental conditions, for instance, several stress conditions (ethanol, SO2, and low pH) promote the production of β-glucan responsible for ropiness by P. parvulus ().

Resistance to Wine-Like Conditions

In this study, LAB species were challenged with scarce nutrients combined with ethanol, SO2, and low pH, simulating a more realistic representation of what LAB face during winemaking. One of the principal changes in this process is ethanol concentration, which affects each LAB species differently, and the resistance of each isolate could also vary, depending on its origin ().

The species showing more tolerant isolates to WLC was O. oeni, which is expected, since this species stands out for its ability to overcome the harsh conditions of wine, enabling it to dominate this media and establish itself in the cellars (). Conversely, higher ethanol levels significantly affected P. parvulus, an undesirable, but apparently prevalent species at these wineries. This high susceptibility could be due to the more stressful conditions found in barrels, which could lead to more sensitive strains.

Although L. plantarum has been previously reported with better adaptability to wine than O. oeni (), the isolates evaluated in this study did not show a remarkable performance. Even if Lactobacillus species are considered highly resistant to ethanol (), wines elaborated in Queretaro seldom reach more than 12% ethanol (), which could explain the lack of adaptation of local strains to 13% ethanol. Moreover, the fact that a high number of isolates (10 of 19) belonging to Lactobacillus spp. and obtained from winery C resisted 13% ethanol was surprising, since they were isolated from must, where they had not been previously exposed to alcohol. Winery C is the oldest one sampled (about 30 years old), which could have enabled some strains to adapt to both environments, vineyard and cellar. This allowed the identification of resistant strains that could eventually be used as starter cultures, as well as the detection of more hazardous species (and materials) with regard to spoilage.

Conclusion

This is the first report related to the diversity of wine associated LAB in Mexico, and particularly in the wine region of Queretaro. Throughout the four wineries studied, five species (O. oeni, P. parvulus, L. plantarum, L. hilgardii, and L. brevis) were detected in must, wine, and barrel/filter samples. The species O. oeni and L. plantarum were detected at all the wineries and P. parvulus was only absent at winery C. L. plantarum and L. brevis were mainly found in musts and at the initial stages of MLF in wines, while L. hilgardii was principally detected at the end of MLF. The highest ethanol concentration tested (13%) combined with 30 mg⋅l-1 of SO2 and pH of 3.5 diminished the number of resistant isolates by around half, regardless of materials origin, with O. oeni being the species with a greater proportion of resistant isolates. In contrast, P. parvulus and Lactobacillus species obtained from barrel/filters were the most affected by high concentration of ethanol.

Statements

Author contributions

All the authors have revised the present draft, contributed important intellectual content and approved the final version to be published. They have also agreed to be accountable for the content of the work. DM-C: Conception of work, acquisition, analysis and interpretation of data, draft development. RM-P: Conception of work and experimental design, consultation on wine quality aspects. JA-T: Support with data acquisition, molecular techniques, and microbial diversity. MI: Consultation on microbial diversity and microbial kinetic studies. LS-M: Consultation on molecular techniques and data interpretation. JP-A: Consultation on sampling at wineries and microbial metabolism in vineyards. SA-M: Conception and design of work, expertise in lactic acid bacteria characterization, data analysis and interpretation, draft development, and financial support management.

Funding

Financial support was provided by Consejo Nacional de Ciencia y Tecnología (CONACYT), México and PRODEP-SEP, México.

Acknowledgments

The authors thank the Consejo Nacional de Ciencia y Tecnología (CONACYT) of Mexico for the scholarship provided to Dalia Elizabeth Miranda Castilleja during this study, as well as the Asociación de Vitivinicultores de Querétaro (AVQ) and the Escuela de Vino Artesanal (EVA) for facilitating access to the wineries.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: http://journal.frontiersin.org/article/10.3389/fmicb.2016.01769/full#supplementary-material

FIGURE S1

Proportion of LAB species recovered in three media from must, wine and barrel/filter rinse: MRS, Man Rogosa Sharpe; MRS-T, MRS added to tomato juice; and MRS-AJ, MRS added to apple juice.

References

  • 1

    Arroyo-LópezF. N.SalvadóZ.TronchoniJ.GuillamónJ. M.BarrioE.QuerolA. (2010). Susceptibility and resistance to ethanol in Saccharomyces strains isolated from wild and fermentative environments.Yeast2710051015. 10.1002/yea.1809

  • 2

    Asociación de Vitivinicultores de Querétaro [AVQ] (2011). Estudio de impacto productivo de un viñedo.Querétaro: Asociación de Vitivinicultores de Querétaro, 111.

  • 3

    BaeS.FleetG. H.HeardG. M. (2006). Lactic acid bacteria associated with wine grapes from several Australian vineyards.J. Appl. Microbiol.100712727. 10.1111/j.1365-2672.2006.02890.x

  • 4

    BarataA.Malfeito-FerreiraM.LoureiroV. (2012). The microbial ecology of wine grape berries.In. J. Food Microbiol.153243259. 10.1016/j.ijfoodmicro.2011.11.025

  • 5

    BartowskyE. J. (2009). Bacterial spoilage of wine and approaches to minimize it.Lett. Appl. Microbiol.48149156. 10.1111/j.1472-765X.2008.02505.x

  • 6

    BerbegalC.PeñaN.RussoP.GriecoF.PardoI.FerrerS.et al (2016). Technological properties of Lactobacillus plantarum strains isolated from grape must fermentation.Food Microbiol.57187194. 10.1016/j.fm.2016.03.002

  • 7

    BokulichN. A.OhtaM.RichardsonP. M.MillsD. A. (2013a). Monitoring seasonal changes in winery-resident microbiota.PloS ONE8:e66437. 10.1371/journal.pone.0066437

  • 8

    BokulichN. A.ThomgateJ. H.RichardsonP. M.MillsD. A. (2013b). Microbial biogeography of wine grapes is conditioned by cultivar, vintage, and climate.PNAS111E139E148. 10.1073/pnas.1317377110

  • 9

    Bravo-FerradaB. M.HollmanA.DelfedericoL.Valdés La HensD.CaballeroA.SemorileL. (2013). Patagonian red wines: selection of Lactobacillus plantarum isolates as potential starter cultures for malolactic fermentation.World J. Microbiol. Biotechnol.2915371549. 10.1007/s11274-013-1337-x

  • 10

    CapozziV.RussoP.LaderoV.FernándezM.FioccoD.AlvarezM. A.et al (2012). Biogenic amines degradation by Lactobacillus plantarum: toward a potential application in wine.Front. Microbiol.3:122. 10.3389/fmicb.2012.00122

  • 11

    CarretéR.VidalM. T.BordonsA.ConstantíM. (2002). Inhibitory effect of sulfur dioxide and other stress compounds in wine on ATPase activity of Oenococcus oeni.FEMS Microbiol. Lett.211155159. 10.1111/j.1574-6968.2002.tb11218.x

  • 12

    CocolinL.AlessandriaV.DolciP.GorraR.RantsiouK. (2013). Culture independent methods to assess the diversity and dynamics of microbiota during food fermentation.Int. J. Food Microbiol.1672943. 10.1016/j.ijfoodmicro.2013.05.008

  • 13

    Consejo Mexicano Vitivinícola A.C [CMV] (2014). Estadísticas del vino en México. Available at: http://www.uvayvino.org/index.php/noticias/22-economia-y-mercados/41-estadisticas-del-vino-en-mexico

  • 14

    CostelloP. J.HenschkeP. A. (2002). Mousy off-flavour of wine: precursors and biosynthesis of the causative N-heterocycles 2-ethyltetrahydropyridine, 2-acetyltetrahydropyridine, and 2-acetyl-1-pyrroline by Lactobacillus hilgardii.J. Agric. Food Chem.5070797087. 10.1021/jf020341r

  • 15

    De la Cruz-de AquinoM. A.Martínez-PenicheR. A.Becerril-RománA. E.Chávaro-OrtízM. S. (2012). Physical and chemical characterization of red wines produced in Queretaro.Rev. Fitotec. Mex.356167.

  • 16

    Dols-LafargueM.Young LeeH.Le MarrecC.HeyraudA.ChambatG.Lonvaud-FunelA. (2008). Characterization of gtf, a glucosiltransferase gene in the genomes of Pediococcus parvulus and Oenococcus oeni, two bacterial species commonly found in wine.Appl. Environ. Microbiol.7440794090. 10.1128/AEM.00673-08

  • 17

    du ToitM.PretoriusI. S. (2000). Microbial spoilage and preservation of wine: using weapons from nature’s own arsenal-a review.S. Afr. J. Enol. Vitic.217496.

  • 18

    FleetG. H. (1993). “The microorganisms of winemaking – isolation, enumeration and identification,” inWine Microbiology and Biotechnology, ed.FleetG. H. (Chur: Harwood Academic Publisher), 126.

  • 19

    G-AlegríaE.LópezI.RuizI.SáenzJ.FérnandezE.ZaragozaM.et al (2004). High tolerance of wild Lactobacillus plantarum and Oenococcus oeni strains to lyophilisation and environmental conditions of acid pH and ethanol.FEMS Microbiol. Lett.2305361. 10.1016/S0378-1097(03)00854-1

  • 20

    GarofaloC.El KhouryM.LucasP.BelyM.RussoP.SpanoG.et al (2015). Autochthonous starter cultures and indigenous grape variety for regional wine production.J. Appl. Microbiol.11813951408. 10.1111/jam.12789

  • 21

    González-ArenzanaL.Pérez-MartínF.PalopM. L.SeseñaS.SantamaríaP.LópezR.et al (2015). Genomic diversity of Oenococcus oeni populations from Castilla La Mancha and La Rioja Tempranillo red wines.Food Microbiol.498294. 10.1016/j.fm.2015.02.001

  • 22

    González-ArenzanaL.SantamariaP.LópezR.GarijoP.GutiérrezA. R.Garde-CerdánT.et al (2013). Microwave technology as new tool to improve microbiological control of oak barrels: a preliminary study.Food Control30536539. 10.1016/j.foodcont.2012.08.008

  • 23

    González-ArenzanaL.SantamariaP.LópezR.TenorioC.López-AlfaroI. (2012). Ecology of indigenous lactic acid bacteria along with different winemaking processes of Tempranillo red wine from La Rioja (spain).Sci. World J.2012796327. 10.1100/2012/796327

  • 24

    La HensD. V.Bravo-FerradaB. M.DelfedericoL.CaballeroA. C.SemorileL. C. (2015). Prevalence of Lactobacillus plantarum and Oenococcus oeni during spontaneous malolactic fermentation in Patagonian red wines revealed by polymerase chain reaction-denaturing gradient gel electrophoresis with two targeted genes.Aust. J. Grape Wine Res.214956. 10.1111/ajgw.12110

  • 25

    LermE.EngelbrechtL.du ToitM. (2010). Malolactic fermentation: the ABC’s of MLF.S. Afr. J. Enol. Vitic.31186210.

  • 26

    LermE.EngelbrechtL.du ToitM. (2011). Selection and characterization of Oenococcus oeni and Lactobacillus plantarum South African wine isolates for use as malolactic fermentation starter cultures.S. Afr. J. Enol. Vitic.32280291.

  • 27

    Lonvaud-FunelA. (1999). Lactic acid bacteria in the quality improvement and depreciation of wine.Antonie Van Leeuwenhoek76317331. 10.1023/A:1002088931106

  • 28

    Lonvaud-FunelA. (2001). Biogenic amines in wines: role of lactic acid bacteria.FEMS Microbiol. Lett.199913. 10.1111/j.1574-6968.2001.tb10643.x

  • 29

    MesasJ. M.RodríguezM. C.AlegreM. T. (2011). Characterization of lactic acid bacteria from musts and wines of three consecutive vintages of Ribera Sacra.Lett. Appl. Microbiol.52258268. 10.1111/j.1472-765X.2010.02991.x

  • 30

    Miranda-CastillejaD. E.Ortíz-BarreraE.Arvizu-MedranoS. M.Pacheco-AguilarJ. R.Aldrete-TapiaJ. A.Martínez-PenicheR. A. (2015). Isolation, selection and identification of autochthonous Saccharomyces spp. yeasts from vineyards stablished in Queretaro. Mexico.Agrociencia49759773.

  • 31

    Pérez-MartínF.SeseñaS.PalopM. L. (2014). Inventory of lactic acid bacteria populations in red wne varieties from Appellation of Origin Méntrida.Eur. Food Res. Technol.4725733. 10.1007/s00217-014-2377-7

  • 32

    PetriA.PfannebeckerJ.FröhlichJ.KönigH. (2013). Fast identification of wine related lactic acid bacteria by multiplex PCR.Food Microbiol.334854. 10.1016/j.fm.2012.08.011

  • 33

    ReguantC.BordonsA.ArolaL.RozésN. (2000). Influence of phenolic compounds on the physiology of Oenococcus oeni from wine.J. Appl. Microbiol.8810651071. 10.1046/j.1365-2672.2000.01075.x

  • 34

    ReguantC.CarretéR.ConstantíM.BordonsA. (2005). Population dynamics of Oenococcus oeni strains in a new winery and the effect of SO2 and yeast strain.FEMS Microbiol. Lett.246111117. 10.1016/j.femsle.2005.03.045

  • 35

    RenoufV.ClaisseO.Lonvaud-FunelA. (2005). Understanding the microbial ecosystem on the grape berry surface through numeration and identification of yeast and bacteria.Aust. J. Grape Wine Res.11316327. 10.1111/j.1755-0238.2005.tb00031.x

  • 36

    RenoufV.ClaisseO.Lonvaud-FunelA. (2007). Inventory and monitoring of wine microbial consortia.Appl. Microb. Cell Physiol.75149164. 10.1007/s00253-006-0798-3

  • 37

    RenoufV.DelahercheA.ClaisseO.Lonvaud-FunelA. (2008). Correlation between indigenous Oenococcus oeni strain resistance and the presence of genetic markers.J. Ind. Microbiol. Biotechnol.352733. 10.1007/s10295-007-0262-0

  • 38

    RodasA. M.FerrerS.PardoI. (2003). 16S-ARDRA, a tool for identification of lactic acid bacteria isolated from grape must and wine.Syst. Appl. Microbiol.26412422. 10.1078/072320203322497446

  • 39

    RuizP.IzquierdoP. M.SeseñaS.PalopM. L. (2008). Intraespecific genetic diversity of lactic acid bacteria from malolactic fermentation of Cencibel wines as derived from combined analysis of RAPD-PCR and PFGE patterns.Food Microbiol.25942948. 10.1016/j.fm.2008.06.007

  • 40

    SaguirF. M.LotoC. I. L.MaturanoC.de NadraM. C. (2009). Identification of dominant lactic acid bacteria isolated from grape juices. Assessment of its biochemical activities relevant to flavor development in wine.Int. J. Wine Res.1175185. 10.2147/IJWR.S4567

  • 41

    SchillingerU.HolzapfelW. H. (2012). “Culture media for lactic acid bacteria,” inHandbook Culture Media for Food and Water Microbiology, 3rd Edn, edsCorryJ.CurtisG.BairdR. (Cambridge: Royal Society of Chemistry), 181.

  • 42

    Shane GoldR.MeagherM. M.HutkinsR.ConwayT. (1992). Ethanol tolerance and carbohydrate metabolism in lactobacilli.J. Ind. Microbiol.104554. 10.1007/BF01583633

  • 43

    SintD.RasoL.TraugottM. (2012). Advances in multriplex PCR; balancing primer efficiencies and improving detection success.Methods Ecol. Evol.3898905. 10.1111/j.2041-210X.2012.00215.x

  • 44

    SolieriL.GenovaF.De PaolaM.GiudiciP. (2010). Characterization and technological properties of Oenococcus oeni strain from wine spontaneous malolactic fermentations: a framework for selection of the new starter cultures.J. Appl. Microbiol.108285298. 10.1111/j.1365-2672.2009.04428.x

  • 45

    Soto-MuñozL.TeixidóN.UsallJ.ViñasI.TorresR. (2014). Detection and quantification by PCR assay of the biocontrol agent Pantoea agglomerans CPA-2 on apples.Int. J. Food Microbiol.1754552. 10.1016/j.ijfoodmicro.2014.01.014

  • 46

    SpanoG.MassaS. (2006). Environmental stress response in wine lactic acid bacteria: beyond Bacillus subtillis.Crit. Rev. Microbiol.327786. 10.1080/10408410600709800

Summary

Keywords

malolactic fermentation, multiplex PCR, Oenococcus oeni, starter cultures, wine spoilage

Citation

Miranda-Castilleja DE, Martínez-Peniche RÁ, Aldrete-Tapia JA, Soto-Muñoz L, Iturriaga MH, Pacheco-Aguilar JR and Arvizu-Medrano SM (2016) Distribution of Native Lactic Acid Bacteria in Wineries of Queretaro, Mexico and Their Resistance to Wine-Like Conditions. Front. Microbiol. 7:1769. doi: 10.3389/fmicb.2016.01769

Received

17 August 2016

Accepted

21 September 2016

Published

08 November 2016

Volume

7 - 2016

Edited by

Giovanna Suzzi, University of Teramo, Italy

Reviewed by

Giuseppe Spano, University of Foggia, Italy; Jose Antonio Curiel, Instituto de Ciencias de la Vid y del Vino, Spain

Updates

Copyright

*Correspondence: Sofía M. Arvizu-Medrano,

This article was submitted to Food Microbiology, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics