Abstract
Anaerobic fungi (phylum Neocallimastigomycota) are common inhabitants of the digestive tract of mammalian herbivores, and in the rumen, can account for up to 20% of the microbial biomass. Anaerobic fungi play a primary role in the degradation of lignocellulosic plant material. They also have a syntrophic interaction with methanogenic archaea, which increases their fiber degradation activity. To date, nine anaerobic fungal genera have been described, with further novel taxonomic groupings known to exist based on culture-independent molecular surveys. However, the true extent of their diversity may be even more extensively underestimated as anaerobic fungi continue being discovered in yet unexplored gut and non-gut environments. Additionally many studies are now known to have used primers that provide incomplete coverage of the Neocallimastigomycota. For ecological studies the internal transcribed spacer 1 region (ITS1) has been the taxonomic marker of choice, but due to various limitations the large subunit rRNA (LSU) is now being increasingly used. How the continued expansion of our knowledge regarding anaerobic fungal diversity will impact on our understanding of their biology and ecological role remains unclear; particularly as it is becoming apparent that anaerobic fungi display niche differentiation. As a consequence, there is a need to move beyond the broad generalization of anaerobic fungi as fiber-degraders, and explore the fundamental differences that underpin their ability to exist in distinct ecological niches. Application of genomics, transcriptomics, proteomics and metabolomics to their study in pure/mixed cultures and environmental samples will be invaluable in this process. To date the genomes and transcriptomes of several characterized anaerobic fungal isolates have been successfully generated. In contrast, the application of proteomics and metabolomics to anaerobic fungal analysis is still in its infancy. A central problem for all analyses, however, is the limited functional annotation of anaerobic fungal sequence data. There is therefore an urgent need to expand information held within publicly available reference databases. Once this challenge is overcome, along with improved sample collection and extraction, the application of these techniques will be key in furthering our understanding of the ecological role and impact of anaerobic fungi in the wide range of environments they inhabit.
Introduction
Anaerobic fungi (phylum Neocallimastigomycota) are the most effective fiber degrading microorganisms in the gut of mammalian herbivores. This is due to their combined mechanical and enzymatic activity, and the associated ability to penetrate plant structural barriers (Orpin, ; Ho et al., ; Lee et al., ). These attributes are underpinned during the vegetative and motile stages of their life cycle, with a putative aerotolerant resistant stage more associated with survival outside the mammalian gut (Davies et al., ; McGranaghan et al., ). During the first 40 years following their recognition as fungi by Orpin in 1975, only six genera of anaerobic fungi were named within phylum Neocallimastigomycota (Anaeromyces, Caecomyces, Cyllamyces, Neocallimastix, Orpinomyces, and Piromyces). Within the last 2 years three new genera of anaerobic fungi have been described: Buwchfawromyces with its type species Buwchfawromyces eastonii (Callaghan et al., ; formerly known as SK2 clade, Koetschan et al., ), Oontomyces with its type species Oontomyces anksri (Dagar et al., ), and Pecoramyces (formerly known as Orpinomyces sp. C1A; Youssef et al., 2013) with its type species Pecoramyces ruminantium (Hanafy et al., ).
Anaerobic fungi have been largely described in the past on the basis of their morphological characteristics. However, due to factors such as convergent evolution and highly variable in vitro growth characteristics, morphological features alone are not sufficient to distinguish between certain genera and species. Within the nine characterized genera more than 20 species have been described, however, genetic analysis indicated that despite different generic names, some species are identical. On the other hand, description of new species supported by morphological and genetic analysis has recently enlarged the group of cultivated anaerobic fungi (Ariyawansa et al., ; Li G. J., et al., ).
Anaerobic fungi have been most extensively studied in ruminants, but in recent years an increasing amount of anaerobic fungal research has focused on their biotechnological exploitation (Prochazka et al., ; Gruninger et al., ; Haitjema et al., ; Gilmore et al., ; Peng et al., ; Solomon et al., ; Dollhofer et al., ). This has been mainly in terms of their potent fiber degrading enzymes, due to challenges with cultivating anaerobic fungi in large scale continuous systems limiting their direct application (Gruninger et al., ; Solomon et al., ). For the anaerobic fungal research community, this biotechnological interest has led to substantial investment that has enabled valuable advances in anaerobic fungal knowledge and resources, particularly from genomic and transcriptomic data in recent years.
In this review, we focus on the different types of molecular methods, including ‘omics approaches, that have been used to date in the study of anaerobic fungi, and we highlight the challenges that currently exist—many of which are fundamentally different from those encountered with the more routinely studied rumen bacteria and archaea.
Barcode markers for rapid phylotyping of anaerobic fungi
The “Assembling the Fungal Tree of Life” (AFToL) project used a multi-gene approach to decipher, to high resolution, the low level evolutionary phylogenetic relationships between the fungal Kingdom (James et al., ). The six genes used were those encoding 18S ribosomal RNA (rRNA), 28S rRNA, 5.8S rRNA, Elongation Factor 1-alpha (EF1α), and two RNA polymerase II subunits (RPB1 and RPB2). However, it is important to recognise the difference between barcoding loci and other loci suitable for phylogenetic inference. Potential barcoding loci, particularly those useful for next generation sequencing (NGS) based diversity studies, are those found on the multicopy rrn (rRNA) operon (Figure 1). These loci have a high copy number (ca. 200) per genome meaning only small amounts of tissue or environmental sample are needed for efficient PCR amplification. Additionally, these loci are not protein coding, therefore having a relatively high mutation rate enabling good phylogenetic resolution (Hibbett et al., ). Consequently, for barcoding and environmental sequencing studies loci belonging to the rrn operon are most suitable, thus such research into anaerobic fungi over the last 25 years has focussed on numerous different regions within this operon (Figure 1, Table 1).
Figure 1
Table 1
| Target gene | Sample type | Primers (5′-3′)a | Application | References |
|---|---|---|---|---|
| 18S rRNA (SSU) | Pure culture | 309e- TCAGGCTCCCTCTCCGG 519- GWATTACCGCGGCKGCTG 686e- AGAATTTCACCTCTG 926e- CCGTCAATTC(AC)TTT(AG)AGTTT 18J.CPM- CAGACACTACGGGAATCT 1400- ACGGGCGGTGTGT(GA)C 915-GCCCCCG(TC)CAATTCCT 920- ATTCCTTT(GA)AGTTT 956- GGCGTTGTGTC(CG)AATTAA 1100- AGGGTTGCGCTCGTT 1100a- TGGGTCTCGCTCGTTG 1511e- C(CT)GCAGGTTCACCTAC | Sequencing | Dore and Stahl, |
| Pure culture | SL2l (R)- CCGAATTCGTAGTCATATGCTTGTCT SL27 (F)- CCAAGCTTAAACCTTGTTACGACTT | Cloning and sequencing | Bowman et al., | |
| Pure culture | NS1 (F)- GTAGTCATATGCTTGTCTC NS2 (R)- GGCTGCTGGCACCAGACTTGC | PCR-RFLP | Fliegerova et al., | |
| Pure culture, rumen fluid and biogas plant sludge | AF-SSU forward- CTAGGGATCGGACGACGTTT AF-SSU reverse- GGACCTYCCGATCAAGGATG AF-SSU probe- 6FAM-ATTC GCGTAACTATTTAGCAGGTTAAGGT-BHQ1 | qRT-PCR | Dollhofer et al., | |
| Internal transcribed spacer 1 (ITS1) | Pure culture | (F)- TGTACACACCGCCCGTC (R)- CTGCGTTCTTCATCGAT | Sequencing | Li and Heath, |
| Pure culture | Cloning and sequencing | Brookman et al., | ||
| Pure culture | PCR-RFLP | Hausner et al., | ||
| Pure culture | ITS 1 (F)- TCCGTAGGTGAACCTGCGG ITS 2 (R)- GCTGCGTTCTTCATCGATGC | PCR-RFLP | Fliegerova et al., | |
| Pure culture | MN100 (F)- TCCTACCCTTTGTGAATTTG MNGM2 (R)- CTGCGTTCTTCATCGTTGCG | ITS1 fingerprinting | Tuckwell et al., | |
| Pure culture | Neo 18S (F)- 6FAM-AATCCTTCGGATTGGCT Neo 5.8S (R)- CGAGAACCAAGAGATCCA | ARISA | Edwards et al., | |
| Pure culture and rumen fluid | MN100 (F)- 6FAM-TCCTACCCTTTGTGAATTTG MNGM2 (R)-CTGCGTTCTTCATCGTTGCG | ARISA | Denman et al., | |
| Rumen digesta | Neo 18S (F)- 6FAM-AATCCTTCGGATTGGCT Neo 5.8S (R)- CGAGAACCAAGAGATCCA | ARISA | Cheng et al., | |
| Fecal samples | (F)- GCCTCCCTCGCGCCATCAG-(barcode)- TCCTACCCTTTGTGAATTTG (R)- GCCTTGCCAGCCCGCTCAG- CTGCGTTCTTCATCGTTGCG | Pyrosequencing | Liggenstoffer et al., | |
| Pig and cow manure | ITS1F (F)- CTTGGTCATTTAGAGGAAGTAA Neo QPCR (R)- GTGCAATATGCGTTCGAAGATT | Cloning and sequencing | Fliegerova et al., | |
| Fecal samples | MN100 (F)- TCCTACCCTTTGTGAATTTG MNGM2 (R) | PCR-DGGE | Nicholson et al., | |
| Rumen fluid | CTGCGTTCTTCATCGTTGCGCGCCCGCCGCG CGCGGCGGGCGGGGCGGGGGCACGGGGGG | PCR-DGGE | Khejornsart and Wanapat, | |
| Rumen fluid | PCR-DGGE | Khejornsart et al., | ||
| Rumen fluid and digesta | PCR-DGGE | Kittelmann et al., | ||
| Pure culture and rumen fluid | qRT-PCR-fungi (F)- GAGGAAGTAAAAGTCGTAACAAGGTTTC qRT-PCR-fungi (R)- CAAATTCACAAAGGGTAGGATGATT | qRT-PCR | Lwin et al., | |
| Rumen fluid and digesta | MN100 (F)- TCCTACCCTTTGTGAATTTG MNGM2 (R)- CTGCGTTCTTCATCGTTGCG Adaptors A (CCATCTCATCCCTGCGTGTCTCCGACTCAG) or B (CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) | Pyrosequencing | Kittelmann et al., | |
| Rumen fluid and digesta | ITS1F (F)- TCCGTAGGTGAACCTGCGG ITS400Rw (R)- ATTGTCAAAAGTTGTTTTTAWATTAT | Cloning and sequencing | Kittelmann et al., | |
| 5.8S rRNA | Pure culture and rumen digesta | Neo QPCR (F)-TTGACAATGGATCTCTTGGTTCTC Neo QPCR (R)- GTGCAATATGCGTTCGAAGATT Taqman probe: Neo 6FAM-CAAAATGCGATAAGTARTGTGAATT GCAGAATACG-TAMRA | qRT-PCR | Edwards et al., |
| SSU and ITS1 | Pure culture, rumen fluid and digesta | (F)- GAGGAAGTAAAAGTCGTAACAAGGTTTC (R)- CAAATTCACAAAGGGTAGGATGATT | qRT-PCR | Denman and Mcsweeney, |
| Rumen fluid and digesta | QC-PCR | Sekhavati et al., | ||
| Rumen fluid and digesta | qRT-PCR | Khejornsart et al., | ||
| Rumen fluid | qRT-PCR | Kittelmann et al., | ||
| Internal transcribed spacer (ITS) | Pure culture | ITS 1 (F)- TCCGTAGGTGAACCTGCGG ITS 4 (R)- TCCTCCGCTTATTGATATGC | PCR-RFLP | Fliegerova et al., |
| Cloning and sequencing | Fliegerova et al., | |||
| JB206 (F)- GGAAGTAAAAGTCGTAACAAGG JB205 (R)- TCCTCCGCTTATTAATATGC | Cloning and sequencing | Tuckwell et al., | ||
| GM1 (F)- TGTACACACCGCCCGTC JB205 (R)- TCCTCCGCTTATTAATATGC | Cloning and sequencing | Nicholson et al., | ||
| ITS1F (F)- CTTGGTCATTTAGAGGAAGTAA EminITS4 (R)- GTTCAGCGGGTACTCTTATCTG | PCR-RFLP | Griffith et al., | ||
| JB206 (F)- GGAAGTAAAAGTCGTAACAAGG JB205 (R)- TCCTCCGCTTATTAATATGC | Cloning and sequencing | Solomon et al., | ||
| 28S rRNA (LSU) | Pure culture | (F)- GCCTTAGTAACGGCGAGTG (R)- GGAACCTTTCCCCACTTC | PCR-RFLP | Hausner et al., |
| NL1 (F)- GCATATCAATAAGCGGAGGAAAAG NL4 (R)- GGTCCGTGTTTCAAGACGG | PCR-RFLP | Fliegerova et al., | ||
| PCR-RFLP | Dagar et al., | |||
| Pure culture, rumen fluid and biogas plant sludge | AF-LSU (F)- GCTCAAAYTTGAAATCTTMAAG AF-LSU (R)- CTTGTTAAMYRAAAAGTGCATT | Cloning and sequencing | Dollhofer et al., | |
| ITS and LSU | Pure culture | ITS5 (F)- GGAAGTAAAAGTCGTAACAAGG NL4 (R)- GGTCCGTGTTTCAAGACGG | Cloning and sequencing | Wang et al., |
| Intergenic spacer region (IGS) | Pure culture | (F)- GAGACAAGCATATGACTAC (R)- ACGCCTCTAAGTCAGAAT | PCR-RFLP | Hausner et al., |
| GH5 cellulolytic endoglucanase | Pure culture, rumen fluid and biogas plant sludge | AF-Endo (F)- CGTATTCCAACYACTTGGWSYGG AF-Endo (R)- CCRKTRTTTAAGGCAAARTTRTAYGGA | qRT-PCR | Dollhofer et al., |
Details of different genes/regions and primers used for studying diversity and taxonomy of anaerobic rumen fungi.
The use of the primer in a forward (F) or reverse (R) orientation is indicated, with exception of the primers from Dore and Stahl (
Contrasting with this, taxonomic loci tend to be single copy protein coding genes, including e.g., RPB1 and RPB2 (James et al.,
The small-subunit (SSU) rRNA gene is widely used as a barcode marker for bacteria, archaea and protists, and has also been looked at as a barcoding and quantification loci for the anaerobic fungi (Dore and Stahl,
Internal transcribed spacer region
The ITS region is the barcode of choice for the fungal kingdom (Schoch et al.,
Over the past decade, next-generation sequencing of the ITS1 region has allowed large-scale analysis of anaerobic fungal diversity and community structure in various host animals (Liggenstoffer et al.,
Molecular surveys based on the ITS1 marker have suggested the existence of several novel anaerobic fungal clades, but their relatedness to known genera remained inconclusive due to the lack of a stable ITS1 phylogeny (Fliegerova et al.,
Using secondary structure information, Tuckwell et al. (
The latest version of the ITS1 phylogeny according to Koetschan et al. (
Figure 2

Phylogenetic tree of the anaerobic fungi (Neocallimastigomycota). The Profile Neighbor Joining tree was constructed according to (Koetschan et al.,
Despite the usefulness of ITS1 as a barcode marker to date, it is becoming increasingly apparent that its application as a phylogenetic marker has fundamental limitations. Within a single culture multiple cloned ITS1 sequences can vary as much as 13% between ITS1 repeats (Callaghan et al.,
Large sub-unit rRNA
The LSU rRNA gene is the longest of the rrn loci and codes for the 28S rRNA ribosomal sub-unit, which is approximately 3,500 bp long in the anaerobic fungi. The upstream 5′ region next to the ITS2 (Figure 1), known as the D1/D2 region, is commonly used in fungal barcoding studies as it provides significant variability that can discriminate phylotypes (Fell et al.,
Hausner et al. (
Dollhofer et al. (
A recent paper comparing ITS1 and LSU based phylogenies concluded that sequences from LSU aligned easier and were better for distinguishing the different genera of anaerobic fungi than ITS1, although both LSU and ITS1 based phylogenies showed a high degree of similarity (Wang et al.,
An LSU based taxonomy made using all available Genbank sequences from pure anaerobic fungal cultures is shown in Figure 3. The phylogenetic tree shows sequences from all known genera and species are resolved and suggests that the monoflagellated Oontomyces, Anaeromyces, Buwchfawromyces, Caecomyces, Cyllamyces, and Piromyces form the basal linages. While the polyflagellated Orpinomyces and Neocallimastix genera group together with the monoflagellated Pecoramyces, and form the distal groups (Figure 3).
Figure 3

Maximum Likelihood phylogenetic tree based on a 744 bp alignment of 29 anaerobic fungal 28S rRNA gene sequences. The sequences are representative of all described genera. An aerobic chytrid Batrachochytrium dendrobatidis was used to root the tree. Topologies are sorted to over 70% (bootstrap = 1,000 replicates) and bootstrap values over 70% are shown. Scale bar shows substitutions per site. The different genera are color coded: Anaeromyces (green), Buwchfawromyces (brown), Caecomyces, and Cyllamyces (olive), Neocallimastix (pink), Oontomyces (black), Orpinomyces (blue), Pecoramyces (orange), and Piromyces (red).
Together with definite improvements in creating alignments and the limited size and sequence heterogeneity of the LSU within a single culture, the LSU is now likely to become the new barcoding locus of choice for anaerobic fungal specific NGS studies (Callaghan et al.,
Genomics
Whilst genetic markers have value in enabling molecular tools to be developed and establishing a taxonomic structure, it is the genomes that provide a key foundation in terms of understanding anaerobic fungal biology. The first thorough analysis of the genic, intergenic and rRNA encoding regions of a variety of genomic segments of an anaerobic fungus was performed by Nicholson et al. (
Requirements for culturing and genomic DNA isolation
The major requirement for successful genome sequencing is high molecular weight (>10 kb) DNA in high quality (no RNA, protein or carbohydrate impurities) and quantity (>12 μg). With anaerobic fungi, several issues hinder researchers, when fulfilling these requirements. Anaerobic fungal cells are protected by a thick, recalcitrant cell wall containing chitin (Orpin,
After overcoming the barrier of the anaerobic fungal cell wall, persistent RNA, protein and carbohydrate residues are a significant challenge when purifying the genomic DNA. Solomon et al. (
As well as the DNA extraction method, the culture conditions used to generate the anaerobic fungal biomass can also influence the effectiveness of nucleic acid extractions and the interpretability of results. For high DNA yields, anaerobic fungi should be actively growing, thus to date incubation times from 3 to 4 days leading to cultures in mid-log to late-log-phase were used (Youssef et al., 2013; Solomon et al.,
For genome assembly, the presence of small contaminating DNA fragments in rumen fluid containing media has been considered a practical challenge. Some researchers have thus turned to rumen fluid free basal media (as described by Lowe et al.,
Sequencing, assembly, and annotation
For the genome analysis of Piromyces species E2, the first anaerobic fungal genome sequenced (made public in 2011), Sanger sequencing (read length 800–900 bp) in combination with Illumina Solexa (read length 2 × 75 bp) sequencing was employed followed by assembly with the use of Velvet (Haitjema et al.,
For the most recently sequenced genomes, of the species N. californiae, Pir. Finnis, and A. robustus, only PacBio SMRT sequencing was performed with high molecular weight DNA fragments (>10 kb), which yielded far improved genome assemblies, and the highest quality anaerobic fungal genomes reported to date (Haitjema et al.,
Table 2
| Genome assembly | Piromyces sp. E2 | Pecoramyces ruminantium C1Aa | Anaeromyces robustus | Neocallimastix californiae | Piromyces finnis |
|---|---|---|---|---|---|
| Sequencing platform | Sanger & Illumina Solexa | PacBio SMRT & HiSeq 2000 sequencing platform, Illumina 100 bp paired-end | PacBio SMRT | PacBio SMRT | PacBio SMRT |
| Assembler | Velvet | Velvet & Whole Genome Shotgun Assembler | Falcon, FinisherSC, Quiver | Falcon, FinisherSC, Quiver | Falcon, FinisherSC, Quiver |
| Annotation | DOE-JGI Annotation Pipeline* & Hidden Markov Modeling | BLASTP, BLASTX, NR database, HMMR Suite, PFAM database, IMG | DOE-JGI Annotation Pipeline* & Hidden Markov Modeling | DOE-JGI Annotation Pipeline* & Hidden Markov Modeling | DOE-JGI Annotation Pipeline* & Hidden Markov Modeling |
| Genome assembly size (Mbp) | 71.02 | 100.95 | 71.69 | 193.03 | 56.46 |
| Sequencing read coverage depth | median ~6x, mean ~20x | 300x | 20x | 20x | NA |
| # of contigs | 17,217 | 32,574 | 1,035 | 1,819 | 232 |
| Three largest Scaffolds (Mbp) | 0.84, 0.64, 0.64 | 0.02, 0.02, 0.02 | 0.67, 0.50, 0.46 | 1.84, 1.45, 1.35 | 2.63, 1.96, 1.65 |
Summary statistics for the anaerobic fungal genomes assembled to date (modified from http://genome.jgi.doe.gov/Pirfi3/Pirfi3.info.html).
Formerly known as Orpinomyces sp. C1A.
As described on the US Department of Energy Joint Genome Institute fungal portal MycoCosm (http://genome.jgi.doe.gov/programs/fungi/FungalGenomeAnnotationSOP.pdf).
Whilst it is now possible to generate high quality anaerobic fungal genomes, it remains a challenge to assign correct functional annotations to novel anaerobic fungal genes. This becomes obvious, when the KOG data for all the available sequenced anaerobic fungal genomes is compared (Figure 4). On average 6% of the gene functions remained unknown and for 19% only a general function prediction was possible. Therefore, no function can be concisely described for 25% of the anaerobic fungal genes. Due to the lack of anaerobic fungal gene content in existing databases (e.g., KEGG and PFAM); accurate annotation of function is likely to remain a key challenge until this has been addressed. Interestingly, a recent study by Mondo et al. (
Figure 4

Comparison of gene models identified by KOG classification in the anaerobic fungal genomes sequenced to date. Percentages of the predicted gene models identified are shown due to the differences in genome assembly size between the organisms (see Table 2), with the percentage values for two categories (Function unknown & General function prediction only) also directly stated on the bars. Data sourced from Youssef et al. (2013) and Haitjema et al. (
Despite these functional annotation challenges, however, analysis of the genome of P. ruminantium C1A by conventional annotation strategies (see Table 2) discovered genomic traits potentially specific for the Neocallimastigomycota phylum and adapted to their anaerobic life-style (Youssef et al., 2013). Reconstruction of the Pecoramyces hydrogenosome allows the metabolism of energy production in anaerobic fungi to be clearly followed, revealing an incomplete tricarboxylic acid cycle and mixed-acid fermentation dependent energy formation. Characterization of the carbohydrate active enzymes (CAZymes) in P. ruminantium C1A also showed a huge and diverse range of lignocellulolytic genes, comprising 357 glycoside hydrolases (GHs), 24 polysaccharide lyases (PLs) and 92 carbohydrate esterases (CEs). From the genome of Fibrobacter succinogenes, a rumen bacterium specialized in lignocellulose utilization, 95 GHs, 5 PLs and 17 CEs were characterized, highlighting the extensive carbohydrate active enzymatic systems possessed by P. ruminantium C1A.
More recently, additional insights into anaerobic fungal CAZymes were generated from the analysis of four high quality anaerobic fungal genomes: Piromyces sp. E2, N. californiae, P. finnis, and A. robustus (Haitjema et al.,
Metagenomics
The rumen microbial community is a consortium of bacteria, archaea, anaerobic fungi, and protozoa. Bacteria and archaea represent the major proportion of microbes in terms of cell count, however, the eukaryotic anaerobic fungi and protozoa also represent a large proportion in terms of microbial biomass. To date, most rumen metagenomics studies have focused on the bacterial and archaeal microbial communities (Hess et al.,
The lack of eukaryotic genes detected in metagenomics studies to date are likely to be caused by sampling strategies excluding eukaryotes, the low eukaryotic DNA content in the rumen (relative to their microbial biomass) and their scarce genetic information, limiting bioinformatics analysis and annotation of eukaryotic genes (Qi et al.,
From a rumen perspective, there is a need to link the available anaerobic fungal genomic data with ecology and function and thus build a more comprehensive database. On this basis, bioinformatics approaches able to identify and annotate anaerobic fungal genes can be developed, enabling scientists to screen rumen metagenome data sets for anaerobic fungal gene content. This will prevent these important fiber degraders from being overlooked in future studies. Furthermore, sampling strategies for future rumen metagenomics studies need to be adjusted to anaerobic fungal cell size (e.g., large enough pore sizes when using nylon bags), growth characteristics (e.g., their growth inside plant fibers as rumen fluid only contains their zoospores) and behavior during nucleic acid extractions (see sections Requirements for culturing and genomic DNA isolation and Future perspectives).
Transcriptomics
Whilst genome-based analysis gives insight into the fundamental biology of anaerobic fungi, gene expression brings our understanding a step closer to their actual activity and metabolism. In practical terms, it also overcomes the issue of eukaryotic genomes containing non-coding introns within their genes. Analysis of expressed anaerobic fungal genes, however, is not new, with the first work in this area being conducted more than 20 years ago, and having already generated fundamental biological insights on a limited subset of genes.
Reymond et al. (
Whilst other cDNA library based studies have also been conducted, most have focused on a limited number of hydrolytic enzymes (Supplementary Table 1). The first of the more high-throughput studies was conducted by Kwon et al. (
Gene expression analysis of axenic/monoxenic anaerobic fungal cultures
The transcriptomes of four anaerobic fungi (P. ruminantium C1A, Piromyces finnis, Neocallimastix californiae, and Anaeromyces robustus) have been published to date (Couger et al.,
Whilst the statistics of the transcriptome assemblies suggest that many transcripts are present (Table 3), it was shown with P. ruminantium C1A that less than half of the total transcripts detected were expressed when the fungus was cultivated. This was irrespective of which substrate was used: glucose (32.3% of total transcripts), alfalfa (28.6%), energy cane (30.2%), sorghum (29.1%), and corn stover (27.0%) (Couger et al.,
Table 3
| Strains | Substrates | Transcripts (#) | Length (bp) | Length max (bp) | Length min (bp) | Average length (bp) |
|---|---|---|---|---|---|---|
| Anaeromyces robustusa | Glucose, reed canary grass, Avicel, cellobiose, filter paper | 17,127 | 21,955,935 | 21,526 | 100 | 1,281.9 |
| Neocallimastix californiaea | Glucose, reed canary grass, Avicel, cellobiose, filter paper | 29,649 | 36,250,970 | 19,022 | 100 | 1,222.7 |
| Pecoramyces ruminantium C1Ab | Glucose, alfalfa, energy cane, corn stover, sorghum | 35,126 | 33,569,440 | 14,646 | 301 | 955.7 |
| Piromyces finnisa | Glucose, reed canary grass | 27,140 | 25,770,853 | 18,057 | 201 | 949.6 |
Statistics of de novo assembled transcripts of anaerobic fungi.
Data from
Solomon et al. (
Couger et al. (
It has been reported that only 47.2% of all of the A. robustus transcripts could be annotated by NCBI BLAST, InterProScan, and OrthoMCL alignments (Solomon et al.,
With COG ontology analysis 1,461 transcripts were annotated from P. ruminantium C1A, 18 of which were highly expressed with all substrates (normalized FPKM > 1,000). Within the 9,178 transcripts not annotated by COG, 92 were highly expressed with all substrates (normalized FPKM > 1,000). Interestingly, the 87 transcripts (which could not be functionally annotated by KEGG, TREMBL or SwissProt) are all included in these 92 core transcripts which could not be annotated by COG. Among the 18 COG annotated core transcripts, ribosomal RNA dominated (Log (normalized FPKM) values ranging from 3.21 to 5.18), followed by proteins (Figure 5) involved in metabolic pathways in the cytosol and hydrogenosome, and plant fiber degradation. As the unannotated highly expressed core transcripts are likely to play a central role in anaerobic fungal metabolism, it is important that future studies are performed in order to determine their function.
Figure 5

COG analysis of the core protein encoding transcripts that were present in Pecoramyces ruminantium C1A grown in five different substrates (glucose, alfalfa, energy cane, corn stover, and sorghum). Transcripts with a normalized FPKM above 100 are presented. Data sourced from Couger et al. (
Couger et al. (
Metatranscriptomics
Utilizing metatranscriptomics for the study of eukaryotic derived activity in mixed communities has many advantages (Marmeisse et al.,
In contrast, Qi et al. (
Qi et al. (
Recently, three studies used sequencing of total RNA, not depleted of rRNA, to examine the active microbial community in the rumen (Poulsen et al.,
Rumen anaerobic fungi are intimately associated with the fiber portion of the diet, with their main active vegetative growth occurring within the plant cell wall matrix. This makes sample preparation of utmost importance if rumen fungal sequences are to be discovered. Sampling and preparation methods that do not contain a representative quantity of rumen fiber and that do not aggressively disrupt the plant cell wall matrix (or the anaerobic fungus itself, see section Requirements for culturing and genomic DNA isolation) are unlikely to be successful in obtaining a truly representative sample of the rumen microbial community and have significant bias against anaerobic fungi (Wang et al.,
Proteomics
Proteomics bridges the gap between transcriptomics and metabolomics, and permits the large scale analysis of proteins. Proteomics can be classified as being either native or translated proteome analysis. The latter involves the translation of individual mRNAs or transcriptomes prior to the proteome analysis, and has been made possible due to the development of NGS techniques. Translated proteome analysis, however, cannot assess post-translational modifications such as glycosylation or methylation, which requires more targeted analyses.
Native proteome analysis involves three key steps: protein separation, sequence analysis and protein identification. The current standard for protein separation utilizes liquid chromatography (LC), where proteins are separated based on characteristics such as polarity and molecular weight (Lin et al.,
Figure 6

2D-DIGE analysis of the Neocallimastix frontalis proteome. Images of N. frontalis cultures grown on glucose (A) and starch (B) are shown in the Cy3 and Cy5 channels, respectively, as well an image of the combined Cy3 + Cy5 channels (C).
Protein identification is performed by searching the acquired peptide mass results of each protein against a database, with the protein database being the key factor for success in identifying a protein. Within the 452 protein sequences currently available in the NCBI database (representing less than 0.3% of the deposited rumen bacterial protein sequences) only four filamentous anaerobic fungal genera are currently represented. Furthermore, the deposited proteins are also heavily biased toward CAZymes due to these being a primary area of research focus. Of the 452 protein sequences there are 109 hexose degrading enzymes and 46 pentose degrading enzyme, whilst only 102 of the deposited sequences are related with intra-cellular carbohydrate metabolism including glycolysis, hydrogenosome metabolism and pseudo-TCA cycle (Kwon et al.,
Using publically available protein data, a virtual proteome map was constructed (Figure 7). Among the 203 protein sequences analyzed, 97 (including cellulase, xylanase, lichenase, and acetylxylan esterase) were predicted to be secretory proteins and the other 106 non-secretory. Of the 106 non-secretory intracellular proteins, 29 were related with hexose or pentose degrading enzymes. The average molecular size of the 203 deposited proteins was 50 kDa. The largest protein was endoglucanase 5A (CAB92326.1) from Piromyces equi (Eberhardt et al.,
Figure 7

Virtual 2D-gel of anaerobic fungal proteins using data obtained from the NCBI database (203 protein sequences) and generated using JVirGl 2.2.3b software (www.jvirgel.de). Predicted secretory proteins (Supplementary Table 2) are shown as red dots, and non-secretory proteins (Supplementary Table 3) as black dots.
In addition to more advanced proteomics techniques to reach a wider range of proteins, targeted proteomics are required to assess the post-translational modifications previously shown to decorate some of the anaerobic fungal proteins (Haitjema et al.,
Metabolomics
Metabolomics refers to the qualitative and quantitative analysis of the metabolites present inside (endometabolome) and outside (exometabolome) growing cells at a given time (Mashego et al.,
Three distinct approaches are used in metabolomics studies: targeted analysis, metabolite profiling and metabolic fingerprinting. Each of these approaches however, has its own advantages and disadvantages (Shulaev,
Table 4
| Anaerobic fungal culture | Fermentation productsb,c,d | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Genus | Species or straina | Substrate | H2 | CO2 | F | A | Lactate | S | E | References | ||
| DL | LL | TL | ||||||||||
| Neocallimastix | patriciarum | Cellulose | ![]() | Orpin and Munn, | ||||||||
| hurleyensis | Glucose | Lowe et al., | ||||||||||
| Xylose | ||||||||||||
| LM1 | Glucose | Phillips and Gordon, | ||||||||||
| MC2 | Coastal bermuda grass | Borneman et al., | ||||||||||
| Glucose | ||||||||||||
| NC71 | Wheat straw | Kostyukovsky et al., | ||||||||||
| Filter paper | ||||||||||||
| Cellobiose | ||||||||||||
| variabilis | Rice straw | Ho et al., | ||||||||||
| Filter paper | ||||||||||||
| frontalis | Cellulose | Srinivasan et al., | ||||||||||
| spp. | Glucose | Paul et al., | ||||||||||
| Piromyces | MC1 | Coastal bermuda grass | Borneman et al., | |||||||||
| Glucose | ||||||||||||
| PC12 | Wheat straw | Kostyukovsky et al., | ||||||||||
| Filter paper | ||||||||||||
| Cellobiose | ||||||||||||
| spiralis | Rice straw | Ho et al., | ||||||||||
| Filter paper | ||||||||||||
| minutus | Rice straw | |||||||||||
| Filter paper | ||||||||||||
| SM1 | Glucose | Phillips and Gordon, | ||||||||||
| spp. | Glucose | Paul et al., | ||||||||||
| E2 | Fructose | Boxma et al., | ||||||||||
| Anaeromyces | PC1 | Coastal bermuda grass | Borneman et al., | |||||||||
| Glucose | ||||||||||||
| spp. | Glucose | Paul et al., | ||||||||||
| Orpinomyces | PC2 | Coastal bermuda grass | Borneman et al., | |||||||||
| Glucose | ||||||||||||
| PC3 | Coastal bermuda grass | |||||||||||
| Glucose | ||||||||||||
| spp. | Glucose | Paul et al., | ||||||||||
| Caecomyces | NM1 | Glucose | Phillips and Gordon, | |||||||||
Fermentation end products of anaerobic fungal metabolism of different substrates.
Species or strain names are given as described in the corresponding publication, with “spp.” indicating that the same results were found with the multiple strains that were tested in a given study.
Fermentation products: hydrogen (H2), carbon dioxide (CO2), formate (F), acetate (A), succinate (S), ethanol (E), D(–) lactate (DL), L(+) lactate (LL), and total lactate (TL) (in publications where the specific isomers were not reported).
Fermentation products were produced (dark gray), produced in low or trace amounts (light gray), assessed but not detected (*) or were not assessed (empty cells).
Hydrogen and carbon dioxide are always produced by anaerobic fungi. If they are not mentioned in the table, it means they were not estimated or their details were not given in the associated reference.
The relative abundances of the metabolites produced by anaerobic fungi are likely to vary based on substrate or strain. The major fermentation products of all species of anaerobic fungi in axenic culture, however, are hydrogen, carbon dioxide, formate, acetate and lactate, with succinate, and ethanol normally produced in lesser quantities (Table 4). Propionate and butyrate, major fermentation products of rumen bacterial metabolism, are not produced by anaerobic fungi. Using an NMR-based metabolomic approach, Cheng et al. (
Numerous in vitro studies have shown that some of the typical end products of anaerobic fungal metabolism are often not accumulated when the fungi are grown in co-culture (Table 5). Hydrogenotrophic methanogens utilize hydrogen and formate as substrates, resulting in the production of methane (Theodorou et al.,
Table 5
| Anaerobic fungus | Coculture partner | Substrate | Fermentation productsa,b | Significant changes in fermentation patterns due to cocultivationc | References | |
|---|---|---|---|---|---|---|
| Fungal monoculture | Fungal co-culture | |||||
| ANAEROBIC FUNGI WITH METHANOGENS | ||||||
| Neocallimastix frontalis PN1 | Methanobrevibacter sp. strain RA1 | Cellulose | H2, CO2, F, A, L, E | CO2, A, L, E, CH4 | of F & H2 into CH4; A, CO2; L, E | Bauchop and Mountfort, |
| Methanosarcina barkeri | CO2, F, A, L, E, CH4 | Initial in H2 & A followed by ![]() | Mountfort et al., | |||
| Methanosarcina barkeri & Methanobrevibacter sp. strain RA1 | CO2, L, E, CH4 | of F & A into CH4; CO2, CH4; L, E | ||||
| Neocallimastix frontalis RE1 | Methanobacterium arboriphilus | Filter paper | H2, CO2, F, A, L, S, E | CO2, F, A, S, E, CH4 | of H2 into CH4; or partial of F into CH4; A; S, L, E; CO2 only with Methanobrevibacter smithii | Marvin-Sikkema et al., |
| Methanobacterium bryantii | ||||||
| Methanobrevibacter smithii | CO2, A, S, CH4 | |||||
| Neocallimastix patriciarum CX | Methanobacterium arboriphilus | CO2, F, A, S, E, CH4 | ||||
| Methanobacterium bryantii | ||||||
| Methanobrevibacter smithii | CO2, A, S, E, CH4 | |||||
| Neocallimastix sp. L2 | Methanobacterium arboriphilus | CO2, F, A, E, CH4 | ||||
| Methanobacterium bryantii | CO2, F, A, S, E, CH4 | |||||
| Methanobrevibacter smithii | CO2, A, S, E, CH4 | |||||
| Neocallimastix frontalis | Methanobacterium formicicum | Cellulose | H2, F, A, L, E | A, L, E, CH4 | of F & H2 into CH4; A; L, E | Nakashimada et al., |
| Methanosaeta concilii | H2, F, A, L, E, CH4 | Partial of F & H2 into CH4; H2, F, A, L, E | ||||
| Methanobacterium formicicum & Methanosaeta concilii | A, L, E, CH4 | of F & H2 into CH4; L, E | ||||
| Neocallimastix frontalis Yaktz1 | Methanobrevibacter ruminantium | Wheat straw | F, A, L, E | A, L, CH4, E | A; L, E | Wei et al., |
| Corn stalk | ||||||
| Rice straw | ||||||
| Piromyces communis P | Methanobacterium arboriphilus | Filter paper | H2, CO2, F, A, L, S, E | CO2, F, A, S, E, CH4 | of H2 into CH4; or partial of F into CH4; A; S, L, E; CO2 only with Methanobrevibacter smithii | Marvin-Sikkema et al., |
| Methanobacterium bryantii | CO2, F, A, E, CH4 | |||||
| Methanobrevibacter smithii | CO2, A, S, E, CH4 | |||||
| Piromyces communis FL | Methanobrevibacter ruminantium | H2, F, A, L, E | A, L, E, CH4 | of F & H2 into CH4; A; L, E | Bernalier et al., | |
| Piromyces sp. | Methanobrevibacter thaueri | Corncob | F, A, L, E | A, L, CH4 | of F into CH4; A | Jin et al., |
| Piromyces sp. F1 | Cellobiose | F, A, L, S, C, α-K, E | F, A, L, S, C, α-K, E | F, A, L, S, C, E; α-K | Cheng et al., | |
| Mixed coculture of anaerobic fungi & methanogens derived from goat rumen | ||||||
| Caecomyces communis FG10 | Methanobacterium arboriphilus | Filter paper | H2, CO2, F, A, L, S, E | CO2, F, A, E, CH4 | of H2 into CH4; or partial of F into CH4; A; S, L, E; CO2 only with Methanobrevibacter smithii | Marvin-Sikkema et al., |
| Methanobacterium bryantii | CO2, F, A, S, E, CH4 | |||||
| Methanobrevibacter smithii | CO2, A, S, L, E, CH4 | |||||
| Methanobrevibacter ruminantium | H2, F, A, L | A, L, CH4 | of F & H2 into CH4; A; L | Bernalier et al., | ||
| ANAEROBIC FUNGI WITH BACTERIA | ||||||
| Neocallimastix frontalis MCH3 | Ruminococcus flavefaciens | Filter paper | H2, CO2, F, A, L, E | H2, CO2, F, A, L, E | CO2, A; H2, F, L, E | Bernalier et al., |
| Fibrobacter succinogenes | CO2; H2, F, A, L, E | |||||
| Eubacterium limosum | H2, CO2, F, A, L, E | H2, CO2, A, B, L, E | CO2, A; H2, L, E | Bernalier et al., | ||
| Piromyces communis FL | Selenomonas ruminantium | H2, F, A, L, E | H2, A, P, L, E | A, L, E; H2 | Bernalier et al., | |
| Ruminococcus flavefaciens | H2, CO2, F, A, L, E | H2, CO2, F, A, L, E | CO2, A; H2, F, L, E | Bernalier et al., | ||
| Fibrobacter succinogenes | CO2; H2, F, A, L, E | |||||
| Eubacterium limosum | H2, CO2, F, A, L, E | H2, CO2, A, B, L, E | CO2, A; H2, L, E | Bernalier et al., | ||
| Ruminococcus flavefaciens | Maize Stem | H2, F, A, L, E | H2, F, A, L, E | F, A; E | Roger et al., | |
| Fibrobacter succinogenes | ||||||
| Piromyces communis B19 | Ruminococcus flavefaciens | Xylan | F, A, L, S | F, A, L, S | S; A | Williams et al., |
| Butyrivibrio fibrisolvens | F, L | of A; L | ||||
| Prevotella ruminicola | F, A, L, S | A, S; F, L | ||||
| Succinivibrio dextrinosolvens | F, A, S | A, S; F | ||||
| Streptococcus bovis | F, A, L, S | L; A | ||||
| Veillonella parvula | F, A, L | A, L | ||||
| Caecomyces communis FG10 | Selenomonas ruminantium | Filter paper | H2, F, A, L | H2, A, P, L, E | E; H2, A | Bernalier et al., |
| Ruminococcus flavefaciens | H2, CO2, F, A, L, E | H2, CO2, F, A, L, E | CO2, L; H2, F, A, E | Bernalier et al., | ||
| Fibrobacter succinogenes | H2, CO2, F, A, L, E | H2, CO2, F, A, E | CO2, A, E; H2, F, L | |||
| Eubacterium limosum | H2, CO2, F, A, L, E | H2, CO2, A, B, L | H2, CO2, A; L | Bernalier et al., | ||
| Ruminococcus flavefaciens | Maize Stem | H2, F, A, L, E | H2, F, A, L, E | F, A; E | Roger et al., | |
| Fibrobacter succinogenes | ||||||
| ANAEROBIC FUNGI WITH CILIATE PROTOZOA | ||||||
| Neocallimastix patriciarum CX | Ciliate protozoa | Rice straw | F, A, L | F, A, P, B | A; F; P & B at the expense of F & L | Widyastuti et al., |
| Piromyces sp. strain OTS1 | Mixed protozoa | Filter paper | F, A, L | A, P, B | A; L | Morgavi et al., |
Changes in fermentation end products of anaerobic fungal metabolism in axenic culture compared to co-culture with methanogens, bacteria or protozoa.
Fermentation products: hydrogen (H2), carbon dioxide (CO2), formate (F), acetate (A), succinate (S), ethanol (E), lactate (L), citrate (C), α ketoglutarate (α-K) and methane (CH4).
Hydrogen and carbon dioxide are always produced by anaerobic fungi in monoculture. If they are not mentioned in the table, it means they were not estimated or their details were not given in the associated reference.
The changes indicated are a conversion (
), an increase (
) or a decrease (
).
As well as influencing metabolism, the presence of methanogens also enhances the lignocellulolytic activities of anaerobic fungi (Bauchop and Mountfort,
Rumen fibrolytic bacteria and anaerobic fungi compete for the same substrates. However, the ability of anaerobic fungi to physically disrupt the plant particles using their invasive rhizoids gives them an advantage over bacteria when utilizing lignocellulosic substrates. The invasive growth of the anaerobic fungal rhizoids can, however, benefit the rumen bacteria by increasing surface area and/or access to internally exposed areas of the plant. Several studies have been conducted on cocultures of anaerobic fungi with fibrolytic and non fibrolytic bacteria (Table 5). The bacterial cultures generally result in a reduction of the fibrolytic activity of anaerobic fungi (Williams et al.,
Rumen protozoa are generally thought to be antagonistic toward anaerobic fungi. Certain protozoa have been reported to prey on anaerobic fungal zoospores (Gordon and Phillips,
Overall, the information regarding anaerobic fungal metabolites is primarily from targeted analysis, and not all of the major metabolites have been measured in studies to date. Particularly, α-ketoglutarate and citrate production in axenic and co-cultures of anaerobic fungi respectively, which have only recently been discovered to be major products (Cheng et al.,
Future perspectives
Anaerobic fungi are the most effective fiber degrading organism in the herbivore gut, with numerous studies confirming their value as a direct fed microbial for ruminants. Reported benefits include improved feed intake, feed digestibility, feed efficiency, daily weight gain and milk production (Lee et al.,
Molecular tools for ecological studies of anaerobic fungi now provide better depth of characterization and taxonomic resolution than before, as it is apparent that several of the previously used ITS1 primers did not provide complete coverage of the Neocallimastigomycota phylum. In addition to ITS1 based profiling methods such as ARISA and DGGE (Table 1), tools and data files have also been generated to support the bioinformatics analysis of NGS amplicon based analysis of this region (see section Internal transcribed spacer region). Several quantitative PCR methods also exist based on the ITS1 region (Denman and Mcsweeney,
A large proportion of early rumen microbial studies focused primarily on the analysis of rumen fluid, where anaerobic fungi only occur transiently as zoospores. Furthermore, whilst rumen zoospore numbers are low compared to counts of bacteria and archaea; anaerobic fungi have been reported to represent up to 20% of the rumen microbial biomass (Rezaeian et al.,
Ruminal sampling is always best performed via a ruminal cannula, as oral stomach tubing is capable of sampling only small feed particles which are normally highly degraded. A ruminal sample of at least 500 grams should be obtained, ideally from the pooling of samples collected at multiple different locations (i.e., the front and middle of the ventral sac and the cranial sac). If required, this sample can then be portioned into liquid and fiber fractions using the French-press method described by Kong et al. (
Subsamples of rumen content that utilize only 100–200 mg quantities for isolation purposes and rely on chemical lysis or bead beating methods to isolate anaerobic fungal RNA/DNA are considered to be inadequate (Wang et al.,
Anaerobic fungi are often considered to play a limited role in the rumen when animals are fed diets supplemented with cereals. However, due to some anaerobic fungi having amylolytic activity, mixed effects of grain supplementation on anaerobic fungal numbers have been reported in the literature (Gordon and Phillips,
As all the currently described Neocallimastigomycota belong to just one family, it is perhaps not entirely unexpected that there are increasing reports of anaerobic fungi in novel herbivorous hosts such as the iguana (Mackie et al.,
To date the long term availability of anaerobic fungal cultures has been an issue, with several type strains being lost over the years. This is due to the inability of commercial culture collections to propagate anaerobic fungal cultures. Therefore, if a culture is deposited in a collection, it is only as good as the shelf-life of the corresponding cryovial. This is a problem that anaerobic fungal researchers are actively seeking to resolve through improving cryopreservation methods (Solomon et al.,
Anaerobic fungal cultures will always be essential to our ability to understand the biology of anaerobic fungi, particularly as there is an increasing need to link ‘omics data with activity and physiology. This is even more important now that it is recognized that a large proportion of anaerobic fungal sequences cannot be functionally annotated, including highly expressed “core” genes. In order to help deliver improved models for future annotations, databases need to be (a) promptly updated with sequenced anaerobic fungal genomes as well as (b) strategies developed to characterize the function of the currently non-annotated “core” genes.
Conclusions
Anaerobic fungi are a central component of the rumen microbiome, and are well established in terms of their key role in ruminal fiber degradation. Application of PCR based approaches in the past decade has increased our understanding of their diversity, and highlighted that many novel taxa remain to be cultivated. Understanding of their ecological role in the rumen is, however, undergoing a paradigm shift in light of the increasing evidence base indicating that anaerobic fungi have undergone substantial niche differentiation. There is a need to move beyond the broad generalization of anaerobic fungi as fiber-degraders, and explore the fundamental differences that underpin their ability to exist in distinct ecological niches. Application of genomics, transcriptomics, proteomics and metabolomics to their study in pure/mixed cultures and environmental samples will be invaluable in this process. A more central key challenge however, is advancing our understanding of the biology of axenic cultures using the wide range of ‘omics approaches that have been successfully developed to date. A central problem for all analyses is the limited functional annotation of anaerobic fungal sequence data. There is, therefore, an urgent need to expand information held within publicly available reference databases. Once this challenge is overcome, along with improved rumen sample collection and extraction, the application of these techniques will be key in furthering our understanding of the ecological role and impact of anaerobic fungi.
Statements
Author contributions
JE initiated and co-ordinated the writing project. All authors contributed text to the manuscript. All co-authors contributed to the development of the manuscript as a whole by giving constructive feedback on the manuscript during its preparation. All authors gave approval of the manuscript for publication.
Funding
The following authors would like to gratefully acknowledge their funding sources: JE (EU H2020 funded Marie Curie Fellowship 706899), SD (Stapledon Fellowship), AP (DBT-CREST Award) and KF (Ministry of Education, Youth and Sports of the Czech Republic CZ.02.1.01/0.0/0.0/15_003/0000460 OP RDE). MO gratefully acknowledges funding support from the Office of Science (BER), U.S. Department of Energy (DE-SC0010352), the National Science Foundation (MCB-1553721), and the Institute for Collaborative Biotechnologies through grant W911NF-09-0001 from the U.S. Army Research Office. Anaerobic fungal genomes for A. robustus, N. californiae, and P. finnis were enabled by the Facilities Integrating Collaborations for User Science (FICUS) exploratory effort and used resources at the DOE Joint Genome Institute and the Environmental Molecular Sciences Laboratory, which are DOE Office of Science User Facilities. Both facilities are sponsored by the Office of Biological and Environmental Research and operated under Contract Nos. DE-AC02-05CH11231 (JGI) and DE-AC05-76RL01830 (EMSL). The Institute of Biological, Environmental, and Rural Sciences, Aberystwyth University receives strategic funding from the BBSRC.
Acknowledgments
All of the authors are members of the Anaerobic Fungal Research Network (www.anaerobicfungi.org). The phylogenetic tree in Figure 2 is reproduced with kind permission from the Taylor and Francis Group, LLC, a division of Informa plc. Copyright © 2017 from “Adaptations of fungi and fungal like organisms for growth under reduced dissolved oxygen concentrations” by SK, Cathrine S. Manohar, Ray Kearney, Donald O. Natvig, and Frank H. Gleason in “The Fungal Community: its Organization and Role in the Ecosystem” (4th Edition) ed. John Dighton and James F. White.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: http://journal.frontiersin.org/article/10.3389/fmicb.2017.01657/full#supplementary-material
References
1
AbarenkovK.NilssonR. H.LarssonK.-H.AlexanderI. J.EberhardtU.ErlandS.et al. (2010). The UNITE database for molecular identification of fungi – recent updates and future perspectives. New Phytol.186, 281–285. 10.1111/j.1469-8137.2009.03160.x
2
AbdelnurP. V.CaldanaC.MartinsM. C. (2014). Metabolomics applied in bioenergy. Chem. Biol. Technol. Agric.1:22. 10.1186/s40538-014-0022-0
3
AebersordR. H.LeavittJ.SaavedraR. A.HoodL. E.KentS. B. H. (1987). Internal amino acid sequence analysis of proteins separated by one- or two-dimensional gel electrophoresis after in situ protease digestion on nitrocellulose. Proc. Natl. Acad. Sci. U.S.A.84, 6970–6974. 10.1073/pnas.84.20.6970
4
AriyawansaH. A.HydeK. D.JayasiriS. C.BuyckB.ChethanaK. W. T.DaiD. Q.et al. (2015). Fungal Diversity Notes 111–252 - Taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers. 75, 27–274. 10.1007/s13225-015-0346-5
5
BauchopT.MountfortD. O. (1981). Cellulose fermentation by a rumen anaerobic fungus in both the absence and the presence of rumen methanogens. Appl. Environ. Microbiol.42, 1103–1110.
6
BelilaA.El-ChakhtouraJ.SaikalyP. E.van LoosdrechtM. C.VrouwenvelderJ. S. (2017). Eukaryotic community diversity and spatial variation during drinking water production (by seawater desalination) and distribution in a full-scale network. Environ. Sci. Wat. Res.3, 92–105. 10.1039/C6EW00265J
7
BensonD. A.CavanaughM.ClarkK.Karsch-MizrachiI.LipmanD. J.OstellJ.et al. (2013). GenBank. Nucleic Acids Res.41, D36–D42. 10.1093/nar/gks1195
8
BernalierA.FontyG.BonnemoyF.GouetP. (1992). Degradation and fermentation of cellulose by the rumen anaerobic fungi in axenic cultures or in association with cellulolytic bacteria. Curr. Microbiol.25, 143–148. 10.1007/BF01571022
9
BernalierA.FontyG.GouetP. (1991). Cellulose degradation by two rumen anaerobic fungi in monoculture or in coculture with rumen bacteria. Anim. Feed Sci. Tech.32, 131–136. 10.1016/0377-8401(91)90016-L
10
BernalierA.FontyG.BonnemoyF.GouetP. (1993). Effect of Eubacterium limosum, a ruminal hydrogenotrophic bacterium, on the degradation and fermentation of cellulose by 3 species of rumen anaerobic fungi. Reprod. Nutr. Dev.33, 577–584. 10.1051/rnd:19930609
11
BornemanW. S.AkinD.LjungdahlL. (1989). Fermentation products and plant cell wall-degrading enzymes produced by monocentric and polycentric anaerobic ruminal fungi. Appl. Environ. Microbiol.55, 1066–1073.
12
BowmanB. H.TaylorJ. W.BrownleeA. G.LeeJ.LuS. D.WhiteT. (1992). Molecular evolution of the fungi: relationship of the Basidiomycetes, Ascomycetes, and Chytridiomycetes. Mol. Biol. Evol.9, 285–296.
13
BoxmaB.VonckenF.JanninkS.Van AlenT.AkhmanovaA.Van WeeldenS. W.et al. (2004). The anaerobic chytridiomycete fungus Piromyces sp. E2 produces ethanol via pyruvate: formate lyase and an alcohol dehydrogenase E. Mol. Microbiol.51, 1389–1399. 10.1046/j.1365-2958.2003.03912.x
14
BrookmanJ.MennimG.TrinciA.TheodorouM.TuckwellD. (2000). Identification and characterization of anaerobic gut fungi using molecular methodologies based on ribosomal ITS1 and 18S rRNA. Microbiology146, 393–403. 10.1099/00221287-146-2-393
15
BrulcJ. M.AntonopoulosD. A.Berg MillerM. E.WilsonM. K.YannarellA. C.DinsdaleE. A.et al. (2009). Gene-centric metagenomics of the fiber-adherent bovine rumen microbiome reveals forage specific glycoside hydrolases. Proc. Natl. Acad. Sci. U.S.A.106, 1948–1953. 10.1073/pnas.0806191105
16
BuchheimM. A.KellerA.KoetschanC.FörsterF.MergetB.WolfM. (2011a). Internal transcribed spacer 2 (nu ITS2 rRNA) sequence-structure phylogenetics: towards an automated reconstruction of the green algal tree of life. PLoS ONE6:e16931. 10.1371/journal.pone.0016931
17
BuchheimM. A.SutherlandD. M.SchleicherT.FörsterF.WolfM. (2011b). Phylogeny of Oedogoniales, Chaetophorales and Chaetopeltidales (Chlorophyceae): inferences from sequence-structure analysis of ITS2. Ann. Bot.109, 109–116. 10.1093/aob/mcr275
18
CalkinsS.ElledgeN. C.HanafyR. A.ElshahedM. S.YoussefN. (2016). A fast and reliable procedure for spore collection from anaerobic fungi: application for RNA uptake and long-term storage of isolates. J. Microbio. Meth.127, 206–213. 10.1016/j.mimet.2016.05.019
19
CallaghanT. M. (2014). Developing Tools for the Identification and Taxonomic Placement of the Neocallimastigales. Ph.D. Thesis. Aberystwyth University, Wales.
20
CallaghanT. M.PodmirsegS. M.HohlweckD.EdwardsJ. E.PuniyaA. K.DagarS. S.et al. (2015). Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys9, 11–28. 10.3897/mycokeys.9.9032
21
CaporasoJ. G.KuczynskiJ.StombaughJ.BittingerK.BushmanF. D.CostelloE. K.et al. (2010). QIIME allows analysis of high-throughput community sequencing data. Nat. Methods7, 335–336. 10.1038/nmeth.f.303
22
ChenH.LiX. L.LjungdahlL. G. (1995). A cyclophilin from the polycentric anaerobic rumen fungus Orpinomyces sp. strain PC-2 is highly homologous to vertebrate cyclophilin B. Proc. Natl. Acad. Sci. U.S.A.92, 2587–2591. 10.1073/pnas.92.7.2587
23
ChengY. F.EdwardsJ. E.AllisonG. G.ZhuW. Y.TheodorouM. K. (2009). Diversity and activity of enriched ruminal cultures of anaerobic fungi and methanogens grown together on lignocellulose in consecutive batch culture. Bioresour. Technol.100, 4821–4828. 10.1016/j.biortech.2009.04.031
24
ChengY. F.JinW.MaoS. Y.ZhuW.-Y. (2013). Production of citrate by anaerobic fungi in the presence of co-culture methanogens as revealed by 1H NMR spectrometry. Asian Austral. J. Anim.26, 1416–1423. 10.5713/ajas.2013.13134
25
ColemanA. (2003). ITS2 is a double-edged tool for eukaryote evolutionary comparisons. Trends Genet.19, 370–375. 10.1016/S0168-9525(03)00118-5
26
Comtet-MarreS.ParisotN.LepercqP.Chaucheyras-DurandF.MosoniP.PeyretailladeE.et al. (2017). Metatranscriptomics Reveals the Active Bacterial and Eukaryotic Fibrolytic Communities in the Rumen of Dairy Cow Fed a Mixed Diet. Front. Microbiol.8:67. 10.3389/fmicb.2017.00067
27
CougerM. B.YoussefN. H.StruchtemeyerC. G.LiggenstofferA. S.ElshahedM. S. (2015). Transcriptomic analysis of lignocellulosic biomass degradation by the anaerobic fungus isolate Orpinomyces sp. Strain C1A. Biotechnol. Biofuels8:208. 10.1186/s13068-015-0390-0
28
DagarS. S.KumarS.MudgilP.SinghR.PuniyaA. K. (2011). D1/D2 domain of large subunit rDNA for differentiation of Orpinomyces spp. Appl. Environ. Microbiol.77, 6722–6725. 10.1128/AEM.05441-11
29
DagarS. S.KumarS.PittaD. W.EdwardsJ.CallaghanT.GriffithG.et al. (2014). Large-subunit rDNA based differentiation of anaerobic rumen fungi using restriction fragment length polymorphism, in Linking Animal Science and Animal Agriculture: Meeting the Global Demands of 2050 92, ADSA-ASAS-CSAS Joint Annual Meeting (Kansas City, MO), 340.
30
DagarS. S.KumarS.GriffithG. W.EdwardsJ. E.CallaghanT. M.SinghR.et al. (2015). A new anaerobic fungus (Oontomyces anksri gen. nov., sp. nov.) from the digestive tract of the Indian camel (Camelus dromedarius). Fungal Biol. U.K.119, 731–737. 10.1016/j.funbio.2015.04.005
31
DaiX.TianY.LiJ.SuX.WangX.ZhaoS.et al. (2014). Metatranscriptomic analyses of plant cell wall polysaccharide degradation by microorganisms in cow rumen. Appl. Environ. Microbiol.81, 1375–1386. 10.1128/AEM.03682-14
32
DaviesD. R.TheodorouM. K.LawrenceM. I. G.TrinciA. P. J. (1993). Distribution of anaerobic fungi in the digestive tract of cattle and their survival in feces. J. Gen. Microbiol.139, 1395–1400. 10.1099/00221287-139-6-1395
33
DenmanS. E.McsweeneyC. S. (2006). Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol.58, 572–582. 10.1111/j.1574-6941.2006.00190.x
34
DenmanS.NicholsonM.BrookmanJ.TheodorouM.McsweeneyC. (2008). Detection and monitoring of anaerobic rumen fungi using an ARISA method. Lett. Appl. Microbiol.47, 492–499. 10.1111/j.1472-765X.2008.02449.x
35
DetheridgeA. P.BrandG.FychanR.CrottyF. V.SandersonR.GriffithG. W.et al. (2016). The legacy effect of cover crops on soil fungal populations in a cereal rotation. Agr. Ecosyst. Environ.228, 49–61. 10.1016/j.agee.2016.04.022
36
DeyA.SehgalJ. P.PuniyaA. K.SinghK. (2004). Influence of anaerobic fungal culture (Orpinomyces sp.) administration on growth rate, ruminal fermentation and nutrient digestion in calves. Asian Austral. J. Anim.17, 820–824. 10.5713/ajas.2004.820
37
DollhoferV.CallaghanT. M.Dorn-InS.BauerJ.LebuhnM. (2016). Development of three specific PCR-based tools to determine quantity, cellulolytic transcriptional activity and phylogeny of anaerobic fungi. J. Microbiol. Meth.127, 28–40. 10.1016/j.mimet.2016.05.017
38
DollhoferV.CallaghanT. M.GriffithG. W.LebuhnM.BauerJ. (2017). Presence and transcriptional activity of anaerobic fungi in agricultural biogas plants. Bioresour. Technol.235, 131–139. 10.1016/j.biortech.2017.03.116
39
DollhoferV.PodmirsegS. M.CallaghanT. M.GriffithG. W.FliegerovaK. (2015). Anaerobic fungi and their potential for biogas production, in Biogas Science and Technology, eds GuebitzG. M.BauerA.BochmannG.GronauerA.WeissS. (Cham: Springer International Publishing), 41–61.
40
DoreJ.StahlD. (1991). Phylogeny of anaerobic rumen Chytridiomycetes inferred from small subunit ribosomal RNA sequence comparisons. Can. J. Bot.69, 1964–1971. 10.1139/b91-246
41
EberhardtR. Y.GilbertH. J.HazlewoodG. P. (2000). Primary sequence and enzymic properties of two modular endoglucanases, Cel5A and Cel45A, from the anaerobic fungus Piromyces equi. Microbiology146, 1999–2008. 10.1099/00221287-146-8-1999
42
EckartM.FliegerováK.HoffmannK.VoigtK.. (2010). Molecular identification of anaerobic rumen fungi, in Molecular Identification of Fungi, eds GherbawyY.VoigtK. (Heidelbergl; Berlin: Springer-Verlag), 297–313.
43
EdwardsJ. E.Kingston-SmithA. H.JimenezH. R.HuwsS. A.SkotK. P.GriffithG. W.et al. (2008). Dynamics of initial colonization of nonconserved perennial ryegrass by anaerobic fungi in the bovine rumen. FEMS Microbiol. Ecol.66, 537–545. 10.1111/j.1574-6941.2008.00563.x
44
ElekwachiC. O.WangZ.WuX.RabeeA.ForsterR. J. (2017). Total rRNA-seq analysis gives insight intobacterial, fungal, protozoaland archaeal communities in the rumen using an optimized RNA isolation method. Front. Microbiol. 8:1814. 10.3389/fmicb.2017.01814
45
FeistP.HummonA. B. (2015). Proteomic challenges: sample preparation techniques for microgram-quantity protein analysis from biological samples. Int. J. Mol. Sci.16, 3537–3563. 10.3390/ijms16023537
46
FellJ. W.BoekhoutT.FonsecaA.ScorzettiG.Statzell-TallmanA. (2000). Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol.Microbiol. 50, 1351–1371. 10.1099/00207713-50-3-1351
47
FerrerM.GolyshinaO. V.ChernikovaT. N.KhachaneA. N.Reyes-DuarteD.SantosV. A.et al. (2005). Novel hydrolase diversity retrieved from a metagenome library of bovine rumen microflora. Environ. Microbiol.7, 1996–2010. 10.1111/j.1462-2920.2005.00920.x
48
FliegerovaK.HodrovaB.VoigtK. (2004). Classical and molecular approaches as a powerful tool for the characterization of rumen polycentric fungi. Folia. Microbiol.49, 157–164. 10.1007/BF02931392
49
FliegerovaK.MrazekJ.VoigtK. (2006). Differentiation of anaerobic polycentric fungi by rDNA PCR-RFLP. Folia Microbiol.51, 273–277. 10.1007/BF02931811
50
FliegerovaK.MrazekJ.HoffmannK.ZabranskaJ.VoigtK. (2010). Diversity of anaerobic fungi within cow manure determined by ITS1 analysis. Folia Microbiol.55, 319–325. 10.1007/s12223-010-0049-y
51
FliegerovaK.PazoutovaS.MrazekJ.KopecnyJ. (2002). Special properties of polycentric anaerobic fungus Anaeromyces mucronatus. Acta. Veta. Brno.71, 441–444. 10.2754/avb200271040441
52
GilbertH. J.HazlewoodG. P.LaurieJ. I.OrpinC. G.XueG. P. (1992). Homologous catalytic domains in a rumen fungal xylanase: evidence for gene duplication and prokaryotic origin. Mol. Microbiol.6, 2065–2072. 10.1111/j.1365-2958.1992.tb01379.x
53
GilmoreS. P.HenskeJ. K.O'MalleyM. A. (2015). Driving biomass breakdown through engineered cellulosomes. Bioengineered, 6, 204–208. 10.1080/21655979.2015.1060379
54
GordonG. L. R.PhillipsM. W. (1998). The role of anaerobic gut fungi in ruminants. Nutr. Res. Rev.11, 133–168. 10.1079/NRR19980009
55
GorgA.WeissW.DunnM. J. (2004). Current two-dimensional electrophoresis technology for proteomics. Proteomics4, 3665–3685. 10.1002/pmic.200401031
56
GrahamR. L. J.GrahamC.McMullanG. (2007). Microbial proteomics: a mass spectrometry primer for biologists. Microb. Cell Fact.6, 26–40. 10.1186/1475-2859-6-26
57
GriffithG. W.OzkoseE.TheodorouM. K.DaviesD. R. (2009). Diversity of anaerobic fungal populations in cattle revealed by selective enrichment culture using different carbon sources. Fungal Ecol.2, 87–97. 10.1016/j.funeco.2009.01.005
58
GrigorievI. V.NikitinR.HaridasS.KuoA.OhmR.OtillarR.et al. (2014). MycoCosm portal: gearing up for 1000 fungal genomes. Nucleic Acids Res.42, 699–704. 10.1093/nar/gkt1183
59
GruningerR. J.PuniyaA. K.CallaghanT. M.EdwardsJ. E.YoussefN.DagarS. S.et al. (2014). Anaerobic fungi (phylum Neocallimastigomycota): advances in understanding their taxonomy, life cycle, ecology, role and biotechnological potential. FEMS Microbiol. Ecol.90, 1–17. 10.1111/1574-6941.12383
60
HaitjemaC. H.GilmoreS. P.HenskeJ. K.SolomonK. V.deGrootR.KuoA.et al. (2017). A parts list for fungal cellulosomes revealed by comparative genomics. Nat. Microbiol.2:17087. 10.1038/nmicrobiol.2017.87
61
HaitjemaC. H.SolomonK. V.HenskeJ. K.TheodorouM. K.O'MalleyM. A. (2014). Anaerobic gut fungi: advances in isolation, culture, and cellulolytic enzyme discovery for biofuel production. Biotechnol. Bioeng.111, 1471–1482. 10.1002/bit.25264
62
HanafyR. A.ElshahedM. S.LiggenstofferA. S.GriffithG. W.YoussefN. H. (2017). Pecoramyces ruminantium, gen. nov, sp. nov., an anaerobic gut fungus from the feces of cattle and sheep. Mycologia.109, 231–243. 10.1080/00275514.2017.1317190
63
HausnerG.InglisG. D.YankeL. J.KawchukL. M.McallisterT. A. (2000). Analysis of restriction fragment length polymorphisms in the ribosomal DNA of a selection of anaerobic chytrids. Can. J. Bot.78, 917–927. 10.1139/b00-067
64
HendersonG.CoxF.GaneshS.JonkerA.YoungW.JanssenP. H. (2015). Rumen microbial community composition varies with diet and host, but a core microbiome is found across a wide geographical range. Sci. Rep.5:14567. 10.1038/srep14567
65
HendersonG.CoxF.KittelmannS.MiriV. H.ZethofM.NoelS. J.et al. (2013). Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities. PLoS ONE8:e74787. 10.1371/journal.pone.0074787
66
HerreraJ.PoudelR.KhidirH. H. (2011). Molecular characterization of coprophilous fungal communities reveals sequences related to root-associated fungal endophytes. Microb. Ecol.61, 239–244. 10.1007/s00248-010-9744-0
67
HessM.SczyrbaA.EganR.KimT. W.ChokhawalaH.SchrothG.et al. (2011). Metagenomic discovery of biomass-degrading genes and genomes from cow rumen. Science331, 463–467. 10.1126/science.1200387
68
HibbettD. S.BinderM.BischoffJ. F.BlackwellM.CannonP. F.ErikssonO. E.et al. (2007). A higher-level phylogenetic classification of the Fungi. Mycol. Res.111, 509–547. 10.1016/j.mycres.2007.03.004
69
HinsuA. T.ParmarN. R.NathaniN. M.PanditR. J.PatelA. B.PatelA. K.et al. (2017). Functional gene profiling through metaRNAseq approach reveals diet-dependent variation in rumen microbiota of buffalo (Bubalus bubalis). Anaerobe44, 106–116. 10.1016/j.anaerobe.2017.02.021
70
HoY. W.AbdullahN.JalaludinS. (1988). Penetrating structures of anaerobic rumen fungi in cattle and swamp buffalo. J. Gen. Microbiol.134, 177–181. 10.1099/00221287-134-1-177
71
HoY. W.WongM.-L.AbdullanN.KudoH.JalaludinS. (1996). Fermentation activities of some new species of anaerobic rumen fungi from Malaysia. J. Gen. Appl. Microbiol.42, 51–59. 10.2323/jgam.42.51
72
HurJ. Y.ParkM. C.SuhK. Y.ParkS. H. (2011). Synchronization of cell cycle of Saccharomyces cerevisiae by using a cell chip platform. Mol. Cells32, 483–488. 10.1007/s10059-011-0174-8
73
IvarssonM.SchnürerA.BengtsonS.NeubeckA. (2016). Anaerobic Fungi: a potential source of biological H2 in the Oceanic Crust. Front. Microbiol.7:674. 10.3389/fmicb.2016.00674
74
JamesT. Y.KauffF.SchochC. L.MathenyP. B.HofstetterV.CoxC.et al. (2006). Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature443:818. 10.1038/nature05110
75
JinW.ChengY.-F.MaoS.-Y.ZhuW.-Y. (2011). Isolation of natural cultures of anaerobic fungi and indigenously associated methanogens from herbivores and their bioconversion of lignocellulosic materials to methane. Bioresource. Technol.102, 7925–7931. 10.1016/j.biortech.2011.06.026
76
KamkeJ.KittelmannS.SoniP.LiY.TavendaleM.GaneshS.et al. (2016). Rumen metagenome and metatranscriptome analyses of low methane yield sheep reveals a Sharpea-enriched microbiome characterized by lactic acid formation and utilisation. Microbiome4:56. 10.1186/s40168-016-0201-2
77
KellerA.FörsterF.MüllerT.DandekarT.SchultzJ.WolfM. (2010). Including RNA secondary structures improves accuracy and robustness in reconstruction of phylogenetic trees. Biol. Direct5:4. 10.1186/1745-6150-5-4
78
KellerN.TurnerG.BennettJ. (2005). Fungal secondary metabolism – from biochemistry to genomics. Nat. Rev. Microbiol.3, 937–947. 10.1038/nrmicro1286
79
KhejornsartP.WanapatM. (2010). Diversity of rumen anaerobic fungi and methanogenic archaea in swamp buffalo influenced by various diets. J. Anim. Vet. Adv.9, 3062–3069. 10.3923/javaa.2010.3062.3069
80
KhejornsartP.WanapatM.RowlinsonP. (2011). Diversity of anaerobic fungi and rumen fermentation characteristic in swamp buffalo and beef cattle fed on different diets. Livest. Sci.139, 230–236. 10.1016/j.livsci.2011.01.011
81
KittelmannS.CathrineS. J.KearneyR.NatvigD.GleasonF. H. (2017). Adaptations of fungi and fungal like organisms for growth under reduced dissolved oxygen concentrations, in The Fungal Community, Its Organization and Role in the Ecosystem, eds DightonJ.WhiteJ. F. (Boca Raton, FL: CRC Press), 275–292.
82
KittelmannS.NaylorG. E.KoolaardJ. P.JanssenP. H. (2012). A proposed taxonomy of anaerobic fungi (Class Neocallimastigomycetes) suitable for large-scale sequence-based community structure analysis. PLoS ONE7:e36866. 10.1371/journal.pone.0036866
83
KittelmannS.SeedorfH.WaltersW. A.ClementeJ. C.KnightR.GordonJ. I.et al. (2013). Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities. PLoS ONE8:e4787910.1371/journal.pone.0047879
84
KoetschanC.KittelmannS.LuJ.Al-HalbouniD.JarvisG. N.MüllerT.et al. (2014). Internal Transcribed Spacer 1 secondary structure analysis reveals a common core throughout the anaerobic Fungi (Neocallimastigomycota). PLoS ONE 9:e91928. 10.1371/journal.pone.0091928
85
KõljalgU.LarssonK.-H.AbarenkovK.NilssonR. H.AlexanderI. J.EberhardtU.et al. (2005). UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi. New Phytol.166, 1063–1068. 10.1111/j.1469-8137.2005.01376.x
86
KongY.TeatherR.ForsterR. (2010). Composition, spatial distribution, and diversity of the bacterial communities in the rumen of cows fed different forages. FEMS Microbiol. Ecol. 74, 612–622. 10.1111/j.1574-6941.2010.00977.x
87
KostyukovskyV. A.OkunevO. N.TarakanovB. V. (1991). Description of two anaerobic fungal strains from the bovine rumen and influence of diet on the fungal population in vivo. Microbiology137, 1759–1764. 10.1099/00221287-137-7-1759
88
KwonM.SongJ.HaJ. K.ParkH.-S.ChangJ. (2009). Analysis of functional genes in carbohydrate metabolic pathway of anaerobic rumen fungus Neocallimastix frontalis PMA02. Asian. Austral. J. Anim.22, 1555–1565. 10.5713/ajas.2009.80371
89
LamK.-K.LaButtiK.KhalakA.TseD. (2015). FinisherSC: a repeat-aware tool for upgrading de novo assembly using long reads. Bioinformatics31, 3207–3209. 10.1093/bioinformatics/btv280
90
LeeS. M.GuanL. L.EunJ. S.KimC. H.LeeS. J.KimE. T.et al. (2015). The effect of anaerobic fungal inoculation on the fermentation characteristics of rice straw silages. J. Appl. Microbiol.118, 565–573. 10.1111/jam.12724
91
LeeS. S.HaJ. K.ChengK. J. (2000). Influence of an anaerobic fungal culture administration on in-vivo ruminal fermentation and nutrient digestion. Anim. Feed Sci. Tech. 88, 201–217. 10.1016/S0377-8401(00)00216-9
92
LeeS. S.ShinK. J.KimW. Y.HaJ. K.HanI. K. (1999). The rumen ecosystem: as a fountain source of novel enzymes - Review. Asian Austral. J. Anim.12, 988–1001. 10.5713/ajas.1999.988
93
LeisS.DreschP.PeintnerU.FliegerovaK.SandbichlerA. M.InsamH.et al. (2014). Finding a robust strain for biomethanation: Anaerobic fungi (Neocallimastigomycota) from the Alpine ibex (Capra ibex) and their associated methanogens. Anaerobe29, 34–43. 10.1016/j.anaerobe.2013.12.002
94
LiF.GuanL. L. (2017). Metatranscriptomic profiling reveals linkages between the active rumen microbiome and feed efficiency in beef cattle. Appl. Environ. Microbiol.83:e00061–17. 10.1128/AEM.00061-17
95
LiF.HendersonG.SunX.CoxF.JanssenP. H.GuanL. L. (2016). Taxonomic assessment of rumen microbiota using total RNA and targeted amplicon sequencing approaches. Front. Microbiol.7:987. 10.3389/fmicb.2016.00987
96
LiG. J.HydeK. D.ZhaoR. L.HongsananS.Abdel-AzizF. A.Abdel-WahabM. A.et al. (2016). Fungal diversity notes 253–366: taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers.78, 1–237. 10.1007/s13225-016-0366-9
97
LiJ.HeathI. B. (1992). The phylogenetic relationships of the anaerobic chytridiomycetous gut fungi (Neocallimasticaceae) and the Chytridiomycota. I. Cladistic analysis of rRNA sequences. Can. J. Bot.70, 1738–1746. 10.1139/b92-215
98
LiggenstofferA. S.YoussefN. H.CougerM. B.ElshahedM. S. (2010). Phylogenetic diversity and community structure of anaerobic gut fungi (phylum Neocallimastigomycota) in ruminant and non-ruminant herbivores. ISME. J.4, 1225–1235. 10.1038/ismej.2010.49
99
LinD.TabbD. L.YatesJ. R.II. (2003). Large-scale protein identification using mass spectrometry. Biochim. Biophys. Acta1646, 1–10. 10.1016/S1570-9639(02)00546-0
100
LockhartR. J.Van DykeM. I.BeadleI. R.HumphreysP.McCarthyA. J. (2006). Molecular biological detection of anaerobic gut fungi (Neocallimastigales) from landfill sites. Appl. Environ. Microbiol.72, 5659–5661. 10.1128/AEM.01057-06
101
LoweS. E.TheodorouM. K.TrinciA. P.HespellR. B. (1985). Growth of anaerobic rumen fungi on defined and semi-defined media lacking rumen fluid. J. Gen.Microbiol.131, 2225–2229. 10.1099/00221287-131-9-2225
102
LoweS. E.TheodorouM.TrinciA. (1987). Growth and fermentation of an anaerobic rumen fungus on various carbon sources and effect of temperature on development. Appl. Environ. Microbiol.53, 1210–1215.
103
LwinK.HayakawaM.Ban-TokudaT.MatsuiH. (2011). Real-time PCR assays for monitoring anaerobic fungal biomass and population size in the rumen. Curr. Microbiol.62, 1147–1151. 10.1007/s00284-010-9843-7
104
MackieR. I.RycykM.RuemmlerR. L.AminovR. I.WikelskiM. (2004). Biochemical and microbiological evidence for fermentative digestion in free-living land iguanas (Conolophus pallidus) and marine iguanas (Amblyrhynchus cristatus) on the Galapagos archipelago. Physiol. Biochem. Zool.77, 127–138. 10.1086/383498
105
MaranoA. V.GleasonF. H.BärlocherF.Pires-ZottarelliC. L.LiljeO.SchmidtS. K.et al. (2012). Quantitative methods for the analysis of zoosporic fungi. J. Microbiol. Meth.89, 22–32. 10.1016/j.mimet.2012.02.003
106
MarmeisseR.KellnerH.Fraissinet-TachetL.LuisP. (2017). Discovering protein-coding genes from the environment: time for the eukaryotes?Trends Biotechnol.35, 824–835. 10.1016/j.tibtech.2017.02.003
107
Marvin-SikkemaF. D.RichardsonA. J.StewartC. S.GottschalJ. C.PrinsR. A. (1990). Influence of hydrogen-consuming bacteria on cellulose degradation by anaerobic fungi. Appl. Environ. Microbiol.56, 3793–3797.
108
MashegoM. R.RumboldK.De MeyM.VandammeE.SoetaertW.HeijnenJ. J. (2007). Microbial metabolomics: past, present and future methodologies. Biotechnol. Lett.29, 1–16. 10.1007/s10529-006-9218-0
109
McGranaghanP.DaviesJ. C.GriffithG. W.DaviesD. R.TheodorouM. K. (1999). The survival of anaerobic fungi in cattle faeces. FEMS Microbiol. Ecol.29, 293–300. 10.1111/j.1574-6941.1999.tb00620.x
110
MohamedD. J.MartinyJ. B. (2011). Patterns of fungal diversity and composition along a salinity gradient. ISME J.5, 379–388. 10.1038/ismej.2010.137
111
MondoS. J.DannebaumR. O.KuoR.LaButtiK.HaridasS.KuoA.et al. (2017). Widespread adenine N6-methylation of active genes in fungi. Nat. Genet.49, 964–968. 10.1038/ng.3859
112
MorgaviD. P.SakuradaM.MizokamiM.TomitaY.OnoderaR. (1994a). Effects of ruminal protozoa on cellulose degradation and the growth of an anaerobic ruminal fungus, Piromyces sp. strain OTS1, in vitro. Appl. Environ. Microbiol.60, 3718–3723.
113
MorgaviD. P.SakuradaM.TomitaY.OnoderaR. (1994b). Presence in rumen bacterial and protozoal populations of enzymes capable of degrading fungal cell walls. Microbiology140, 631–636. 10.1099/00221287-140-3-631
114
MountfortD. O.AsherR. A.BauchopT. (1982). Fermentation of cellulose to methane and carbon dioxide by a rumen anaerobic fungus in a triculture with Methanobrevibacter sp. strain RA1 and Methanosarcina barkeri. Appl. Environ. Microbiol.44, 128–134.
115
NakashimadaY.SrinivasanK.MurakamiM.NishioN. (2000). Direct conversion of cellulose to methane by anaerobic fungus Neocallimastix frontalis and defined methanogens. Biotechnol. Lett.22, 223–227. 10.1023/A:1005666428494
116
NewboldC. J.de la FuenteG.BelancheA.Ramos-MoralesE.McEwanN. R. (2015). The role of ciliate protozoa in the rumen. Front. Microbiol.6:1313. 10.3389/fmicb.2015.01313
117
NicholsonM. J.McsweeneyC. S.MackieR. I.BrookmanJ. L.TheodorouM. K. (2010). Diversity of anaerobic gut fungal populations analysed using ribosomal ITS1 sequences in faeces of wild and domesticated herbivores. Anaerobe16, 66–73. 10.1016/j.anaerobe.2009.05.003
118
NicholsonM. J.TheodorouM. K.BrookmanJ. L. (2005). Molecular analysis of the anaerobic rumen fungus Orpinomyces–insights into an AT-rich genome. Microbiology151, 121–133. 10.1099/mic.0.27353-0
119
O'FallonJ. V.WrightR.CalzaR. E. (1991). Glucose metabolic pathways in the anaerobic rumen fungus Neocallimastix frontalis EB188. Biochem. J.274, 595–599. 10.1042/bj2740595
120
OrpinC. G. (1975). Studies on the rumen flagellate Neocallimastix frontalis. Microbiology91, 249–262. 10.1099/00221287-91-2-249
121
OrpinC. G.JoblinK. N. (1997). The rumen anaerobic fungi, in The Rumen Microbial Ecosystem, eds HobsonP. N.StewartC. S. (Dordrecht: Springer), 140–195.
122
OrpinC. G.MunnE. A. (1986). Neocallimastix patriciarum sp. nov., a new member of the Neocallimasticaceae inhabiting the rumen of sheep. Brit. Mycol. Soc. 86, 178–181. 10.1016/S0007-1536(86)80138-3
123
OrpinC. G. (1977). The occurrence of chitin in the cell walls of the rumen organisms Neocallimastix frontalis, Piromonas communis and Sphaeromonas communis. J. Gen. Microbiol. 99, 215–218. 10.1099/00221287-99-1-215
124
OzkoseE.ThomasB. J.DaviesD. R.GriffithG. W.TheodorouM. K. (2001). Cyllamyces aberensis gen. nov. sp. nov., a new anaerobic gut fungus with branched sporangiophores isolated from cattle. Can. J. Bot.79, 666–673. 10.1139/b01-047
125
ParkM. A. (2011). Genomic and Proteomic Approaches for Elucidation of Carbohydrate Metabolism in Anaerobic Rumen Fungus, Neocallimastix frontalis PMA02. Ph.D. Thesis, Seoul National University.
126
PaulS. S.KamraD. N.SastryV. R. (2010). Fermentative characteristics and fibrolytic activities of anaerobic gut fungi isolated from wild and domestic ruminants. Arch. Anim. Nutr.64, 279–292. 10.1080/17450391003625037
127
PaulS. S.KamraD. N.SastryV. R. B.AgarwalN. (2004). Effect of administration of an anaerobic gut fungus isolated from wild blue bull to buffaloes on in-vivo ruminal fermentation and digestion of nutrients. Anim. Feed Sci. Tech.115, 143–157. 10.1016/j.anifeedsci.2004.01.010
128
PengX.GilmoreS. P.O'MalleyM. A. (2016). Microbial communities for bioprocessing: lessons learned from nature. Curr. Opin. Chem. Eng.14, 103–109. 10.1016/j.coche.2016.09.003
129
PhillipsM. W.GordonG. L. (1988). Sugar and polysaccharide fermentation by rumen anaerobic fungi from Australia, Britain and New Zealand. Biosystems.21, 377–383. 10.1016/0303-2647(88)90036-6
130
PicardK. T. (2017). Coastal marine habitats harbor novel early-diverging fungal diversity. Fungal Ecol.25, 1–13. 10.1016/j.funeco.2016.10.006
131
PittaD. W.PinchakW. E.InduguN.VecchiarelliB.SinhaR.FulfordJ. D. (2016). Metagenomic Analysis of the Rumen Microbiome of Steers with Wheat-Induced Frothy Bloat. Front. Microbiol. 7:689. 10.3389/fmicb.2016.00689
132
PopeP. B.MackenzieA. K.GregorI.SmithW.SundsetM. A.McHardyA. C.et al. (2012). Metagenomics of the Svalbard reindeer rumen microbiome reveals abundance of polysaccharide utilization loci. PLoS ONE7:e38571. 10.1371/journal.pone.0038571
133
PoulsenM.SchwabC.JensenB. B.EngbergR. M.SpangA.CanibeN.et al. (2013). Methylotrophic methanogenic Thermoplasmata implicated in reduced methane emissions from bovine rumen. Nat. Commun.4:1428. 10.1038/ncomms2432
134
ProchazkaJ.MrazekJ.ŠtrosováL.FliegerováK.ZábranskáJ.DohányosM. (2012). Enhanced biogas yield from energy crops with rumen anaerobic fungi. Eng. Life Sci.12, 343–351. 10.1002/elsc.201100076
135
PuniyaA. K.SalemA. Z. M.KumarS.DagarS. S.GriffithG. W.PuniyaM.et al. (2015). Role of live microbial feed supplements with reference to anaerobic fungi in ruminant productivity. J. Integr. Agr.14, 550–560. 10.1016/S2095-3119(14)60837-6
136
QiM.WangP.O'TooleN.BarbozaP. S.UngerfeldE.LeighM. B.et al. (2011). Snapshot of the eukaryotic gene expression in muskoxen rumen—a metatranscriptomic approach. PLoS ONE6:e20521. 10.1371/journal.pone.0020521
137
ReymondP.GeourjonC.RouxB.DurandR.FevreM. (1992). Sequence of the phosphoenolpyruvate carboxykinase-encoding cDNA from the rumen anaerobic fungus Neocallimastix frontalis: comparison of the amino acid sequence with animals and yeast. Gene110, 57–63. 10.1016/0378-1119(92)90444-T
138
RezaeianM.BeakesG. W.ParkerD. S. (2004). Distribution and estimation of anaerobic zoosporic fungi along the digestive tracts of sheep. Mycol. Res.108, 1227–1233. 10.1017/S0953756204000929
139
RogerV.GrenetE.JamotJ.BernalierA.FontyG.GouetP. (1992). Degradation of maize stem by two rumen fungal species, Piromyces communis and Caecomyces communis, in pure cultures or in association with cellulolytic bacteria. Reprod. Nutr. Dev.32, 321–329. 10.1051/rnd:19920402
140
RossM. G.RussC.CostelloM.HollingerA.LennonN. J.HegartyR.et al. (2013). Characterizing and measuring bias in sequence data. Genome Biol. 14:R51. 10.1186/gb-2013-14-5-r51
141
SantamariaM.FossoB.ConsiglioA.De CaroG.GrilloG.LicciulliF.et al. (2012). Reference databases for taxonomic assignment in metagenomics. Brief Bioinform.13, 682–695. 10.1093/bib/bbs036
142
SaxenaS.SehgalJ. P.PuniyaA. K.SinghK. (2010). Effect of administration of rumen fungi on production performance of lactating buffaloes, Benef. Microbes1, 183–188. 10.3920/BM2009.0018
143
SchlossP. D.WestcottS. L.RyabinT.HallJ. R.HartmannM.HollisterE. B.et al. (2009). Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol.75, 7537–7541. 10.1128/AEM.01541-09
144
SchochC. L.SeifertK. A.HuhndorfS.RobertV.SpougeJ. L.LevesqueC. A.et al. (2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. PNAS109, 6241–6246. 10.1073/pnas.1117018109
145
SchurchN. J.SchofieldP.GierlinskiM.ColeC.SherstnevA.SinghV.et al. (2016). How many biological replicates are needed in an RNA-seq experiment and which differential expression tool should you use?RNA22, 839–851. 10.1261/rna.053959.115
146
SeibelP. N.MüllerT.DandekarT.SchultzJ.WolfM. (2006). 4SALE a tool for synchronous RNA sequence and secondary structure alignment and editing. BMC Bioinformatics7:498. 10.1186/1471-2105-7-498
147
SeibelP. N.MüllerT.DandekarT.WolfM. (2008). Synchronous visual analysis and editing of RNA sequence and secondary structure alignments using 4SALE. BMC Res. Notes1:91. 10.1186/1756-0500-1-91
148
SekhavatiM. H.MesgaranM. D.NassiriM. R.MohammadabadiT.RezaiiF.Fani MalekiA. (2009). Development and use of quantitative competitive PCR assays for relative quantifying rumen anaerobic fungal populations in both in vitro and in vivo systems. Mycol. Res.113, 1146–1153. 10.1016/j.mycres.2009.07.017
149
ShulaevV. (2006). Metabolomics technology and bioinformatics. Brief. Bioinform.7, 128–139. 10.1093/bib/bbl012
150
SolomonK. V.HaitjemaC. H.HenskeJ. K.GilmoreS. P.Borges-RiveraD.LipzenA.et al. (2016a). Early-branching gut fungi possess a large, comprehensive array of biomass-degrading enzymes. Science351, 1192–1195. 10.1126/science.aad1431
151
SolomonK. V.HenskeJ. K.TheodorouM. K.O'MalleyM. A. (2016b). Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi. Anaerobe38, 39–46. 10.1016/j.anaerobe.2015.11.008
152
SrinivasanK.MurakamiM.NakashimadaY.NishioN. (2001). Efficient production of cellulolytic and xylanolytic enzymes by the rumen anaerobic fungus, Neocallimastix frontalis, in a repeated batch culture. J. Biosci. Bioeng.91, 153–158. 10.1016/S1389-1723(01)80058-X
153
TarazonaS.Garcia-AlcaldeF.DopazoJ.FerrerA.ConesaA. (2011). Differential expression in RNA-seq: a matter of depth. Genome Res.21, 2213–2223. 10.1101/gr.124321.111
154
TheodorouM. K.MennimG.DaviesD. R.ZhuW. Y.TrinciA. P.BrookmanJ. L. (1996). Anaerobic fungi in the digestive tract of mammalian herbivores and their potential for exploitation. Proc. Nutr. Soc.55, 913–926. 10.1079/PNS19960088
155
ThorsenM. S. (1999). Abundance and biomass of the gut-living microorganisms (bacteria, protozoa and fungi) in the irregular sea urchin Echinocardium cordatum (Spatangoida: Echinodermata). Mar. Biol.133, 353–360. 10.1007/s002270050474
156
TrinciA. P.DaviesD. R.GullK.LawrenceM. I.Bonde NielsenB.RickersA.et al. (1994). Anaerobic fungi in herbivorous animals. Mycol. Res.98, 129–152. 10.1016/S0953-7562(09)80178-0
157
TripathiV. K.SehgalJ. P.PuniyaA. K.SinghK. (2007). Effect of administration of anaerobic fungi isolated from cattle and wild blue bull (Boselaphus tragocamelus) on growth rate and fiber utilization in buffalo calves. Arch. Anim. Nutr.61, 416–423. 10.1080/17450390701556759
158
TuckwellD. S.NicholsonM. J.McsweeneyC. S.TheodorouM. K.BrookmanJ. L. (2005). The rapid assignment of ruminal fungi to presumptive genera using ITS1 and ITS2 RNA secondary structures to produce group-specific fingerprints. Microbiology151, 1557–1567. 10.1099/mic.0.27689-0
159
Villas-BôasS. G.MasS.ÅkessonM.SmedsgaardJ.NielsenJ. (2005). Mass spectrometry in metabolome analysis. Mass. Spectrom. Rev.24, 613–646. 10.1002/mas.20032
160
WangL.HatemA.CatalyurekU. V.MorrisonM.YuZ. (2013). Metagenomic Insights into the Carbohydrate-Active Enzymes Carried by the Microorganisms Adhering to Solid Digesta in the Rumen of Cows. PLoS ONE8:e78507. 10.1371/journal.pone.0078507
161
WangP.QiM.BarbozaP.LeighM. B.UngerfeldE.SelingerL. B.et al. (2011). Isolation of high-quality total RNA from rumen anaerobic bacteria and fungi, and subsequent detection of glycoside hydrolases. Can. J. Microbiol.57, 590–598. 10.1139/w11-048
162
WangX.LiuX.GroenewaldJ. Z. (2017). Phylogeny of anaerobic fungi (phylum Neocallimastigomycota), with contributions from yak in China. Anton. Van. Lee.110, 87–103. 10.1007/s10482-016-0779-1
163
WeiY. Q.YangH. J.LuanY.LongR. J.WuY. J.WangZ. Y. (2016a). Isolation, identification and fibrolytic characteristics of rumen fungi grown with indigenous methanogen from yaks (Bos grunniens) grazing on the Qinghai-Tibetan Plateau. J. Appl. Microbiol.120, 571–587. 10.1111/jam.13035
164
WeiY.-Q.LongR.-J.YangH.YangH.-J.ShenX.-H.ShiR.-F.et al. (2016b). Fiber degradation potential of natural co-cultures of Neocallimastix frontalis and Methanobrevibacter ruminantium isolated from yaks (Bos grunniens) grazing on the Qinghai Tibetan Plateau. Anaerobe.39, 158–164. 10.1016/j.anaerobe.2016.03.005
165
WhiteT. J.BrunsT.LeeS. J. W. T.TaylorJ. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols18, 315–322.
166
WidyastutiY.NewboldC.StewartC.OrskovE. (1995). Interactions between rumen anaerobic fungi and ciliate protozoa in the degradation of rice straw cell walls. Lett. Appl. Microbiol.20, 61–64. 10.1111/j.1472-765X.1995.tb00408.x
167
WilliamsA.WithersS.JoblinK. (1991). Xylanolysis by cocultures of the rumen fungus Neocallimastix frontalis and ruminal bacteria. Lett. Appl. Microbiol.12, 232–235. 10.1111/j.1472-765X.1991.tb00547.x
168
WilliamsA.WithersS.NaylorG.JoblinK. (1994). Effect of heterotrophic ruminal bacteria on xylan metabolism by the anaerobic fungus Piromyces communis. Lett. Appl. Microbiol.19, 105–109. 10.1111/j.1472-765X.1994.tb00917.x
169
WolfM.RuderischB.DandekarT.SchultzJ.MüllerT. (2008). ProfDistS: (profile-) distance based phylogeny on sequence–structure alignments. Bioinformatics24, 2401–2402. 10.1093/bioinformatics/btn453
170
WurzbacherC.WarthmannN.BourneE.AttermeyerK.AllgaierM.PowellJ. R.et al. (2016). High habitat- specificity in fungal communities of an oligo-mesotrophic, temperate lake. MycoKeys16, 17–44. 10.3897/mycokeys.16.9646
171
XueG. P.OrpinC. G.GobiusK. S.AylwardJ. H.SimpsonG. D. (1992). Cloning and expression of multiple cellulase cDNAs from the anaerobic rumen fungus Neocallimastix partriciarum in Escherichia coli. J. Gen. Microbiol.138, 1413–1420. 10.1099/00221287-138-7-1413
172
XueG.DenmanS. E.GlassopD.JohnsonJ. S.DierensL. M.GobiusK. S.et al. (1995). Modification of a xylanase cDNA isolated from an anaerobic fungus Neocallimastix patriciarum for high-level expression in Escherichia coli. J. Biotechnol.38, 269–277. 10.1016/0168-1656(94)00133-W
173
YoussefN. H.CougerM. B.StruchtemeyerC. G.LiggenstofferA. S.PradeR. A.NajarF. Z.et al. (2013). The genome of the anaerobic fungus Orpinomyces sp. strain C1A reveals the unique evolutionary history of a remarkable plant biomass degrader. Appl. Environ. Microbiol.79, 4620–4634. 10.1128/AEM.00821-13
Summary
Keywords
anaerobic fungi, Neocallimastigomycota, rumen, phylogeny, genomics, (meta) transcriptomics, proteomics, metabolomics
Citation
Edwards JE, Forster RJ, Callaghan TM, Dollhofer V, Dagar SS, Cheng Y, Chang J, Kittelmann S, Fliegerova K, Puniya AK, Henske JK, Gilmore SP, O'Malley MA, Griffith GW and Smidt H (2017) PCR and Omics Based Techniques to Study the Diversity, Ecology and Biology of Anaerobic Fungi: Insights, Challenges and Opportunities. Front. Microbiol. 8:1657. doi: 10.3389/fmicb.2017.01657
Received
07 June 2017
Accepted
15 August 2017
Published
25 September 2017
Volume
8 - 2017
Edited by
Itzhak Mizrahi, Ben-Gurion University of the Negev, Beersheba, Israel
Reviewed by
Timothy John Snelling, University of Aberdeen, United Kingdom; Josh C. McCann, University of Illinois at Urbana–Champaign, United States
Updates

Check for updates
Copyright
© 2017 Edwards, Forster, Callaghan, Dollhofer, Dagar, Cheng, Chang, Kittelmann, Fliegerova, Puniya, Henske, Gilmore, O'Malley, Griffith and Smidt.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Joan E. Edwards joan.edwards@wur.nl
This article was submitted to Microbial Symbioses, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
