ORIGINAL RESEARCH article

Front. Microbiol., 20 August 2018

Sec. Food Microbiology

Volume 9 - 2018 | https://doi.org/10.3389/fmicb.2018.01876

Association Between agr Type, Virulence Factors, Biofilm Formation and Antibiotic Resistance of Staphylococcus aureus Isolates From Pork Production

  • 1. School of Food Science and Engineering, South China University of Technology, Guangzhou, China

  • 2. Institute of Genomics, Huaqiao University, Xiamen, China

  • 3. State Key Laboratory of Food Safely Technology for Meat Products, Xiamen, China

  • 4. Institute of Animal Health, Guangdong Academy of Agricultural Sciences, Guangzhou, China

Abstract

Livestock-associated Staphylococcus aureus colonization and/or infections exist in pigs and people in frequent contact with pigs. In this study, a total of 130 S. aureus isolates obtained from different stages of pork production were subjected to antimicrobial susceptibility, biofilm formation, as well as PCR screening to identify virulence genes, and the accessory gene regulator alleles (agr). Among all 130 S. aureus isolates, 109 (83.8%, 109/130) isolates were positive for agr. All swine farms isolates belonged to agr IV, whereas S. aureus isolated from slaughterhouse and retail indicated diverse agr types. All isolates exhibited biofilm formation ability, and raw meat isolates (belonging to agr I) exhibited a greater ability to form strong biofilms than swine farms isolates (belonging to agr IV). agr-positive isolates were associated with more virulence genes than agr-negative isolates. Most biofilm-producing isolates were positive for microbial surface component recognizing adhesive matrix molecule (MSCRAMM), capsule type and ica group genes. The results illustrate a significant association between the prevalence rate of MSCRAMM, capsule type and ica group genes among isolates producing weak, moderate and strong biofilms. The high prevalence of resistance to ciprofloxacin, gentamicin, tetracycline, clarithromycin, clindamycin, and trimethoprim-sulfamethoxazole were mainly observed in moderate and weak biofilm producers. Our findings indicate that S. aureus isolates from pork production displayed diverse molecular ecology.

Introduction

Staphylococcus aureus is an important zoonotic pathogen that is responsible for a variety of infectious diseases characterized by septicemia and sepsis (; Song et al., 2015). China is one of the world’s largest pork producers with more than 470 million pigs, accounting for ∼50% of the total numbers in the world (). Consecutively, several reports suggested transmission between pigs and humans causing livestock-associated S. aureus (LA-SA) colonization in 23–45% of pig-farmers (Voss et al., 2005; ; Smith et al., 2008) and 4.6% of pig-care veterinarians (Wulf et al., 2006). The “One Health” concept recognizes that human health or livestock or wildlife health are interconnected and bound to the animal-human-ecosystems in which they (co)exist. Occupational exposure to swine has been associated with increased Staphylococcus aureus carriage, and increased risk of colonization and infections of different hosts (Witte et al., 2007; ; Price et al., 2012; ; ; ). The risk of zoonotic transmission to humans demands our deep understanding of S. aureus contamination and ecology in the swine production.

The rapid development of resistance to multiple antimicrobial agents increases the difficulty treating S. aureus infections and biofilm production facilitate this organism to survive in the presence of antibiotics (; ). Several studies have demonstrated that low doses of certain antibiotics could induce biofilm formation, indicating that biofilm regulation might be involved in the global response to external stresses, including antibiotics (; ). Previous studies regarding quantitative correlation between biofilm formation and antibiotics resistance have yielded different results. For example, Neopane et al. (2018) concluded that the biofilm-positive strains have a higher tendency to exhibit multidrug resistance and methicillin resistance compared to biofilm-negative strains, while indicated that there was no significant difference in the percentage of multi-drug-resistance (MDR) among biofilm producers and non-biofilm formers for both medical and non-medical personnel.

Staphylococcus aureus produces a wide variety of protein toxins, such as exfoliative toxins, Panton-Valentine leukocidin, hemolysins, enterotoxins, and toxic shock syndrome toxin. Among the large array of S. aureus virulence factors the MSCRAMMs (microbial surface component recognizing adhesive matrix molecules) includes different adhesins, which are essential for initial stages of infection (). MSCRAMMs, which includes fibronectin binding proteins (FnbA and FnbB), fibrinogen binding proteins (ClfA, ClfB and Efb), capsule proteins (Capsule type 5 and 8) and collagen binding proteins (Cna), can bind to a variety of mammalian extracellular proteins and abiotic surfaces (). Furthermore, the formation of a highly organized multicellular biofilm is related to the polysaccharide intercellular adhesin (PIA) production, which is controlled by the ica operon (). Therefore, the numbers and combinations of toxin genes may contribute to the pathogenicity of S. aureus.

While previous studies have documented the prevalence of S. aureus isolates in bovine mastitis (; Snel et al., 2015; ; ; ), there is a lack of data regarding the prevalence and characterization of S. aureus in pork production. A thorough understanding of the correlation between the observed polymorphism in genotype and virulence, and the diversity in production practices is important for targeted mitigation. In this study, an extensive study was conducted involving systematic sampling of three commercial swine farms, a contracted slaughterhouse for the designated farms, and a retail market in Xiamen, China to profile S. aureus isolates along the production, processing and retail chain. The data enabled tracking of the spread of S. aureus from pork production and a better understanding of the evolution of S. aureus.

Materials and Methods

Bacterial Strains and Antibiotic Susceptibility

From September – December 2014, three commercial swine farms with > 5000 pigs, one large slaughterhouse and several terminal markets were selected from Xiamen City, People’s Republic of China, and 501 samples were collected from these places for S. aureus isolation. Pigs were born and raised in these three commercial swine farms with distance for more than 25 km from each other and then were sent to the slaughterhouse. These three swine farms and the slaughterhouse were vertically integrated pork processing plant, meaning pigs originated from these three swine farms contracted to sell hogs exclusively to the slaughterhouse. However, terminal samples from the markets did not totally originate from the slaughterhouse tested in the present study.

Briefly, a total of 501 non-duplicate samples were collected from the pork industry, including three commercial swine farms (sty door and soil, n = 71; nasal swabs, n = 97), one slaughterhouse (pork, n = 173), and terminal markets (pork, n = 160). Isolation and identification of S. aureus were performed according to China’s National Technical Standard GB4789.10-2010 and the special gene nuc was targeted by PCR for identifying S. aureus (). Contamination with S. aureus was detected in 26.0% (130/501) of the total samples, and the prevalence of S. aureus was highest in the slaughterhouse (35.8%, 62/173) followed by the market (24.4%, 39/160) and the farm (17.3%, 29/168).

These isolates were assessed for antimicrobial susceptibility by the Kirby-Bauer disk diffusion method described by the Clinical and Laboratory Standards Institute (). The antibiotic disks used (Hangzhou Microbial Reagent Co., Ltd., Hangzhou) included ciprofloxacin (5 μg), penicillin (10 μg), gentamicin (10 μg), tetracycline (30 μg), clarithromycin (15 μg), clindamycin (2 μg), chloramphenicol (30 μg), sulfamethoxazole-trimethoprim (25 μg), nitrofurantoin (30 μg), rifampin (5 μg), cephalothin (30 μg), minocycline (30 μg), cefoxitin (30 μg) and oxacillin (1 μg).

agr Genotyping

Bacterial genomic DNA template was extracted from the isolates by a commercial DNA extraction kit (Biomed, Beijing, China). The agr types (I–IV) were determined by a multiplex PCR assay as described by . In brief, multiplex PCR was performed with the following primers: Pan (5′-ATG CAC ATG GTG CAC ATG C-3′), agr1 (5′-GTC ACA AGT ACT ATA AGC TGC GAT-3′), agr2 (5′-TAT TAC TAA TTG AAA AGT GGC CAT AGC-3′), agr3 (5′-GTA ATG TAA TAG CTT GTA TAA TAA TAC CCA G-3′) and agr4 (5′-CGA TAA TGC CGT AAT ACC CG-3′). These primers yield a PCR product of 441, 575, 323, or 659 bp corresponding to agr group I, II, III, and IV, respectively. Each assay contained 2 μL of prepared DNA template, 2.5 μL of 10× Easy Taq Buffer [Takara Biomedical Technology (Beijing) Co., Ltd, China], 1 μL of 10 mM deoxynucleotide triphosphate [Takara Biomedical Technology (Beijing) Co., Ltd, China], 1 μL of upstream and downstream primers (10 μM), and 0.125 μL of DNA polymerase (5 U/μL) [Takara Biomedical Technology (Beijing) Co., Ltd, China], and the final system volume was adjusted to 25 μL with sterile ultrapure water. The PCR conditions were as follows: 1 cycle at 94°C for 5 min; 26 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and finally 1 cycle at 72°C for 10 min. All PCR products were analyzed by electrophoresis on a 1.5% (w/v) agarose gel.

Identification of Virulence Determinants

The nucleotide sequences of all PCR primers used in this study and their respective amplified products and specific Tm (°C) are listed in Table 1. All the oligonucleotide primers were synthesized by Sangon Biotech (Shanghai, China). Each assay contained 1 μL of prepared DNA template, 2.5 μL of 10× Easy Taq Buffer [Takara Biomedical Technology (Beijing) Co., Ltd, China], 1 μL of 10 mM deoxynucleotide triphosphate [Takara Biomedical Technology (Beijing) Co., Ltd, China], 1 μL of upstream and downstream primers (10 μM), and 0.125 μL of DNA polymerase (5 U/μL) [Takara Biomedical Technology (Beijing) Co., Ltd, China], and the final system volume was adjusted to 25 μL with sterile ultrapure water. The PCR conditions were as follows: an initial denaturation at 95°C for 5 min; 30 cycles of 95°C for 30 s, specific Tm for 30 s, and 72°C for 40–90 s depending on the PCR product length; and a final extension at 72°C for 10 min. Sequencing of the extracted PCR product was performed by Beijing Genomics Institute (Shenzhen, China) and the data were analyzed with the GenBank database using the BLAST algorithm at the National Center for Biotechnology Information web site1.

Table 1

Target genePrimer namePutative function of encoded proteinPrimer sequence (5′—3′)Product size (bp)Tm (°C)Reference
clfAclfA-FEncoding Clumping factor, ClfAAAAACACGCAATTCGGAAAA85553Ote et al., 2011
clfA-RGCAGTTGAAGTTACACCATTTAAGT
clfBclfB-FEncoding Clumping factor, ClfBTGTCGAATAAGCAGAATAAG50549Ote et al., 2011
clfB-RGGTGATGATTGTGGTAAATC
bbpbbp-FEncoding bone sialoprotein-binding protein, BbpAACTACATCTAGTACTCAACAACAG57555Tristan et al., 2003
bbp-RATGTGCTTGAATAACACCATCATCT
ebpSebpS-FEncoding cell surface elastin-binding proteinCATCCAGAACCAATCGAAGAC18655Tristan et al., 2003
ebpS-RCTTAACAGTTACATCATCATGTTTATCTTTG
cnacna-FEncoding collagen-binding proteinGTCAAGCAGTTATTAACACCAGAC42355Tristan et al., 2003
cna-RAATCAGTAATTGCACTTTGTCCACTG
enoeno-FEncoding laminin binding proteinACGTGCAGCAGCTGACT30255Tristan et al., 2003
eno-RCAACAGCATYCTTCAGTACCTTC
fibfib-FEncoding fibrinogen binding protein, FibCTACAACTACAATTGCCGTCAACAG40455Tristan et al., 2003
fib-RGCTCTTGTAAGACCATTTTCTTCAC
fnbAfnbA-FEncoding fibronectin-binding protein AGTGAAGTTTTAGAAGGTGGAAAGATTAG64355Tristan et al., 2003
fnbA-RGCTCTTGTAAGACCATTTTTCTTCAC
fnbBfnbB-FEncoding fibronectin-binding protein BGTAACAGCTAATGGTCGAATTGATACT52455Tristan et al., 2003
fnbB-RCAAGTTCGATAGGAGTACTATGTTC
cap5cap5-FEncoding CP5 synthesis enzymeATGAGGATAGCGATTGAAAA51849Ote et al., 2011
cap5-RCGCTTCTTAATCACTTTTGC
cap8cap8-FEncoding CP8 synthesis enzymeATCGAAGAACATATCCAAGG83446Ote et al., 2011
cap8-RTTCATCACCAATACCTTTTA
icaAicaA-FEncoding intercellular adhesion protein ACTTGCTGGCGCAGTCAATAC17855Pereyra et al., 2016
icaA-RCCAACATCCAACACATGGCA
icaCicaC-FEncoding intercellular adhesion protein CCTTGGGTATTTGCACGCATT20955Pereyra et al., 2016
icaC-RGCAATATCATGCCGACACCT
icaDicaD-FEncoding intercellular adhesion protein DCGCTATATCGTGTGTCTTTTGGA16455Pereyra et al., 2016
icaD-RTCGCGAAAATGCCCATAGTT
bapbap-FEncoding biofilm-associated protein, BapCCCTATATCGAAGGTGTAGAATTGCAC97160Pereyra et al., 2016
bap-RGCTGTTGAAGTTAATACTGTACCTGC
pvlpvl-FEncoding Panton-Valentine leukocidinGTCGTTAGGAATAATCACTCC42348Ote et al., 2011
pvl-RCCTGTTGATGGACCACTATTAA
tsttsst-FEncoding toxic shock syndrome toxin-1TTTTTTATCGTAAGCCCTTTGTTGC55051Ote et al., 2011
tsst-RCACCCGTTTTATCGCTTGAA
hlahla-FEncoding alpha-haemolysin precursorTGCCGCAGATTCTGATATTAA84551Ote et al., 2011
hla-RTTTCTGAAGAACGATCTGTCCA
hlbhlb-FEncoding beta-haemolysin precursorGCGGTTGTGGATTCGATAAT52450Ote et al., 2011
hlb-RGGCTTTGATTGGGTAATGATC
hldhld-FEncoding delta-haemolysin precursorGGGATGGCTTAATAACTCATACTT23648Ote et al., 2011
hld-RCAGAGATGTGATGGAAAATAGTTGA
etaeta-FEncoding exfoliative toxin ATTGTAAAAGGACAAACAAGTGC54449.4Ote et al., 2011
eta-RTTCCCAATACCAACACCA
etbetb-FEncoding exfoliative toxin BTTACAAGCAAAAGAATACAGCG64150Ote et al., 2011
etb-RGGAAGATTATGTTGTCCGCC

Target genes, putative function of encoded protein, primer sequence, and PCR conditions.

Biofilm Formation

Quantification of biofilm formation was performed by spectrophotometry in microplates (Nest Biotechnology Co., Ltd. Wuxi, China) using crystal violet staining as previously described (Pereyra et al., 2016). Briefly, 20 μL of bacterial log phase culture was added to 200 μL of fresh 1% glucose BHI in 96-well flat-bottom microtiter plates. S. aureus ATCC25923 (biofilm-forming) and S. epidermidis ATCC12228 (not biofilm-forming) were used as positive and negative controls, respectively. BHI without bacteria served as the blank. The plates were incubated at 37°C for 24, 48, and 72 h under aerobic conditions. After each sampling time, wells were washed three times with 300 μL of sterile phosphate-buffered saline (PBS; pH 7.2) and drained by inversion. Subsequently, 200 μL of methanol was added to each well and the plates were dried for 15 min. The adherent cells were stained with 150 μL of 0.1% crystal violet solution for 15 min and then washed twice with sterile water. Bound crystal violet was dissolved by treatment with 150 μL of 95% ethanol for 10 min, and OD570 was measured for the stained bacteria and control wells. The experiment was performed in triplicate. An OD570 value of 0.3 was taken as the cutoff point to differentiate between biofilm producers and non-biofilm-producer strains [cut-off value (ODc) = average OD of negative control + 3× standard deviation (SD) of negative control] (Pereyra et al., 2016). The quantitative classification of biofilm production based on ODc and average OD values was carried out, resulting in four categories of strains: strong biofilm producers (OD > 4 × ODc), moderate biofilm producers (4 × ODc > OD > 2 × ODc), weak biofilm producers (2 × ODc > OD > ODc), and no biofilm producers (OD < ODc) (Pereyra et al., 2016).

Growth Rate Analysis

The growth of 12 strong, 12 moderate and 12 weak biofilm formers were measured according to Qi et al. (2016). Briefly, isolates were cultured in BHI agar for 18–24 h and adjusted to 0.5 McFarland units with 0.85% NaCl medium, and diluted 1: 20 in BHI medium. The cultures were incubated for 24 h at 37°C with shaking at 200 rpm and the bacterial growth was monitored by measuring the OD600 values of the culture. All experiments include three independent replicates.

Statistical Analysis

Statistical analysis was performed with SPSS v.22.0 (SPSS Inc., Chicago, IL, United States). Differences groups were compared using the chi-squared test and a p-value of <0.05 was deemed to be significant. Spearman’s rank correlation test was used for comparison of biofilm formation ability and multi-drug-resistance (MDR).

Results

agr Genotyping

By multiplex PCR, the agr types were successfully identified in 109 isolates, and 21 isolates were non-typeable for agr locus. As shown in Table 2, the agr I was most prevalent (39.2%; 51/130), followed by agr IV (32.3%; 42/130), agr II (9.2%; 12/130) and agr III (3.1%; 4/130). All swine farms isolates belonged to agr IV, whereas S. aureus isolated from slaughterhouse and retail indicated diverse agr types.

Table 2

agr groupNumber of S. aureus isolates from various samplesa
Total
Swine farmsSlaughterhouseTerminal markets
I0 (0)15 (24.2%)36 (92.3%)51 (39.2%)
II0 (0)12 (19.4%)0 (0)12 (9.2%)
III0 (0)4 (6.5%)0 (0)4 (3.1%)
IV29 (100%)11 (17.7%)2 (5.1%)42 (32.3%)
agr (negative)0 (0)20 (32.3)1 (2.6%)21 (16.2%)
Total296239130

The agr types of 130 S. aureus isolates from different stages of pork production.

aThe number in parentheses represents the percentage of isolates in the corresponding genotype.

Prevalence and Distribution of Virulence Genes

As illustrated in Figure 1, nearly all isolates harbored the hla (95.4%), hlb (100%) and hld (98.5%) genes, encoding alpha-, beta-, and delta-hemolysins respectively. No isolate harbored bap, pvl, or tsst. It was found that the bbp, cna and cap8 genes were detected only in isolates obtained from slaughterhouse and terminal markets. As shown in Table 3, the most frequent numbers of toxin genes per isolate were 11∼14 in all S. aureus isolates (Table 3). Notably, one isolate harbored 16 toxin genes and 5 isolates harbored 15 toxin genes, which were obtained from slaughterhouse (Table 3).

FIGURE 1

Table 3

Number of the toxin gene per isolate (n)Number of S. aureus isolatesa
Total number of isolates (130)b
Swine farms (29)Slaughter house (62)Terminal markets (39)
160 (0)1 (1.6%)0 (0)1 (0.8%)
150 (0)5 (8.1%)0 (0)5 (3.8%)
141 (3.4%)13 (21.0%)5 (12.8%)19 (14.6%)
1314 (48.3%)9 (14.5%)10 (25.6%)33 (25.4%)
1213 (44.8%)18 (29.0%)14 (35.9%)45 (34.6%)
111 (3.4%)5 (8.1%)6 (15.4%)12 (9.2%)
100 (0)3 (4.8%)3 (7.7%)6 (4.6%)
90 (0)2 (3.2%)0 (0)2 (1.5%)
80 (0)2 (3.2%)0 (0)2 (1.5%)
70 (0)2 (3.2%)0 (0)2 (1.5%)
60 (0)2 (3.2%)1 (2.6%)3 (2.3%)

The toxin genes number of S. aureus isolates from different stages of pork production.

aThe number in parentheses represents the percentage of isolates with the corresponding number of toxin genes for all S. aureus isolates of the same part in pork production. bThe number in parentheses represents the percentage of isolates with the corresponding number of toxin genes for all S. aureus isolates.

The average toxin gene number was also examined based on agr genotyping, and a higher average number of toxin genes was found in the agr-positive isolates compared to agr-negative isolates. The agr-positive isolates were associated with a high average number of toxin genes (averaging 13.2 for agr II, 12.6 for agr I, 12.6 for agr IV and 12.0 for agr III), whereas the agr-negative isolates were associated with a lower average number of toxin genes (averaging 9.9) (Figure 2). The distribution of virulence genes differed among the isolates according to the agr genotyping. Among the MSCRAMMs genes, the prevalence of 3 genes was significantly different between the agr-positive and agr-negative isolates: clfA (p < 0.01), clfB (p < 0.01) and fnbA (p < 0.05). The capsule multiple type (carriage of both capsule type 5 and 8) (p < 0.01) and icaC gene (p < 0.01) were positively associated with agr-positive isolates (Figure 3).

FIGURE 2

FIGURE 3

Quantification of Biofilm Biomass and Growth Rate Analysis

Biofilm formation was analyzed, and all the isolates were able to form biofilm. The biomass of biofilms formed by most isolates increased continuously during incubation for 72 h at 37°C (Table 4). Biofilm strong producers are mainly in slaughterhouse and biofilm biomass increase with time. No significant difference in the growth rates of the strong, moderate and weak biofilm formers was observed, indicating that the difference in biofilm formation was not due to the growth rate.

Table 4

Number of S. aureus biofilm phenotypea,b
24 h
48 h
72 h
Strain sourceNo. of strainsWeakModerateStrongWeakModerateStrongWeakModerateStrong
Swine farms2962121316227
(20.7%)(72.4%)(6.9%)(44.8%)(55.2%)(6.9%)(93.1%)
Slaughterhouse625273011348260
(8.1%)(43.6%)(48.4%)(1.6%)(21.0%)(77.4%)(3.2%)(96.8%)
Terminal markets3978241434435
(18.0%)(20.5%)(61.5%)(2.6%)(10.3%)(87.2%)(10.26%)(89.7%)
Total130185656230988122
(%)(13.8%)(43.1%)(43.1%)(1.5%)(23.1%)(75.4%)(6.2%)(93.8%)

Biofilm phenotype of 130 S. aureus isolates at different time points.

aThe number in parentheses represents the percentage of isolates with the corresponding number of biofilm phenotype for all S. aureus isolates of the same part in pork production. bBiofilm-forming ability was measured after 24, 48, and 72 h at 37°C in terms of biofilm biomass by crystal violet staining. The results are presented by optical density (OD) determination of three independent repeats and compared to ATCC 25923 (biofilm-positive) and ATCC12228 (biofilm-negative).

Correlation Between Virulence Genes and Antibiotic Resistance in Biofilm Producing S. aureus

The relationship between prevalence of biofilm-associated genes and biofilm formation ability (incubation for 24 h at 37°C) of S. aureus isolates was further analyzed (Figures 4, 5). Considering the studied gene status, 19 different gene patterns were observed (Table 5). The most prevalent gene pattern was clfA-clfB-ebpS-eno-fib-cap5-icaA-icaC-icaD which was identified in 13 (10.0%) of 130 isolates. However, there was only one strong biofilm producer, nine moderate biofilm producers and three weak biofilm producers in this genes pattern. Conversely, among the genes patterns of clfA-clfB-ebpS-eno-fib-fnbB-cap5-cap8-icaA-icaC-icaD (3.8%,5/130), clfB-eno-fib-fnbB-cap5-cap8-icaA-icaD (1.5%, 2/130), clfB-bbp-eno-fib-cap5-cap8-icaA-icaC-icaD (1.5%, 2/130), clfA-clfB-eno-fib-fnbB-cap5-cap8-icaA-icaD (1.5%, 2/130), and clfB-eno-fib-cap5-cap8-icaA-icaC-icaD (1.5%, 2/130), all isolates showed strong biofilm formation ability (Table 5). A comparison between the strong, moderate, and weak biofilm producers in the isolates showed a significant difference in the prevalence of virulence genes among these isolates.

FIGURE 4

FIGURE 5

Table 5

Biofilm related genes patternsNumber of S. aureus biofilm phenotypea
Total
StrongModerateWeak
clfA-clfB-ebpS-eno-fib-cap5-icaA-icaC-icaD19313
clfA-clfB-ebpS-eno-fib-fnbA-cap5-icaA-icaC-icaD1539
clfA-clfB-ebpS-eno-fib-fnbB-cap5-icaA-icaC-icaD2507
clfA-clfB-ebpS-eno-fib-fnbB-cap5-cap8-icaA-icaC-icaD5005
clfA-clfB-eno-fib-fnbB-cap5-cap8-icaA-icaC-icaD1315
clfA-clfB-ebpS-cna-eno-fib-cap5-cap8-icaA-icaC-icaD2204
clfB-bbp-eno-fib-fnbB-cap8-icaA-icaC-icaD2013
clfB-eno-fib-fnbB-cap5-cap8-icaA-icaD2002
clfB-bbp-eno-fib-cap5-cap8-icaA-icaC-icaD2002
clfA-clfB-eno-fib-fnbB-cap5-cap8-icaA-icaD2002
clfB-eno-fib-cap5-cap8-icaA-icaC-icaD2002
clfA-clfB-ebpS-eno-fib-cap5-cap8-icaA-icaC-icaD1102
clfA-clfB-ebpS-fnbB-cap5-cap8-icaA-icaC-icaD1012
clfA-clfB-ebpS-cna-eno-fib-fnbB-cap5-cap8-icaA-icaC-icaD0202
clfA-clfB-ebpS-eno-fib-fnbA-cap5-icaC-icaD0202
clfA-clfB-ebpS-fib-fnbB-cap5-cap8-icaA-icaC-icaD0202
clfA-clfB-ebpS-eno-fib-cap8-icaA-icaC-icaD0202
clfB-eno-fib-fnbB-cap5-cap8-icaA-icaC-icaD0112
clfA-clfB-ebpS-fib-cap8-icaA-icaC-icaD0112

The prevalence of biofilm related genes pattern and their associations with biofilm production in 130 S. aureus from different stages of pork production.

aBiofilm phenotype was measured after 24 h at 37°C.

To determine whether biofilm formation was correlated with resistance to any particular antibiotic(s), we compared the biofilm forming capacities (incubation for 24 h at 37°C) among isolates with different resistance profiles for the 14 antibiotics (Table 6). Resistance to ciprofloxacin, gentamicin, tetracycline, clarithromycin, clindamycin and trimethoprim-sulfamethoxazole were significantly higher in moderate biofilm producers and weak biofilm producers than in strong biofilm producers (Table 6). Notably, resistance to nitrofurantoin was only found in strong biofilm producers (7.1%, 4/56) and moderate biofilm producers (1.8%, 1/56) (Table 6). Resistance to penicillin, cefoxitin and chloramphenicol showed no significant difference among strong biofilm producers, moderate biofilm producers and weak biofilm producers (Table 6). Regarding multidrug resistance, no significant association to strong, moderate or weak biofilm producers was observed (Table 7).

Table 6

Antibiotic categoryAntibiotic agentPercentage of antibiotic-resistant strains in different biofilm phenotype
Strong biofilm producers (56) aModerate biofilm producers (56)aWeak biofilm producers (18)a
β-lactamasePenicillin85.7% (48/56)98.2% (55/56)94.4% (17/18)
Oxacillin17.9% (10/56)1.8% (1/56)11.1% (2/18)
Cefoxitin19.6% (11/56)10.7% (6/56)27.8% (5/18)
Cephalothin8.9% (5/56)1.8% (1/56)11.1% (2/18)
FluoroquinolonesCiprofloxacin17.9% (10/56)53.6% (30/56)66.7% (12/18)
AminoglycosidesGentamicin14.3% (8/56)35.7% (20/56)55.6% (10/18)
TetracyclinesTetracycline46.4% (26/56)58.9% (33/56)83.3% (15/18)
Minocycline14.3% (8/56)016.7% (3/18)
MacrolidesClarithromycin32.1% (18/56)60.7% (34/56)72.2% (13/18)
LincomycinsClindamycin30.4% (17/56)60.7% (34/56)83.3% (15/18)
ChloramphenicolsChloramphenicol28.6% (16/56)14.3% (8/56)38.9% (7/18)
SulfonamidesTrimethoprim-sulfamethoxazole21.4% (12/56)53.6% (30/56)66.7% (12/18)
NitrofuransNitrofurantoin7.1% (4/56)1.8% (1/56)0
RifamycinsRifampicin17.9% (10/56)1.8 % (1/56)27.8% (5/18)

Biofilm formation and antibiotic resistance pattern of 130 S. aureus isolates from different stages of pork production.

aThe number in parentheses represents the corresponding number of biofilm phenotype for S. aureus isolates of antibiotic resistance. Biofilm phenotype was measured after 24 h at 37°C, and the number of strong biofilm producers, moderate biofilm producers and weak biofilm producers were 56, 56 and 18, respectively.

Table 7

Number of antibiotic categoryNumber of S. aureus biofilm phenotypea
Total number of isolates
StrongModerateWeak
91 (5.6%)1 (0.8%)
86 (10.7%)4 (7.1%)2 (11.1%)12 (9.2%)
76 (10.7%)16 (28.6%)6 (33.3%)28 (21.5%)
63 (5.4%)9 (16.1%)4 (22.2%)16 (12.3%)
51 (1.8%)1 (1.8%)2 (11.1%)4 (3.1%)
41 (1.8%)3 (5.4%)1 (5.6%)5 (3.8%)
33 (5.4%)1 (1.8%)4 (3.1%)
215 (26.8%)7 (12.5%)022 (16.9%)
113 (23.2%)14 (25.0%)1 (5.6%)28 (21.5%)
08 (14.3%)1 (1.8%)1 (5.6%)10 (7.7%)
Total56 (43.1%)56 (43.1%)18 (13.8%)130 (100%)

Occurrence of multidrug resistant pattern and their associations with biofilm phenotype in 130 S. aureus from different stages of pork production.

aBiofilm phenotype was measured after 24 h at 37°C.

Discussion

The agr (accessory gene regulator) system is a peptide quorum-sensing system present in all the Staphylococci and a dominant regulator of pathogenesis and biofilm development in S. aureus (; Paharik and Horswill, 2016). All the swine farms isolates were agr type IV, whereas the slaughterhouse and terminal markets isolates indicated diverse agr types. In addition, isolates belonging to agr-positive group had a higher number of toxin genes than those belonging to agr-negative group (p < 0.05), suggesting that agr profiles may be associated with the virulence potential of S. aureus, which is consistent with a previous finding (). Raw meat isolates (belonging to agr I) exhibited a great ability to form strong biofilms than swine farms isolates (belonging to agr IV). Previous studies have shown that biofilm formation in S. aureus isolated from bovine mastitis with agr I is higher than those with other agr types (; ; ).

The prevalence of virulence genes involved in biofilm formation and staphylococcal toxin genes were investigated. Most biofilm-producing isolates were positive for MSCRAMM, capsule type and ica group genes. The data show a significant association between the prevalence rate of MSCRAMM, capsule type and ica group genes among isolates producing weak, moderate and strong biofilms. Approximately 92.3% (120/130) of all isolates harbored icaA and icaD genes simultaneously, which were similar to those from previous studies (Szweda et al., 2012; Pereyra et al., 2016). Moreover, although both pvl and tst genes were not detected in the tested isolates, hemolysins and enterotoxin-producing genes (data not shown) were found. This suggests that these isolates exhibit pathogenic potential.

In the present study, all S. aureus isolates were biofilm producers. Biofilm formation is influenced by numerous factors, such as sugar content and concentration (glucose versus lactose), proteolytic enzymes and biofilm-associated genes, etc. (). In this study, biofilm production was higher for raw meat isolates compared to swine farms isolates. There was a difference in the prevalence of several genes involved in adhesion and biofilm production between raw meat and swine farms isolates. However, further studies are required to quantify the expression of relevant genes. Moreover, biofilm biomass increased proportionally as biofilms aged, which is accordance with previous findings (). High variability in biofilm biomass was found among isolates throughout the time course of biofilm formation (24 – 72 h), which is in accordance with previous findings (Marino et al., 2011; Va′zquez-Sa′nchez et al., 2014). Moreover, our study demonstrated the potential association between antibiotic resistance and biofilm-forming ability of S. aureus. Apart from resistance to penicillin, the high prevalence of resistance to ciprofloxacin, gentamicin, tetracycline, clarithromycin, clindamycin and trimethoprim-sulfamethoxazole were mainly observed in moderate and weak biofilm producers. Together, Qi et al. (2016) reported that for Acinetobacter baumannii, there was a statistically negative correlation between antibiotic resistance and biofilm forming capacity, suggesting that biofilm-forming strains are less dependent on antibiotic resistance than no biofilm-forming strains for survival. Previous studies have demonstrated that biofilm resistance to antimicrobials is multifaceted, including reduced penetration of the agent into biofilms due to the presence of extracellular matrix, biofilm heterogeneity and biofilm-specific phenotypes such as expression of efflux pump and persister cells (Stewart and Costerton, 2001; ). Moreover biofilm resistance is known to vary from one microorganism to another (). Thus our further study will focus on the enhancement in resistance of our Staphylococcus aureus after biofilm formation.

In summary, our study revealed agr type diversity, virulence potential, antibiotic multiresistance and high biofilm formation ability of S. aureus isolated from pork production. All swine farms isolates belonged to agr IV, whereas S. aureus isolated from slaughterhouse and retail indicated diverse agr types. Raw meat isolates (belonging to agr I) exhibited a great ability to form strong biofilms than swine farms isolates (belonging to agr IV). Most biofilm-producing isolates were positive for MSCRAMM, capsule type and ica group genes. The results illustrate a significant association between the prevalence rate of MSCRAMM, capsule type and ica group genes among isolates producing weak, moderate and strong biofilms. Clarifying these mechanisms could provide novel insights that would prevention against S. aureus biofilm-related infections.

Statements

Author contributions

HY and LS participated in the design of this study. RC, DX, LS, and CL provided assistance for concepts, design, literature search, data acquisition, and manuscript preparation. YZ collected important background information, carried out the study, and performed the statistical analysis. HY and YZ drafted the manuscript. HY and DX performed the manuscript review. All the authors have read and approved the content of the manuscript.

Funding

This work was supported by the National Key Basic Research Program (2016YFD0500606), the Science and Technology Planning Project of Guangdong Province, China (2014A020214001 and 2016A020219001), the Fundamental Research Funds for the Central Universities, SCUT (D2170320), and the Central Universities constructs the world first-class university (discipline) and Characteristic Development Guidance Special Fund (K5174960).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1

    AkinbobolaA. B.SherryL.MckayW. G.RamageG.WilliamsC. (2017). Tolerance of Pseudomonas aeruginosa in in-vitro biofilms to high-level peracetic acid disinfection.J. Hosp. Infect.97162168. 10.1016/j.jhin.2017.06.024

  • 2

    ArturssonK.SöderlundR.LiuL.MoneckeS.SchelinJ. (2016). Genotyping of Staphylococcus aureus in bovine mastitis and correlation to phenotypic characteristics.Vet. Microbiol.193156161. 10.1016/j.vetmic.2016.08.012

  • 3

    BardiauM.DetilleuxJ.FarnirF.MainilJ. G.OteI. (2014). Associations between properties linked with persistence in a collection of Staphylococcus aureus isolates from bovine mastitis.Vet. Microbiol.1697479. 10.1016/j.vetmic.2013.12.010

  • 4

    BardiauM.YamazakiK.DuprezJ. N.TaminiauB.MainilJ.OteI. (2013). Genotypic and phenotypic characterization of methicillin-resistant Staphylococcus aureus (MRSA) isolated from milk of bovine mastitis.Lett. Appl. Microbiol.57181186. 10.1111/lam.12099

  • 5

    BhattacharyaM.BerendsE. T. M.ChanR.SchwabE.RoyS.SenC. K. (2018). Staphylococcus aureus biofilms release leukocidins to elicit extracellular trap formation and evade neutrophil-mediated killing.Proc. Natl. Acad. Sci. U.S.A.11574167421. 10.1073/pnas.1721949115

  • 6

    BolesB. R.HorswillA. R. (2008). Agr-mediated dispersal of Staphylococcus aureus biofilms.PLoS Pathog.4:e1000052. 10.1371/journal.ppat.1000052

  • 7

    BrakstadO. G.AasbakkK.MaelandJ. A. (1992). Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.J. Clin. Microbiol.3016541660.

  • 8

    CheungG. Y.WangR.KhanB. A.SturdevantD. E.OttoM. (2011). Role of the accessory gene regulator agr in community-associated methicillin-resistant Staphylococcus aureus pathogenesis.Infect. Immun.7919271935. 10.1128/IAI.00046-11

  • 9

    CLSI (2012). Performance Standards for Antimicrobial Susceptibility Testing. Wayne, PA: Clinical and Laboratory Standards Institute.

  • 10

    CoelhoL. R.SouzaR. R.FerreiraF. A.GuimaraesM. A.Ferreira-CarvalhoB. T.FigueiredoA. M. (2008). Agr RNAIII divergently regulates glucose-induced biofilm formation in clinical isolates of Staphylococcus aureus.Microbiology15434803490. 10.1099/mic.0.2007/016014-0

  • 11

    CramtonS. E.GerkeC.SchnellN. F.NicholsW. W.GotzF. (1999). The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation.Infect. Immun.6754275433.

  • 12

    CrombeF.ArgudinM. A.VanderhaeghenW.HermansK.HaesebrouckF.ButayeP. (2013). Transmission dynamics of methicillin-resistant Staphylococcus aureus in pigs.Front. Microbiol.4:57. 10.3389/fmicb.2013.00057

  • 13

    DavisM. F.PisanicN.RhodesS. M.BrownA.KellerH.NadimpalliM.et al (2018). Occurrence of Staphylococcus aureus in swine and swine workplace environments on industrial and antibiotic-free hog operations in North Carolina, USA: a one health pilot study.Environ. Res.1638896. 10.1016/j.envres.2017.12.010

  • 14

    DhanawadeN. B.KaloreyD. R.SrinivasanR.BarbuddheS. B.KurkureN. V. (2010). Detection of intercellular adhesion genes and biofilm production in Staphylococcus aureus isolated from bovine subclinical mastitis.Vet. Res. Commun.348189. 10.1007/s11259-009-9326-0

  • 15

    DonlanR. M. (2002). Biofilms: microbial life on surfaces.Emerg. Infect. Dis.8881890. 10.3201/eid0809.020063

  • 16

    EyohA. B.ToukamM.AtashiliJ.FokunangC.GonsuH.LyongaE. E.et al (2014). Relationship between multiple drug resistance and biofilm formation in Staphylococcus aureus isolated from medical and non-medical personnel in Yaounde, Cameroon.Pan Afr. Med. J.17:186. 10.11604/pamj.2014.17.186.2363

  • 17

    FluitA. C. (2012). Livestock-associated Staphylococcus aureus.Clin. Microbiol. Infect.18735744. 10.1111/j.1469-0691.2012.03846.x

  • 18

    GeB.MukherjeeS.HsuC. H.DavisJ. A.TranT.YangQ.et al (2017). MRSA and multidrug-resistant Staphylococcus aureus in U.S. retail meats, 2010-2011.Food Microbiol.62289297. 10.1016/j.fm.2016.10.029

  • 19

    GilotP.LinaG.CochardT.PoutrelB. (2002). Analysis of the genetic variability of genes encoding the RNA III-activating components agr and TRAP in a population of Staphylococcus aureus strains isolated from cows with mastitis.J. Clin. Microbiol.4040604067. 10.1128/JCM.40.11.4060-4067.2002

  • 20

    GravelandH.DuimB.van DuijkerenE.HeederikD.WagenaarJ. A. (2011). Livestock-associated methicillin-resistant Staphylococcus aureus in animals and humans.Int. J. Med. Microbiol.301630634. 10.1016/j.ijmm.2011.09.004

  • 21

    HoffmanL. R.D’ArgenioD. A.MacCossM. J.ZhangZ.JonesR. A.MillerS. I. (2005). Aminoglycoside antibiotics induce bacterial biofilm formation.Nature43611711175. 10.1038/nature03912

  • 22

    HuijsdensX. W.van DijkeB. J.SpalburgE.van Santen-VerheuvelM. G.HeckM. E.PluisterG. N.et al (2006). Community-acquired MRSA and pig-farming.Ann. Clin. Microbiol. Antimicrob.5:26. 10.1186/1476-0711-5-26

  • 23

    KaplanJ. B. (2011). Antibiotic-induced biofilm formation.Int. J. Artif. Organs34737751. 10.5301/ijao.5000027

  • 24

    KhoramroozS. S.MansouriF.MarashifardM.Malek HosseiniS. A.Akbarian Chenarestane-OliaF.GanaveheiB.et al (2016). Detection of biofilm related genes, classical enterotoxin genes and agr typing among Staphylococcus aureus isolated from bovine with subclinical mastitis in southwest of Iran.Microb. Pathog.974551. 10.1016/j.micpath.2016.05.022

  • 25

    KockR.SchaumburgF.MellmannA.KoksalM.JurkeA.BeckerK.et al (2013). Livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) as causes of human infection and colonization in Germany.PLoS One8:e55040. 10.1371/journal.pone.0055040

  • 26

    KotB.SzwedaP.Frankowska-MaciejewskaA.PiechotaM.WolskaK. (2016). Virulence gene profiles in Staphylococcus aureus isolated from cows with subclinical mastitis in eastern Poland.J. Dairy Res.83228235. 10.1017/S002202991600008X

  • 27

    KrishnasamyV.OtteJ.SilbergeldE. (2015). Antimicrobial use in Chinese swine and broiler poultry production.Antimicrob. Resist. Infect. Control4:17. 10.1186/s13756-015-0050-y

  • 28

    MagroG.BiffaniS.MinozziG.EhrichtR.MoneckeS.LuiniM.et al (2017). Virulence genes of S. aureus from dairy cow mastitis and contagiousness risk.Toxins9:E195. 10.3390/toxins9060195

  • 29

    MahT. F.O’TooleG. A. (2001). Mechanisms of biofilm resistance to antimicrobial agents.Trends Microbiol.93439. 10.1016/S0966-842X(00)01913-2

  • 30

    MarinoM.FrigoF.BartolomeoliI.MaifreniM. (2011). Safety-related properties of staphylococci isolated from food and food environments.J. Appl. Microbiol.110550561. 10.1111/j.1365-2672.2010.04909.x

  • 31

    NeopaneP.NepalH. P.ShresthaR.UeharaO.AbikoY. (2018). In vitro biofilm formation by Staphylococcus aureus isolated from wounds of hospital-admitted patients and their association with antimicrobial resistance.Int. J. Gen. Med.112532. 10.2147/IJGM.S153268

  • 32

    OteI.TaminiauB.DuprezJ. N.DizierI.MainilJ. G. (2011). Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. Vet. Microbiol.153285292. 10.1016/j.vetmic.2011.05.042

  • 33

    PaharikA. E.HorswillA. R. (2016). The staphylococcal biofilm: adhesins, regulation, and host response.Microbiol. Spectr. 4. 10.1128/microbiolspec.VMBF-0022-2015

  • 34

    PereyraE. A.PicechF.RennaM. S.BaravalleC.AndreottiC. S.RussiR.et al (2016). Detection of Staphylococcus aureus adhesion and biofilm-producing genes and their expression during internalization in bovine mammary epithelial cells.Vet. Microbiol.1836977. 10.1016/j.vetmic.2015.12.002

  • 35

    PriceL. B.SteggerM.HasmanH.AzizM.LarsenJ.AndersenP. S.et al (2012). Staphylococcus aureus CC398: host adaptation and emergence of methicillin resistance in livestock.mBio3e305e311. 10.1128/mBio.00305-11

  • 36

    QiL.LiH.ZhangC.LiangB.LiJ.WangL.et al (2016). Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii.Front. Microbiol.7:483. 10.3389/fmicb.2016.00483

  • 37

    SmithT. C.MaleM. J.HarperA. L.KroegerJ. S.TinklerG. P.MoritzE. D.et al (2008). Methicillin-resistant Staphylococcus aureus (MRSA) strain ST398 is present in midwestern U.S. swine and swine workers.PLoS One4:e4258. 10.1371/journal.pone.0004258

  • 38

    SnelG. G.MoneckeS.EhrichtR.PiccininiR. (2015). Molecular characteristics of bap-positive Staphylococcus aureus strains from dairy cowmastitis.J. Dairy Res.82312316. 10.1017/S0022029915000199

  • 39

    SongM.BaiY.XuJ.CarterM. Q.ShiC.ShiX. (2015). Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai.Int. J. Food Microbiol.19518. 10.1016/j.ijfoodmicro.2014.11.020

  • 40

    StewartP. S.CostertonJ. W. (2001). Antibiotic resistance of bacteria in biofilms.Lancet358135138. 10.1016/S0140-6736(01)05321-1

  • 41

    SzwedaP.SchielmannM.MilewskiS.FrankowskaA.JakubczakA. (2012). Biofilm production and presence of ica and bap genes in Staphylococcus aureus strains isolated from cows with mastitis in the eastern Poland.Pol. J. Microbiol.616569.

  • 42

    TristanA.YingL.BesM.EtienneJ.VandeneschF.LinaG. (2003). Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections.J. Clin. Microbiol.4144654467. 10.1128/JCM.41.9.4465-4467.2003

  • 43

    Va′zquez-Sa′nchezD.CaboM. L.IbusquizaP. S.Rodri′guez-HerreraJ. J. (2014). Biofilm-forming ability and resistance to industrial disinfectants of Staphylococcus aureus isolated from fishery products.Food Control39816. 10.1016/j.foodcont.2013.09.029

  • 44

    VossA.LoeffenF.BakkerJ.KlaassenC.WulfM. (2005). Methicillin-resistant Staphylococcus aureus in pig farming.Emerg. Infect. Dis.1119651966. 10.3201/eid1112.050428

  • 45

    WitteW.StrommengerB.StanekC.CunyC. (2007). Methicillin-resistant Staphylococcus aureus ST398 in humans and animals. Central Europe.Emerg. Infect. Dis.13255258. 10.3201/eid1302.060924

  • 46

    WulfM.van NesA.Eikelenboom-BoskampA.de VriesJ.MelchersW.KlaassenC.et al (2006). Methicillin-resistant Staphylococcus aureus in veterinary doctors and students, the Netherlands.Emerg. Infect. Dis.1219391941. 10.3201/eid1212.060355

Summary

Keywords

Staphylococcus aureus, agr typing, biofilm formation, virulence gene, antibiotic resistance, pork production

Citation

Zhang Y, Xu D, Shi L, Cai R, Li C and Yan H (2018) Association Between agr Type, Virulence Factors, Biofilm Formation and Antibiotic Resistance of Staphylococcus aureus Isolates From Pork Production. Front. Microbiol. 9:1876. doi: 10.3389/fmicb.2018.01876

Received

08 March 2018

Accepted

25 July 2018

Published

20 August 2018

Volume

9 - 2018

Edited by

Learn-Han Lee, Monash University Malaysia, Malaysia

Reviewed by

Maria José Saavedra, Universidade de Trás-os-Montes e Alto Douro, Portugal; Florence Dubois-Brissonnet, AgroParisTech-Institut des Sciences et Industries du Vivant et de l’Environnement, France

Updates

Copyright

*Correspondence: Chunling Li, He Yan,

These authors have contributed equally to this work

This article was submitted to Food Microbiology, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics