ORIGINAL RESEARCH article

Front. Microbiol., 21 June 2019

Sec. Food Microbiology

Volume 10 - 2019 | https://doi.org/10.3389/fmicb.2019.01393

Heterologous Expression of Argininosuccinate Synthase From Oenococcus oeni Enhances the Acid Resistance of Lactobacillus plantarum

  • 1. College of Enology, Northwest A&F University, Yangling, China

  • 2. Shandong Engineering and Technology Research Center for Ecological Fragile Belt of Yellow River Delta, Binzhou, China

  • 3. Heyang Experimental and Demonstrational Stations for Grape, Weinan, China

  • 4. Shaanxi Engineering Research Center for Viti-Viniculture, Yangling, China

Abstract

Oenococcus oeni can survive well in wine (an acid-stress environment) and dominate malolactic fermentation (MLF). To demonstrate a possible role of argininosuccinate synthase gene (argG) in the acid tolerance response of O. oeni, a related argG gene was inserted into a plasmid pMG36e and heterologously expressed in Lactobacillus plantarum SL09, a wine isolate belonging to a species of relevant importance in MLF. The expression levels of the argG gene in L. plantarum were analyzed by RT-qPCR, argininosuccinate synthase (ASS) activity and cell properties (amino acids, pH, H+-ATPase activity, and ATP levels) were determined at pH 3.7 in comparison with that at pH 6.3. Results showed that the recombinant strain L. plantarum SL09 (pMG36eargG) exhibited stronger growth performance compared with the control strain (without argG gene), and the expression levels of hsp1, cfa, atp, the citrate and malate metabolic genes were apparently increased under acid stress. In addition, the recombinant strain exhibited 11.0-, 2.0-, 1.9-fold higher ASS activity, H+-ATPase activity and intracellular ATP level, compared with the corresponding values for control strain during acid-stresses condition, which may take responsible for the acid tolerance enhancement of the recombinant strain. This is the first work report on heterologous expression of argG gene, and the results presented in this study will be beneficial for the research on acid stress response of O. oeni.

Introduction

Oenococcus oeni, an important lactic acid bacteria (LAB), is critical for winemaking owing to the ability of deacidification and stabilization of wine through malolactic fermentation (; ; ). The optimal pH for O. oeni growth is 4.8–5.5, however, wine is a harsh environment, with high acidity (pH 3.0–3.5), which is considered as a major stress for O. oeni growth (; ; ). O. oeni has a certain acid resistance mechanism because it survives well in a wine environment and play a crucial role in winemaking (; ).

Significant efforts have been made in order to reveal the mechanism by which O. oeni tolerates acid stress. A potential method used by bacteria is the use of a H+-ATPase to pump H+ out of the cell and thus increase the acid tolerance (). The citrate metabolism affects the acid tolerance of O. oeni, owing to its end products (), with finding that the genes involved in glutamine and glutamate metabolism were upregualted of O. oeni under stress. verified that the CtsR is the master regulator of stress-response in O. oeni. In addition, the arginine catabolism through the arginine deiminase (ADI) pathway is known to enhance acid tolerance by converting arginine into an alkaline product and by increasing external pH (; ; ). Moreover, the argG and argH gene involved in acid tolerance response of Lactobacillus casei (), which were responsible for encoding argininosuccinate synthase (ASS) and argininosuccinate lyase (ASL), respectively. Of these, ASS is considered as the rate-limiting enzyme for arginine biosynthesis (), we observed that the argG gene of O. oeni SD-2a was apparently over-expressed after acid shock in our previous research (), and functioned as a core regulatory gene during acid stress response according to its place in a gene co-expression network. However, the potential role of the argG gene on O. oeni acid stress has not been elucidated.

Oenococcus oeni seems to be good model for the study of mechanisms involved in stress resistance, but there are difficulties to genetically modify the O. oeni cells even using the current molecular biology technologies (; ; ). Currently, more attention was turned to other LABs as a model to explore O. oeni, expressed O. oeni mle in L. plantarum WCFS1, and the recombinant L. plantarum cells expressing MLE accelerate the malolactic fermentation. reported that the production of Lo18 from O. oeni expressed in L. lactis improved tolerance to heat and acid stress, suggesting Lo18 may play a role in cytoplasmic protein and membrane stabilization during stress. These studies suggested that achieving heterologous expression in other LABs can be used to explore the stress response mechanism of O. oeni. In addition, Lactobacillus plantarum is able to conduct MLF, and some L. plantarum strains are commercially used MLF starter (; ; ; ).

Therefore, in the present work, the argG was heterologously expressed in L. plantarum and the expression of argG gene was detected by RT-qPCR and ASS activity. Moreover, the growth of recombinant (pMG36eargG) and control strain (pMG36e) were measured under acid stress (pH 3.0–4.0), and cell properties (amino acids, pH, H+-ATPase activity, and ATP levels) were also determined at pH 3.7 and 6.3 to study the heterologous expression of the argG gene in the recombinant L. plantarum strain.

Materials and Methods

Strains and Growth Conditions

The industrial O. oeni strain, SD-2a was isolated from a local wine region in Shandong Province, China (), and preserved in China General Microbiological Culture Collection Center (CGMCC 0715). L. plantarum SL09 was isolated from red wine and identified by 16S rRNA gene analysis (Supplementary Table S1; ; ).

Oenococcus oeni SD-2a was cultured at 28°C in FMATB (5 g/L glucose, 5 g/L D, L-malate, 5 g/L yeast extract, 10 g/L peptone, 0.2 g/L MgSO4⋅7H2O, 0.05 g/L MnSO4⋅4H2O, 0.5 g/L cysteine/HCl, and 250 mL fresh tomato juice, pH 4.8). L. plantarum SL09 was cultured at 37°C in MRS broth, and Escherichia coli DH5α grew at 37°C in Luria-Bertani (LB) medium. Agar plates were prepared with 15 g/L agar. The culture of L. plantarum SL09 strain with plasmid pMG36e or pMG36eargG required the addition of erythromycin (Solarbio, Beijing, China), with a final concentration of 100 μg/ml, meanwhile, the E. coli DH5α strain with plasmid pMG36e or pMG36eargG required the addition of erythromycin (Solarbio, Beijing, China) with a final concentration to 200 μg/ml.

Data Acquisition and Gene Screening

The changes in the transcriptome of O. oeni SD-2a during acid shock were studied previously (), the RNA-seq data were downloaded from Sequence Read Archive (SRA) database with an accession number of SRP105332. The gene co-expression network was constructed in this study using the differential expression of genes and the Pearson model to calculate the co-expression coefficient and P-value between genes. Genes with a high co-expression coefficient and different expression levels (more than 2 folds) were selected.

DNA Extraction and Plasmid Construction

Oenococcus oeni SD-2a was grown in FMATB medium to an OD600nm of 1.0 (5 × 108 CFU/mL), then harvested by centrifugation at 12,000 × g for 2 min. DNA extraction was performed using the TIANamp Bacteria DNA Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. The argG gene from O. oeni SD-2a was amplified from genomic DNA using primers argG-F and argG-R (Table 1) to introduce the restriction site with PrimeSTAR® HS DNA Polymerase (Takara). Subsequently, the PCR product and the vector pMG36e were digested by Sal I and Hind III. Both fragments were ligated and the resulting plasmid transformed into chemically competent E. coli DH5α cells according to the method recommended by the manufacturer (Takara) (Figure 1). Positive colony PCR amplified constructs were verified by sequencing, performed by a commercial provider, and the plasmid pMG36eargG was extracted using the Plasmid Mini Kit I (omega).

TABLE 1

Strains, plasmids, or amplimerRelevant propertyaReferences/source
E. coli DH5αCloning hostTakara
O. oeni SD-2aDonor bacteriaOur lab
L. plantarum
SL09Plasmid-free bacteriaOur lab
SL09(pMG36e)L. plantarum harboring pMG36e, EmrThis study
SL09(pMG36eargG)L. plantarum harboring pMG36eargG, EmrThis study
Plasmids
pMG36eE. coli-L. lactis shuttle vector (3,6 kb), Emr
pMG36eargGpDL278-derivative vector containing the 1.4-kb region with the argG gene, EmrThis study
argG-FCGCGGATCCGAAGGAGAA AAAATGGCAGATAThis study
argG-RCCCAAGCTTGATCAGTCTA GCATGACCTGThis study

Bacterial strains, plasmids, and primers used in this study.

aEmr, erythromycin resistance.

FIGURE 1

Cell Preparation and Electroporation

The overnight culture of L. plantarum SL09 was inoculated into 10 ml MRS broth supplemented with 4% glycine and incubated at 37°C to OD600nm≈0.4. The cells were harvested by centrifugation, washed two times with 10 ml of sterile electroporation buffer (5 mM potassium phosphate, 0.5 mM MgCl2 and 0.5 M sucrose). Then, the cells were gently resuspended in 0.2 ml of electroporation buffer, and 100 μl of the solution was mixed together with 1 μg of plasmid DNA (pMG36e or pMG36eargG), transferred to a sterile 2-mm Gene Pulser cuvette (Bio-Rad) and left on ice for 5 min. Electroporation was performed with a Bio-Rad pulse gene controller (4 ms at 2.0 kV). The cells were immediately rescued into 1.8 ml of MRS supplemented with 0.3 M sucrose and incubated for 3 h at 37°C and plated onto MRS containing erythromycin (100 μg/ml). All strains and plasmids used in this study are listed in Table 1.

Stress Challenges in L. plantarum

Stress Experiment

An overnight culture of SL09 (pMG36eargG) and SL09 (pMG36e) grown in MRS (pH 6.3) medium at 37°C was used to inoculate (1%, v/v) into fresh MRS media (pH 6.3), and cultured to an OD600nm of 1.0. The culture was then inoculated (1%, v/v, without washing treatment) into fresh normal MRS (pH 6.3) or acid-stressed MRS pH 3.0–pH 4.0 (gradient 0.1) then cultured at 37°C to investigated the growth performance of strains by measuring absorbance at 600 nm and counting plates colonies. The pH of the medium was adjusted by 1 M HCL using pH meter (INESA Scientific Instrument Co., Ltd., Shanghai, China). All growth experiments were carried out in triplicate, and all the culture added with 100 μg/mL erythromycin.

ASS Activity Assay and Determination of Amino Acids in Cells

The samples used in these assays were taken from cultures under pH 3.7 and pH 6.3, respectively. L. plantarum SL09 (pMG36e) and recombinant SL09 (pMG36eargG) were cultivated to logarithmic phase (8 h for pH 6.3, 36 h for pH 3.7). The cells were harvested by centrifugation at 12,000 × g for 10 min, washed twice with Tris–Hcl buffer, ground with liquid nitrogen, resuspended in Tris–Hcl buffer (50 mmol/L, pH 7.4), and then centrifuged at 12,000 × g, 4°C for 10 min to obtain the cell supernatant. Reaction mixtures included 100 μl of cell supernatant, 100 μl of 50 mM N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid (pH 7.5), 16 mM ATP, 30 mM citrulline, 90 mM aspartic acid, and 5 mM MgCl2. Reactions were incubated at 27°C for 60 min and terminated with 70% (w/v) trichloroacetic acid. Final reaction supernatants were obtained by centrifugation at 5,000 × g, 4°C for 2 min. The supernatants added 300 μL O-phthalaldehyde and 600 μL borate buffer, then mixed at room temperature, filtered the mixture using 0.45 μm filtration, incubated in the dark strictly for 15 min, then applied to HPLC according to to obtain the concentration of other amino acids. Units of ASS activity (U) were expressed as micromoles of citrulline consumed per minute at 27°C ().

Measurement of pHi

Cells used for pHi measurement were cultivated to logarithmic phase (8 h for pH 6.3, 36 h for pH 3.7). The pHi was assayed by the fluorescence method using 2′, 7′-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxy- fluorescein, acetoxymethyl ester (BCECF AM) as the fluorescent probe (; ).

Determination of H+-ATPase and Intracellular ATP Concentration

Intracellular H+-ATPase activity was measured using the H+-ATPase assay kit (Beyotime Biotechnology, Shanghai, China). Enzyme activity units (U) were defined as the amount of enzyme required to oxidate 1 μmol NADH per minute at 37°C, pH 7.5. ATP concentrations were determined using a Firefly Luciferase ATP Assay Kit (Beyotime Biotechnology, Shanghai, China).

RT-qPCR

Total RNA was extracted using the RNAprep pure Cell/Bacteria Kit (Tiangen, Beijing, China) following the manufacturer’s instructions. The quality of the RNA samples was verified on a 1% (v/v) agarose gel, and the concentration of RNA was determined by measuring the A260nm using a BioDrop μLITE Spectrophotometer (Tamar Laboratory Supplies LTD., Cambridge, United Kingdom). Next, cDNA was synthesized using the Thermo Fisher Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, MA, United States). RT-qPCR was conducted according to the instructions of ChamQTM SYBR qPCR Master Mix (Vazyme, Nanjing, China). The L. plantarum SL09 16S rRNA gene was used as the housekeeping gene, and the SL09 (pMG36e) served as the control strain and was cultivated at the same pH value (3.7 and 6.3) (). The primers used for RT-qPCR are described in Table 2. The results were analyzed using the comparative critical threshold (2–ΔΔCT) method in which the amount of target RNA was adjusted to a reference signal (internal target RNA) as described previously ().

TABLE 2

GenePrimes Sequence (5’-3’)SizeDescriptionReferences
argHCCGAAACGGGTGCTAAGTATG135Argininosuccinate lyase ASLThis work
CAGCGGCAGGCAAAATACCAG
argFCCAGAGTTTTTGGGTAAGGAC189Ornithine carbamoyltransferaseThis work
CGTCGGGTGCCACTCATCGGT
cfaTTGGATGTTGGGAGTGGTTGG123Cyclopropane-fatty-acyl-phospholipid synthaseThis work
TTGCTTGATTTGCGCTTGTGT
hsp1TGGCACGCTCCTTCTGGGCAC139Heat shock proteinThis work
TCACGATAATCCAACTTCACA
uvrAATTCCGATGGATGTGCCGTATG148UvrABC system protein AThis work
TGATAACGCCCTCAAACACAGC
recACCCCGTTTATGCGGAACACCTA186Protein RecAThis work
GCGTCACCCATTTCACCTTCAA
recNCTGGTAAACGCACGAAAACGAG94DNA repair protein RecNThis work
TTAGTGACTTTAGTTCCCGCCA
recFGGTTTATTTGGGTGTCTTGTCG141DNA replication and repair protein RecFThis work
TTAATTGTTCCTGTTCTTGCGT
recOAACGCCCACTGAGTTCTGATAG106DNA repair protein RecOThis work
TTCCGTGTTGGATTTGGCTAAG
mleATAACCCCAGCCCAAAAAGC279Malolactic enzymeThis work
TACCCGTGGCAACTAAGGC
mdhCAAGAACCTCGCAGGGATT75Malate dehydrogenaseThis work
ATTGTCGCCACCATTGCTG
mlePAATCTTGGCTAACGAAGCACAT80Malate permeaseThis work
CCACGATGAACAACACGGTACT
atpGCGATGCTGTTCATTGCGAC174H+-ATPaseThis work
CGTTATCGTTCCCGTTTTGT
citPAAGCAATGGGCAGATGATGAGC168Citrate transport proteinThis work
AGCAACGAGTAGCAAGGAGACG
citEAAATGAAGAACGCTTACGGC116Citrate lyaseThis work
CGGCATCTTCCAAGTCAAAC
asnHTTACCGATTGGCACCCACAGT125Asparagine synthetaseThis work
ATTGCCAAGACTGAGACGGGG
aspBATTCTGCCACCCCTGCTCGCC131Asparagine–oxo-acid transaminaseThis work
CGACGAATCAGTTTCAGGCAG
purAGCGTAGCCGACCTGCTTGATA185Adenylosuccinate synthetaseThis work
AATGACAACGGAAGTATCGGT
thrAATTATCCATCCCGCTTCCACC265Aspartokinase/homoserine dehydrogenase 1This work
TCAACCACCCCACTACCCACA
glkATCAAGCATTGGCACAGGTTT129GlucokinaseThis work
ACCCCACTACCCACAGTTCCT
pfkTGTTGTAGCCGTGTTCCGTTA2076-PhosphofructokinaseThis work
ACAAAATAGAAGCAGCCGACT
pgkAGCGTTGCATCATCGTTTCT208Phosphoglycerate kinaseIn this study
GCGCCGGAACAAATAACAAA
pycAAACTGTCAAAAATGCGGAAAA171Pyruvate carboxylaseThis work
CCTGGAATCGGCTGAAAGAAC
ldhACATCGTTGTCATTACGGCTG209Lactate dehydrogenaseThis work
AATGACCCGATGCCGTGGAAA
gapdhTTCAGCAACCGACGATTCAA194Glyceraldehyde-3-phosphate dehydrogenaseThis work
AGCAGAAATCAAGACACGCT
argGGCGGTCTCATTGGATGTTGGC252Argininosuccinate synthaseThis work
GCTATGGCGACGGCATTATTA
16S rRNAAAGGGTTTCGGCTCGTAAAA24816S rRNAThis work
TGCACTCAAGTTTCCCAGTT

Primers used for RT-qPCR.

Statistical Analysis

The activity of ASS and H+-ATPase, the concentration of amino acids, and the pHi and ATP levels were all determined in triplicate for each pH growth condition tested. A one-way analysis of variance (ANOVA) with Duncan test was performed using SPSS 19.0 software (SPSS Inc., Chicago, IL, United States) to investigate the significance of differences.

Results and Discussion

Gene Screening

The argG gene (orf00834) is a core regulatory gene during acid stress response according to the co-expression network (Figure 2), and the argG gene was over-expressed (2.94 folds) after acid shock (pH 3.0) 1 h. This gene was selected for this assay.

FIGURE 2

Growth Resistance of L. plantarum Under Different pH Conditions

To investigate the influence of ASS on the resistance of transformed cells toward acidity, the growth of each strain was evaluated at OD600nm and counted plates colonies under different pH conditions (Figure 3 and Supplementary Figure S2). Despite their similar growth performance at pH 6.3, the growth of recombinant strain L. plantarum SL09 (pMG36eargG) was more robust than that of the control L. plantarum SL09 (pMG36e) under acid stress conditions (pH 3.7, 3.3, and 3.2). As the pH decreased from 6.3 to 3.2, the maximum OD600nm of both strains gradually decreased. The maximum OD600nm of SL09 (pMG36eargG) was significantly higher than that of the control strain at pH 3.7. This difference was more obvious for the cells grown at pH 3.3, where the maximum OD600nm of the recombinant strain was 5-fold higher than that of the control strain. A similar result was also observed at pH 3.2, where only the SL09 strain (pMG36eargG) grew well. The results of plate counting shown similar performance as results of the OD600nm measurement.

FIGURE 3

The results indicated that the SL09 (pMG36eargG) strain displayed stronger resistance to acid stress than SL09 (pMG36e). Although the acidic environment still inhibited cell growth, the introduction of the argG gene dramatically enhanced the acid tolerance of L. plantarum, allowing these bacteria to survive at a lower pH, one which would normally reduce growth.

ASS Activity Assay and Effect on Intracellular Amino Acids

To verify the heterologous expression of the argG gene, the transcriptional level of argG gene in recombinant and control L. plantarum was analyzed. (The RNA quality was shown in Supplementary Figure S1). As shown in Figure 4A, the expression level of argG was detected in the recombinant strain, (pMG36eargG) with strain SL09 (pMG36e) as control, and the relative expression level was significantly higher under acid stress conditions (pH 3.7). Figure 5A shows the ASS activity of both strains under the favorable and acid stress conditions (pH 6.3 and pH 3.7, respectively). Indeed, the recombinant strain exhibited higher ASS activity than did the control strain, especially under acid stress (pH 3.7, 11-fold difference). From pH 6.3 to pH 3.7, the ASS activity of the control strain was decreased by 61%, but the ASS activity of SL09 (pMG36eargG) increased by 260%. The improvement of ASS activity at pH 3.7 demonstrated that acid stress induced the high-efficiency expression of the argG gene in the recombinant strain. In arginine biosynthesis, ASS acts as the rate-limiting enzyme encoded by argG gene (). Indeed, as shown in Figure 5B, the amount of arginine synthesized was elevated, which may be attributed to the increased ASS activity level. Based on these findings, the acid tolerance enhancement of recombinant strain benefited from the heterologous expression of the argG gene that regulates ASS in the arginine deiminase pathway (ADI pathway).

FIGURE 4

FIGURE 5

Since the metabolism of amino acids is complex and consists of multiple interactions (), the impact of heterologous expression of the argG gene on amino acid metabolic genes can be seen at the transcriptional level (Figure 4A). The expressions of aspB, thrA, glnA, argR, argG, argH, and argF were significantly higher when SL09 (pMG36eargG) was exposed to acid stress than under the control condition, while the expression of purA and asnH was decreased. We observed that the genes involved in the ADI pathway were upregulated while the genes converting aspartate into adenylosuccinate and asparagine were downregulated, which is beneficial to the accumulation of aspartate, an arginine precursor. Investigating further, the levels of intracellular amino acids in the recombinant strain were compared to those in the control strain at pH 6.3 and pH 3.7. As is shown in Figure 5B, the heterologous expression of argG gene increases the concentrations of aspartate, glutamate, glutamine, arginine, and threonine under acid stress, most of them are related to the ADI pathway, which was in accordance with the RT-qPCR results.

In this study, the heterologous expression of argG gene tilted amino acid metabolism toward ADI pathway, which can produce alkaline products to neutralize H+ (), meanwhile, putrescine could be formed (). Putrescine is one of the biogenic amine present in wine, one which will affect the quality and safety of wine. The relationship of heterologous expression of argG gene and content of putrescine needs to be explored it next step. In addition, found that arginine stimulated pre-adaption of O. oeni to wine stress at the start of wine-making, which may be related to the expression level of stress response genes, including ftsH, omrA, and arcR, which were higher when the medium contained arginine. Subsequent study showed that arginine combined with fructose triggered the expression of ftsH, omrA, and arcR genes ().

ASS Effect on Glycolysis Pathway and Other Response Genes

Glycolysis is the major pathway that produces energy for LAB growth, except for the amino acid metabolism pathway. There are many genes involved glycolysis, such as the gapdh, ldh, pfk, pgk, pycA, and glk genes (). Additionally, other stress response genes together with the genes in glycolysis pathway were chosen to investigate the influence induced by the expression of argG gene (; ; Figures 4B,C). The expression level of all genes in this study was calculated based the expression of the control strain SL09 (pMG36e). Compared with pH 6.3, the expression level of some genes (gapdh, ldh, pfk, pgk, pycA, and glk) in glycolysis pathway were not significantly changed at pH 3.7. These results suggested that the heterologous expression of argG in L. plantarum did not have significant effects on the glycolysis pathway under acid stress. This also recommended that those genes, such as ldh, can be used as internal control genes for RT-qPCR experiments in L. plantarum (; ). Furthermore, at pH 3.7, the expression level of cfa, hsp1, mleA, mdh, mleP, atp, citP, and citE were higher than pH 6.3, displaying an increase between 1.0- and 8.5-fold. The cell membrane is the first barrier against an external unfavorable environment for LAB. Maintenance of the quality of the cell membrane is improved by the increased expression of the cfa and hsp1 genes. In O. oeni, the CFA encoded by the cfa gene could reduce the effects of stress on the membrane, since cyclopropane rings restrict the overall mobility and disorder of acyl chains more than the cis double bonds. Additionally, in O. oeni, the hsp18 gene encodes a small heat shock protein (sHSP), which contributes to the maintenance of membrane integrity under stress conditions by preventing the thermal aggregation of cellular proteins (). There are three genes which encode for small heat shock protein in L. plantarum. The hsp1 gene was involved in controlling and improving membrane fluidity, and the hsp3 gene may be responsible for the induction of thermotolerance. However, the deletion of hsp2 did not significantly impair resistance to heat and other stresses (). In this study, we investigated the expression level of hsp1 genes which may be related to acid-stress response of L. plantarum. The consumption of H+ is another response to acid stress, and the recombinant strain at pH 3.7 showed a higher expression level of atp gene than pH 6.3. H+-ATPase is encoded by the atp gene, an enzyme can synthesize ATP using the H+ from the extracellular space into the cell.

The mleP, mleA, and mdh gene were important genes, responsible for malate metabolism (, ), and citP and citE gene played a major role in citrate metabolism (), the expression of these genes was enhanced and was beneficial in improving strain acid tolerance. The metabolism of L-malate and citrate does not directly provide an energy source, but decarboxylation and the efflux of metabolites generate a proton motive force that can be used to drive ATP synthesis by H+-ATPase ().

The effects of heterologous expression of the argG gene on SL09 at pH 3.7 are presented in Figure 6. The heterologous expression of argG gene did not affect the expression of genes related to DNA damage repair, because the uvrA, recA, recN, recF, and recO, were not significantly improved at pH 3.7,but may have stimulated the expression of hsp1, cfa, atp, and the malate and citrate metabolic genes under the acid condition. The functions of these genes include maintenance of the quality of the cell membrane, to exclude H+ and produce more ATP.

FIGURE 6

ASS Effect on pHi, H+-ATPase Activity and Intracellular ATP Level

The pHi, H+-ATPase activity and intracellular ATP level of both strain were measured at pH 3.7 and pH 6.3, respectively (Figures 7A–C), to further investigate the effect of heterologous expression of the argG gene on acid stress resistance and the ASS effect on other stress response genes.

FIGURE 7

The intracellular pH of both strains did not show a significant difference at pH 6.3. Compared with pH 6.3, the pHi of the recombinant strain and the control strain were decreased at pH 3.7, the intracellular pH of the recombinant strain stabilized at 5.83, and the control strain decreased to 4.75. Obviously, the pHi of the recombinant strain declined less than the control strains. Although the H+-ATPase activity of both strains decreased at pH 3.7, but the H+-ATPase activity of the recombinant strain was two-fold higher than the control strain (pMG36e). Similarly, the ATP level of SL09 (pMG36eargG) and SL09 (pMG36e) were both decreased at pH 3.7, with the recombinant strain maintaining a higher ATP level (88.8%) than the wild-type strain (44.6%). These results were in accordance with the RT-qPCR results.

The intracellular pH affected a variety of biochemical reactions including reactions catalyzed by enzymes, since pHi is crucial for the maintenance of normal physiological activity in cells. The results indicated that the heterologous expression of the argG gene in L. plantarum increased the ability of cells to maintain neutral pH, which may be related to the higher mRNA level of atp, citrate and malate metabolic genes, and H+-ATPase activity under acid conditions. The pHi affected the activity of H+-ATPase, meanwhile the H+-ATPase activity also affected pHi because H+ is pumped out of cells through the H+-ATPase coupled with ATP hydrolysis (). Moreover, citrate and malate metabolism could improve the pHi by using H+ during decarboxylation. The influence of the heterologous expression of the argG gene brought was complex and systematic and may increase the expression genes involved in consumption of H+ indirectly based on results, but further investigation into the relationship between them is needed.

In addition, the heterologous expression of the argG gene in L. plantarum contributed the ATP level in cells suggested by results. ATP levels in cells is a direct energy source, playing a crucial role in maintaining bacteria growth, proliferation, and cellular functions. The content of intracellular ATP was affected by many factors, in this study, the higher H+-ATPase activity of SL09 (pMG36eargG) under pH 3.7 promoted formation of ATP by consuming H+, the increased expression of genes involved malate and citrate of SL09 (pMG36eargG) under pH 3.7 was beneficial to ATP synthesis, and the heterologous expression of the argG gene in L. plantarum improved the concentration of amino acids participated in ADI pathway, which the arginine metabolism through the ADI pathway produces 1 mol of ATP per mol of arginine consumed. The level of intracellular ATP of SL09 (pMG36eargG) was higher than SL09 (pMG36e) according to the results, which will be helpful to the growth of the strain, the maintenance of cell functions, and the instigation of the stress mechanism. Therefore, the SL09 (pMG36eargG) demonstrated better performance than SL09 (pMG36e) under acid stress.

Conclusion

The heterologous expression of argG gene fromO. oeni SD-2a was achieved in L. plantarum SL09. Due to the expression of the argG gene, the acid stress resistance of recombination L. plantarum was improved, mainly affecting the ADI pathway, malate and citrate metabolism, with an increase in pHi, H+-ATPase activity and intracellular ATP levels. Additionally, the heterologous expression of argG gene also stimulated the expression of hsp1, cfa, and other genes related to malate and citrate metabolism, which requires further investigation. This work may be helpful to understand and eventually obtain O. oeni strains with high acid tolerance in winemaking industry.

Statements

Data availability statement

The datasets generated for this study can be found in Sequence Read Archive (SRA) database, SRP105332.

Author contributions

HL, LL, and HZ conceived the idea of the study. HZ, LL, SP, and LY designed and carried out the experiments. LL and HZ analyzed the data and wrote the manuscript. HW revised the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 31471708).

Acknowledgments

We would like to thank Prof. Shuwen Liu for supplying pMG36e plasmid and L. plantarum SL09. We would also like to thank the reviewers for their comments and suggestions, which greatly improved the original version of the manuscript.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2019.01393/full#supplementary-material

References

Summary

Keywords

Oenococcus oeni, heterologous expression, acid stress, argininosuccinate synthase, Lactobacillus plantarum

Citation

Zhao H, Liu L, Peng S, Yuan L, Li H and Wang H (2019) Heterologous Expression of Argininosuccinate Synthase From Oenococcus oeni Enhances the Acid Resistance of Lactobacillus plantarum. Front. Microbiol. 10:1393. doi: 10.3389/fmicb.2019.01393

Received

24 April 2019

Accepted

04 June 2019

Published

21 June 2019

Volume

10 - 2019

Edited by

Vittorio Capozzi, University of Foggia, Italy

Reviewed by

Liliana Carmen Semorile, Universidad Nacional de Quilmes (UNQ), Argentina; Maria Dimopoulou, Agricultural University of Athens, Greece

Updates

Copyright

*Correspondence: Hua Li, ; Hua Wang,

These authors have contributed equally to this work

This article was submitted to Food Microbiology, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics