Abstract
The Gram-negative bacterium Vibrio cholerae encodes two nucleases, Dns and Xds, which play a major role during the human pathogen’s lifecycle. Dns and Xds control three-dimensional biofilm formation and bacterial detachment from biofilms via degradation of extracellular DNA and thus contribute to the environmental, inter-epidemic persistence of the pathogen. During intestinal colonization the enzymes help evade the innate immune response, and therefore promote survival by mediating escape from neutrophil extracellular traps. Xds has the additional function of degrading extracellular DNA down to nucleotides, which are an important nutrient source for V. cholerae. Thus, Xds is a key enzyme for survival fitness during distinct stages of the V. cholerae lifecycle and could be a potential therapeutic target. This study provides detailed information about the enzymatic properties of Xds using purified protein in combination with a real time nuclease activity assay. The data define an optimal buffer composition for Xds activity as 50 mM Tris/HCl pH 7, 100 mM NaCl, 10 mM MgCl2, and 20 mM CaCl2. Moreover, maximal activity was observed using substrate DNA with low GC content and ambient temperatures of 20–25°C. In silico analysis and homology modeling predicted an exonuclease domain in the C-terminal part of the protein. Biochemical analyses with truncated variants and point mutants of Xds confirm that the C-terminal region is sufficient for nuclease activity. We also find that residues D787 and H837 within the predicted exonuclease domain are key to formation of the catalytic center.
Introduction
Vibrio cholerae, a facultative human pathogen, is able to transit between two different environmental habitats, the aquatic reservoir and the human intestinal tract, causing the secretory diarrheal disease cholera (, ). Plants, zooplankton, crustaceans etc. present surfaces for formation of V. cholerae biofilms and allow its persistence in the aquatic reservoir (, ). During this phase of its lifecycle, bacterial aggregates detach from the biofilms and constitute an agent for initial infection of the human host via oral ingestion (, ; ). To counter environmental challenges the bacterium adapts its physiology continuously through rapid changes in transcriptional regulation, protein synthesis and post-translational control. Proteolysis is particularly important during multiple stages of V. cholera’s lifecycle by varying virulence gene expression and biofilm growth, e.g., through control of transcription factors TcpP and ToxR; mucosal escape response or FliA degradation (; ; Wurm et al., 2017). Moreover, dramatic shifts in gene expression are essential for the survival of the bacteria within extreme environments like the acidic human stomach or the nutrient poor aquatic environment. Early induced genes initiate the virulence gene cascade leading to colonization of the small intestine and to severe diarrhea, while late induced genes increase fitness at the late infection state and are advantageous for the transition to the aquatic environment (; ; ). Two predicted extracellular nucleases of V. cholerae, encoded by xds (VC2621) and dns (VC0470), were shown to facilitate its survival fitness in- and outside of the host (; ; ).
Extracellular nucleases are known to control biofilm structure in several pathogens, e.g., Staphylococcus, Neisseria, Shewanella, through degradation of extracellular DNA (eDNA) (; ; ). This matrix component is an abundant polymer in soil and water. Combined with Vibrio exopolysaccharides (VPS) and a variety of matrix proteins, it provides a major component of the Vibrio biofilm matrix. eDNA is reported to be important for the initial attachment of the bacteria to the surface. When combined with nucleases, it acts as a flexible structural component, which can be modified according to the needs of the bacteria. Deletion of both V. cholerae nucleases results in thick and disorganized biofilm that lacks the fluid-filled channels and pillars typically present for effective transport of molecules (Watnick and Kolter, 1999; Yildiz and Schoolnik, 1999; Watnick et al., 2001; ; ; ). Although both enzymes utilize DNA as substrate, their enzymatic reactions and regulation differ. While Dns is an EndA homolog that acts as an endonuclease, Xds exhibits exonuclease activity (). Moreover, dns expression is repressed via the quorum sensing regulator HapR, while xds expression is controlled independently of population density. Notably, dns expression fluctuates during biofilm formation, whereas Xds increases over time to reach a maximum in mature biofilms (). Dns seems to be the prominent nuclease for establishment of the three-dimensional (3D) biofilm structure, but Xds is essential for degradation of eDNA to the nucleotide level (; ). Expression of both nucleases in late stages of the mature biofilm indicates their importance during nutrient deprivation. Recently, it was shown that both nucleases are expressed under low phosphate conditions, which V. cholerae faces after the transition from the host to the aquatic environment. This is similar to reports of Pseudomonas aeruginosa, which represents another human pathogen that degrades eDNA down to carbon, nitrogen, and phosphate levels (; ; ; ). Additionally, xds expression is induced via the phosphate stress response regulator PhoB, as part of the two-component system PhoB/R, which is active upon phosphate limitation (). The activity of both nucleases results in degradation of eDNA and the extracellular accumulation of nucleotides. The latter are further transported via OmpK through the outer membrane followed by dephosphorylation via three periplasmic phosphatases. While free phosphate is taken up by the Pst/PhoU system the nucleosides are transported via the NupC system into the cell (; ; ; ).
As biofilms serve as a reservoir for eDNA in the outside environment, neutrophil extracellular traps (NETs) provide a source of DNA inside the host. NETs originate from neutrophils upon contact with microbes as a first line of defense of the innate immune system (). They consist of a nuclear or mitochondrial backbone associated with cytoplasmic and granula proteins. These components form fibers for efficient capture and killing of intruders effectively preventing the spread of microbes from the initial site of infection (; ). We showed recently, that presence of eDNA, provided by NETs, induce both extracellular nucleases. Degradation of NETs by Xds and Dns, increases V. cholerae colonization fitness in vivo by liberation of the bacteria out of this entrapment ().
Intriguingly, Xds homologs are rare yet often found in pathogens where biofilm formation is associated with virulence, e.g., Acinetobacter baumannii and P. aeruginosa (; ; ; ). Until today, no Xds homolog was found to be present in the human host highlighting the enzyme’s potential use for tailored therapy. In this context, highly specific Xds inhibitors would prevent dysbiosis of the human microbiome caused by standard antibiotic treatments. Herein we present an in depth characterization of Xds enzymatic properties in order to provide detailed understanding of its nuclease activity.
Materials and Methods
Bacterial Strains and Growth Conditions
Bacterial strains and plasmids used in this study are listed in Table 1; oligonucleotides are listed in Table 2. V. cholerae C6709, a spontaneous streptomycin (Sm)-resistant mutant of the clinical isolate O1 El Tor Inaba was used as wild type (WT) (), Escherichia coli strains DH5αλpir and SM10λpir were used for genetic manipulation (; ; ), BL21 (NEB) for expression of proteins, Cutibacterium acnes (ATCC 6919; IA1) and Haemophilus influenzae (RD KW20) as template for dsDNA with 67 and 31% GC content, respectively (see Table 1). If not noted otherwise, strains were cultured in Luria Bertani (LB) broth (1% tryptone, 1% NaCl, 0.5% yeast extract) either shaking with 180 rpm or on LB broth agar plates with aeration at 37°C. If required, antibiotics or other supplements were used in the following final concentrations: streptomycin (Sm) 100 μg/ml, ampicillin (Ap) 100 μg/ml or 50 μg/ml in combination with other antibiotics, isopropyl-β-thiogalactopyranoside (IPTG) 0.5 mM, and glucose (Gluc) 0.2%.
TABLE 1
| Strain or plasmid | Genotype, resistance, description | References |
| E. coli | ||
| DH5aλpir | F–Φ80ΔlacZΔM15Δ(argFlac)U169 deoR recA1 endA1 hsdR17 (rK–mK+) supE44 thi-1 gyrA69 relA1, λpirR6K, Apr | |
| SM10λpir | thi thr leu tonA lacY supE recA:RPA-2-Te:Mu λpirR6K, Kmr | |
| BL21 (DE3) | fhuA2 [lon] ompTgal (λ DE3) [dcm]ΔhsdS λ DE3 = λsBamHIoΔEcoRI-B int:(lacI:PlacUV5:T7 gene1) i21Δnin5 | NEB |
| V. cholerae | ||
| WT | C6709, wild type V. cholerae strain serogroup: O1; biotype: El Tor; serotype: Inaba; Peru 1991,tcpA + ctx + hapR + spontaneous SmR | |
| C6709ΔxdsΔdns | deletion of VC2621 and VC0470 in C6709,SmR | |
| Δdns | Deletion of dns(VC0470)in C6709, SmR | |
| ΔepsC-N | Deletion of epsC-N (VC2734-VC2723) in C6709, SmR | This study |
| ΔdnsΔepsC-N | Deletion of dns(VC0470) and epsC-N (VC2734-VC2723) in C6709, SmR | This study |
| C. acnes | ATCC 6919; IA1; Isolated from: acne patient; Source: DSMZ | |
| H. influenzae | Rd KW20; Un encapsulated variant of a former capsular serotype d strain, obtained from A. Wright | Wilcox and Smith (1975) |
| Plasmids | ||
| pRS415 | Yeast and bacterial Plasmid; ApR | Stratagene |
| pCVD442 | ori6K mobRP4 sacB, Apr | |
| pAC1000 | CmR | |
| p | pTRC99a, IPTG-inducible vector; ApR | |
| pxds | Xds from C6709 with C terminal FLAG tag in pTRC99a | This study |
| pxdsΔS39–G137 | Deletion of S39-G137 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔS39–Q159 | Deletion of S39-Q159 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔS39–S184 | Deletion of -S39-S184 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔS39–I200 | Deletion of S39-I200of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔS39–V233 | Deletion of S39-V233 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔS39–D248 | Deletion of S39-D248 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔS39–G473 | Deletion of S39-G473 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔL30–G134 | Deletion of L30-G134 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔL30–S184 | Deletion of L30-S184 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔL30–I200 | Deletion of L30-I200of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔN221–Q300 | Deletion of N221-Q300 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsΔL30–G473 | Deletion of L30-G473 of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsD787A | Point mutation in D787 to Aof Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsH837A | Point mutation in H837 to Aof Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsC188A | Point mutation in C188 to A of Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsC276A | Point mutation in C276 to Aof Xds, with C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsC661A | Point mutation in C661 to A of Xds, C terminal FLAG tag on the pTRC99A, ApR | This study |
| pxdsC684A | Point mutation in C684 to A of Xds, C terminal FLAG tag on the pTRC99A, ApR | This study |
Strains and plasmids used in this study.
TABLE 2
| Primer name | Sequence (5′ to 3′) |
| Xds_EcoRI_1 | AAAGAATTC GAAATGAGAACAACCCC |
| Xds_XbaI_2 | AAATCTAGA CTATTTGTCATCGTCGTCCTTGTAGTCGCG ACGGCGACGCCAAA |
| S39-G137_3 | TCTTTCGCAAAATCTGCGCCGCCTTCAACGTATTGAG AAATC |
| S39-G137_4 | GATTTCTCAATACGTTGAAGGCGGCGCAGATTTTGCG AAAGA |
| S39-Q159_3 | GCCTTGGGTCGCCCAATCGGAAGCGCCTTCAACGTATT GAGAAAT |
| S39-Q159_4 | ATTTCTCAATACGTTGAAGGCGCTTCCGATTGGGCGA CCCAAGGC |
| S39-S184_3 | ACCATCTAGCGTACAATTGAAGGGCCTTCAACGTATTGA GAAAT |
| S39-S184_4 | ATTTCTCAATACGTTGAAGGCTTCAATTGTACGCTAG ATGGT |
| S39-I200_3 | GCCTTCACCTTGAATTTGTTGGCCTTCAACGTATTGA GAAAT |
| S39-I200_4 | ATTTCTCAATACGTTGAAGGCCAACAAATTCAAGGTG AAGGC |
| S39-V233_3 | GCCTTTAGTCAGTCCTGTCGTGCCTTCAACGTATTGA GAAAT |
| S39-V233_4 | ATTTCTCAATACGTTGAAGGCACGACAGGACTGACTA AAGGC |
| S39-D248_3 | TTCAGAGGTATTCGGGTTGTAGTCGCCTTCAACGTATT GAGAAAT |
| S39-D248_4 | ATTTCTCAATACGTTGAAGGCGACTACAACCCGAATA CCTCT |
| S39-G473_3 | GTTGAACGTGGCAATGCGCAGATCGCCTTCAACGTATT GAGAAAT |
| S39-G473_4 | ATTTCTCAATACGTTGAAGGCGATCTGCGCATTGCCACGT TCAAC |
| L30-G134_3 | AAAATCTGCGCCGCCCATACTGTCAGCGTAGCTTGGC GCCAC |
| L30-G134_4 | GTGGCGCCAAGCTACGCTGACAGTATGGGCGGCGCAG ATTTT |
| L30-S184_3 | ACCATCTAGCGTACAATTGAAGGCGTCAGCGTAGCTTG GCGCCAC |
| L30-S184_4 | GTGGCGCCAAGCTACGCTGACGCCTTCAATTGTACGCT AGATGGT |
| L30-I200_3 | GCCTTCACCTTGAATTTGTTGGTCAGCGTAGCTTGGC GCCAC |
| L30-I200_4 | GTGGCGCCAAGCTACGCTGACCAACAAATTCAAGGTG AAGGC |
| N221-Q300_3 | GCGCAGCTTGCTGGCC GGTGATGTAGGGATA |
| N221-Q300_4 | TATCCCTACATCACC GGCCAGCAAGCTGCG |
| L30-G473_3 | GTTGAACGTGGCAATGCGCAGATCGTCAGCGTAGCTTG GCGCCAC |
| L30-G473_4 | GTGGCGCCAAGCTACGCTGACGATCTGCGCATTGCCAC GTTCAAC |
| D787A_3 | CTGACTAACAGATGAGCCAACGCGCCGACTT |
| D787A_4 | AAGTCGGCGCGTTGGCTCATCTGTTAGTCAG |
| H837A_3 | AGTACCGCTGGGTCAGCATCTGAGGCGCGGAA |
| H837A_4 | TTCCGCGCCTCAGATGCTGACCCAGCGGTACT |
| C188A_3 | TTCAGCACCATCTAGCGTAGCATTGAAGGCACTCGG |
| C188A_4 | CCGAGTGCCTTCAATGCTACGCTAGATGGTGCTGAA |
| C276A_3 | CTGCACTTTGCCTTTCACGGCCACCACATCGCCCGG |
| C276A_4 | CCGGGCGATGTGGTGGCCGTGAAAGGCAAAGTGCAG |
| C661A_3 | CGCGGCATCTTCCCAAGCCGCTGATCCTTTCGATTT |
| C661A_4 | AAATCGAAAGGATCAGCGGCTTGGGAAGATGCCGCG |
| C684A_3 | GACGCGGAAGTTTTCAGCTGCGCCTTGGTAATCGAG |
| C684A_4 | CTCGATTACCAAGGCGCAGCTGAAAACTTCCGCGTC |
| CAT_BamHI_Fw | TTTGGATCC GATAAGCTTGATGAAAATTTGT |
| CAT_BamHI_Rev | TTAGGATCC GGTTAGTGACATTAGAAAA |
| HI_Fw | TTTTAAATGTTCCTTATTTATTAA |
| HI_ Rev | TATTGCTTACAATAGGAAATACAGA |
| CA_ Fw | GTGTTGACGCGCATGTCACAGCT |
| CA_ Rev | GTAGACGCCGGGAGCGACCCGGC |
| VC2734_SacI_1 | AAAGAGCTC GCCTTGCTTAGGTTCA |
| VC2734_BamHI_2 | TTAGGATCC CATAAATTTCCACGTTATTCC |
| VC2723_EcoRI_3 | AATGAATTC TAGGATGTGTAATCCCATTCA |
| VC2373_XbaI_4 | TTTTCTAGA TCATTCGCTGGCCTTTA |
| Seq_pTrc_Fw | TTGTGAGCGGATAACAA |
| Seq_pTrc-Rev | TCAGGCTGAAAATCTTCTCTC |
| Seq_1180nt_Fw | GAATCGGATGCCAAAGCACCAGAT |
Oligonucleotides used in this study.
aRestriction sites are underlined, point-mutations are in bold.
Construction of in Frame Mutants and Expression Plasmids
PCR conditions, the isolation of chromosomal DNA, plasmids or PCR products, and construction of expression plasmids were carried out as described previously (). Qiaquick® Gel extraction and Qiaquick® PCR Purification kits (Qiagen) were used for purifying PCR products and digested plasmid DNA. PCR reactions for sub-cloning were carried out using the Q5® High-Fidelity DNA Polymerase (NEB), while Taq DNA Polymerase (NEB) was used for all other PCRs. Deletion mutants were generated using derivatives of the suicide vector pCVD442 in combination with an established method (). Respective suicide vectors were constructed by PCR-amplification of approximately 800 bp fragments, representing upstream and downstream regions of the gene of interest, using the oligonucleotide pairs X_Y_1 and X_Y_2 or X_Y_3 and X_Y_4, where X represents the gene and Y the restriction site/enzyme used (Table 2). Subsequently, fragments generated were digested with the appropriate restriction enzyme indicated by the name of the oligonucleotide, and finally ligated into an identically digested suicide plasmid pCVD442. The respective suicide plasmids were first transformed into E. coli DH5αλpir. Positive clones were selected via PCR (data not shown) and further transformed in E. coli Sm10λpir and then transferred into V. cholerae via conjugation. Cells were grown on Sm- and Ap-containing agar plates to select for the integration of the plasmid into the chromosome. This selection was followed by growth on sucrose to obtain Aps colonies, in which an excision of the plasmid from the chromosome took place. Correct deletions were confirmed by PCR (data not shown). Point mutants harboring an amino acid (AA) exchange as well as truncated versions of Xds were generated by SOE (splicing by overlap extension) PCR, using chromosomal DNA of V. cholerae WT as template and the oligonucleotide pairs Xds_EcoRI_1 and Xds_XbaI_2 as well as the oligos XY_3 and XY_4, where XY stands for the respective AA (Table 2) (). The generation of overlapping regions allowed the annealing of the two PCR fragments in a further PCR reaction. The respective PCR fragments were digested with the appropriate restriction enzymes and ligated into a similarly digested, IPTG-inducible plasmid (pTRC99a). Ligation products were transformed into DH5αλpir and ApR colonies were characterized by PCR for the positive constructs which were verified by Sanger-sequencing (data not shown). Plasmids were isolated and transformed in to V. cholerae or E. coli strains, which were then tested for nuclease activity with DNase Agar plates, gel electrophoresis or nuclease activity assay with SYBR Green I (SGI). Further the clones were taken for cell fractionation or immunoblot analysis.
Generation of Whole Cell Lysates (WCL)
To obtain WCL appropriate amounts of V. cholerae and E. coli cultures grown overnight (ON) were inoculated in fresh LB to an OD600 of 0.1, grown to an OD600 of 0.5 following induction with IPTG (0.5 mM) for 4 h with aeration at 37°C, 180 rpm shaking. Cell equivalents reflecting 1 ml of an OD600 of 1.3, were harvested by centrifugation in an Eppendorf centrifuge (5 min at 5,000 g), resuspended in 100 μl of Laemmli buffer, boiled for 30 min at 100°C and either stored at −20°C or directly used for SDS-PAGE. For immunoblot analyses of WCL the overall protein contents were assessed to contain similar protein levels by SDS-PAGE following Kang staining.
Cellular Fractionation
Cellular fractionation was performed as described by Neu and Heppel (). V. cholerae strains grown ON were inoculated in fresh LB to an OD600 of 0.1, followed by induction with 0.5 mM IPTG at an OD600 of 0.5 for 4 h. Cell equivalents reflecting 1 l of a culture with OD600 of 1 were pelleted by centrifugation (10 min, 5,000 g) and washed in buffer (20 mM Tris/HCl pH 8). After a second centrifugation step, cells were resuspended in 20% sucrose and 1 mM Na-EDTA and incubated for 10 min subsequently shaking. After centrifugation for 10 min, 5,000 g at 4°C cells were resuspended in ice cold 0.5 mM Mg2SO4. Combination of cold temperature and hypotonic solution caused the burst of the bacterial outer membrane and release of the periplasmic fraction (PF) in the supernatant. Proteins in the PF were precipitated using trichloroacetic acid (TCA)/acetone for immunoblot analyses. The remaining pellet was further resuspended in 10 mM Tris/HCl pH 8 and lysed using 0.1 mm glass beads in combination with a PowerLyzerTM 24 (MO BIO Laboratories, Inc.), applying three 1 min cycles at 3,400 rpm with 1 min intervals on ice between each cycle (, ). Lysates were centrifuged for 30 min at 10,000 g and 4°C to obtain the cytoplasmic fraction (CF) represented by the supernatant. The remaining pellet was resuspended in 100 μl 10 mM Tris/HCl pH 8 and used as membrane fraction (MF).
Precipitation of Proteins Using TCA/Acetone
Protein precipitation using TCA and acetone was essentially performed as described by Link and LaBaer (), with following modifications. Solution of 100% TCA was added to the protein samples (PF) to the final TCA concentration of 20%. Samples were mixed and stored ON at −20°C. On the next day, samples were thawed and centrifuged 30,000 g for 1 h. Supernatant was carefully decanted and 20 ml of acetone was added to the pellet. Samples were again centrifuged 30,000 g for 1 h. A second washing step with 20 ml of acetone was performed with the final centrifugation step of 50,000 g. After decanting the supernatant, pellets were air-dried for 30 min and subsequently resuspended in 200 μl of TBS buffer. In attempt to completely dissolve the pellet, samples were placed in a sonification bath for 30 min. Undissolved particles were removed by short centrifugation.
SDS-PAGE and Immunoblot Analysis
Proteins concentrations were generally determined with Bradford assay (BioRad) to ensure loading of equal protein amounts. To separate proteins the standard sodium dodecyl-sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) procedure in combination with 12% gels and the PageRulerTM Prestained Protein Ladder (Thermo Scientific) as a molecular mass standard was used. Proteins were stained according to or transferred to a nitrocellulose membrane (Amersham) for immunoblot analysis. Blocking was done overnight at 4°C in TBS (0.5 M Tris/HCl pH 7.5, 1.5 M NaCl) supplemented with 10% milk powder. FLAG-tagged proteins were detected with HRP-conjugated α-FLAG antibody (A8592, Sigma). After washing (5 × 5 min) with 1× TBS T (0.5 M Tris/HCl pH 7.5, 1.5 M NaCl, 0.5% Tween-20) blots were detected with ECL (Bio-Rad) according to the manufacturer’s instructions.
Purification of Proteins by Affinity Chromatography
Agarose resin conjugated to anti-FLAG antibody M2 (A2220, Sigma) was used for protein purification. Proteins were extracted by main cultures inoculated and expressed as described above. Cells were harvested by centrifugation for 10 min at 4°C and 9,500 g, the cell pellet was re-suspended in lysis buffer (50 mM Tris/HCl pH 7.4, 100 mM NaCl and 1% TritonX) and lysed by sonication on ice. Cell lysates were clarified by centrifugation for 30 min at 4°C and 17,000 g and filtered with a syringe filter (0.45 μm). The proteins were purified using an agarose resin conjugated to anti-FLAG antibody M2 (A2220, Sigma) for 1.5 h, 4°C rotating. The resin was washed four times with 1 mL TBS for 5 min, 1,000 g, 4°C. Elution was carried out by 200 μl TBS containing 150 μg/ml of 3 × FLAG peptide (F4799, Sigma) and subsequently shaking at 4°C for 1 h. Further the resin was centrifuged at 8,200 g for 3 min and the supernatant was taken as protein solution. The concentrations of purified proteins were obtained by the absorbance at 280 nm using the NanoDrop® ND-1000 Spectrophotometer (PEQLAB Biotechnologie GmbH, Erlangen, Germany).
Homology Modeling
Homology model of the nuclease domain of Xds protein structure was modeled with the Phyre2 server using the intensive search mode (). Three templates (4ruw: 20% s.id, 4zkf: 13% s.id., 3ngo: 13% s.id.) were selected to model 94% of the residues at >90% confidence.
DNase Agar Activity Test
DNase test agar (BD) was used according to manufactures protocol. Plates containing 0.5 mM IPTG and 100 μg/ml Ap were inoculated with respective strains and incubated at 37°C for 48 h before the standard HCl-DNA precipitation method for detection of DNA was used ().
DNase Activity Assay Using Agarose Gel Electrophoresis
DNase activity assay using a defined PCR fragment was performed as described previously (; ). Bacterial strains were grown and induced with 0.5 mM IPTG for 4 h as described above. Cells were pelleted by centrifugation at 5,000 g for 5 min and supernatants were used for incubation at RT for 8 and 16 h, respectively. A 600 ng PCR fragment [1 kb fragment of the cat gene amplified from pAC1000 (Table 1) using oligonucleotides CAT_BamHI_Fw and CAT_BamHI_Rev (Table 2)] was used as a substrate in combination with 5× buffer (50 mM Tris/HCl pH7, 100 mM NaCl, 10 mM MgCl2, and 20 mM CaCl2). Finally, samples were visualized on agarose gels (0.8%).
Real Time DNase Activity Assay Using SYBR Green I (SGI)
Nuclease assay with SGI nucleic acid stain (Invitrogen) was performed similar than described by and Zheng et al. (2013)As the truncated Xds-version. Briefly a 100 bp DNA fragment amplified by Xds_EcoRI_1 and His837Ala_3 was used as linearized dsDNA (standard 53% GC content) (see Table 2), whereas pRS415 served as template for circular dsDNA. For determination of Xds activity on DNA with variation in GC content, the 100 bp fragment was amplified using C. acnes chromosomal DNA with CA_Fw and CA_Rev (67% GC), and H. influenzae chromosomal DNA with HI_Fw and HI_Rev (31% GC), respectively (see Tables 1, 2). The substrate DNA was stained with SGI (1.000×) for 1 h at RT. FLAG purified protein (0.5 μg) was incubated with 220 ng of stained DNA substrate and 10 μl of buffer (different compositions). The reaction volume was filled up with distilled water to a total of 50 μl. Fluorescence measurements were carried out with a CFX96 Real-Time PCR Detection System (Bio-Rad).
Parameters deduced from the nuclease assay are area under curve (AUC), substrate degradation, duration to degrade 50% of the substrate and endpoint measurement of the remaining substrate in percent. AUC was calculated using GraphPad Prism software (La Jolla, CA, United States) by selecting “Analysis” and then “Area under curve” using 0.0 as a baseline for the y-axis. Substrate degradation was calculated in the linear range predicted between 60 and 80% fluorescence activity.
Statistical Analysis
Data were analyzed using the Mann-Whitney U test or a Kruskal-Wallis test followed by post hoc Dunn’s multiple comparisons. Differences were considered significant at P values of <0.05. GraphPad Prism version 6 was used for all statistical analyses.
Results
Bioinformatical Analysis of Xds
Open reading frame VC2621 (UniProt: Q9KNV9) of V. cholerae O1 El Tor comprises 2610 bp, which encode the 869 amino acid (AA) protein Xds. The predicted molecular weight is 94.3 kDa (). Analysis with SignalP-5.0 software revealed a signal peptide with a cleavage probability of 0.9866 between Ala28 and Asp29, consistent with its extracellular activity (). AA sequence analysis and 3D homology modeling indicated a Lamin-tail domain (LTD) (L30-G134) in the N-terminal part of the protein (Figure 1A) (; ). LTDs are usually found in the C-terminal part of nuclear lamins, which are intermediate filament proteins important for maintenance of cellular integrity. LTDs harbor an immunoglobulin fold and are suggested to be in involved in tethering proteins to membranes in bacteria (; ; ). Additionally, the sequence revealed an OB (oligonucleotide/oligosaccharide binding)-fold from N221-Q300 (Figure 1A). OB-folds can be found in both eukaryotic and prokaryotic proteins and are shown to form protein-DNA, -RNA or -protein interactions (; ; ). Finally, an endonuclease/exonuclease/phosphatase (EEP) domain is located at position G473-I846, which is predicted to hydrolyze the phosphodiester bonds of the nucleotides (Figure 1). A 3D model of the putative nuclease domain (G473-I846) was calculated using Phyre2 based on unpublished structures with Protein Data Bank (PDB)-IDs 4zkf and 4ruw and a nuclease domain (PDB-ID 3ngo) as templates (Figure 1B) (Wang et al., 2010; ). The alignment identified D787 and H837 as potential catalytic residues when compared with other nuclease sequences. Comparisons of the templates showed residues E240, D410, N412, and H529 of 3ngo and residues E351, D496, N498, and H599 of 4zkf to be at equivalent positions as the Xds residues E532, D711, N713, and H837, respectively. These represent metal binding residues in the cleft of the active site. In addition, Xds harbors four cysteines C188, C276, C661, and C684. In silico analyses including 3D modeling did not predict a disulfide-bond within the nuclease domain (). Other potential disulfide bonds could not be predicted, as the lack of a suitable template prevents homology modeling of the entire protein.
FIGURE 1
Elucidation of Optimum Buffer Conditions for Xds
To investigate the activity of the extracellular nuclease, Xds was purified as C-terminal FLAG-tagged protein using the pTRC99a expression system and E. coli BL21 as a host. The nuclease assay was performed using 5.1 pmol of purified full-length Xds and 100 kb of double stranded DNA (dsDNA) fragment stained with SGI as a substrate. Degradation of DNA through hydrolysis of phosphodiester bonds to nucleotides was detected by a decrease in fluorescence excited from SGI bound to dsDNA. This fluorescent-based real time nuclease assay was used to identify the optimal reaction conditions, including concentrations of NaCl, MgCl2, CaCl2, as well as pH and temperature.
To begin with, fastest degradation of DNA was shown for 0 and 100 mM NaCl, whereas higher amounts of NaCl resulted in a decrease in enzyme activity (Figure 2A). The following analysis measuring the area under the curve (AUC) showed a significant difference between 100 mM NaCl when compared to 250 and 350 mM NaCl (Figure 2B). Substrate degradation was evaluated within the linear range predicted between 60 and 80% fluorescence activity. The analysis revealed that Xds degrades 1.7 ng of DNA per minute at 0 mM NaCl and about 1.1 ng DNA per minute at 100 mM NaCl (Figure 2C). Further the enzyme takes 75 min at 0 mM NaCl and 110 min at 100 mM NaCl to degrade 50% of the substrate, respectively (Figure 2D). Endpoint measurement of the remaining substrate (Figure 2E) confirmed that the enzyme was most active at concentration of 0 and 100 mM NaCl.
FIGURE 2

NaCl-dependency of Xds activity. (A) Shown are the relative fluorescence units (RFU) in percent indicating SGI bound to dsDNA. 5.1 pmol of purified Xds was incubated with 220 ng dsDNA (substrate) in Tris/HCl buffer (50 mM, pH7) at 25°C with different salt concentrations, 350 mM NaCl (black), 250 mM NaCl (red), 150 mM NaCl (gray), 100 mM NaCl (orange), and 0 mM NaCl (blue). Fluorescence was measured every 5 min for 12 h. (B–E) Bar charts summarize the enzyme parameters retrieved from the nuclease assays provided in panel A. Shown are the area under the curve (AUC, B), nanogram of substrate degraded per minute (C), duration to degrade 50% of the substrate (D), endpoint measurement of the remaining substrate in percent (E). The data is presented as median from at least nine independent experiments. Error bars indicate the interquartile range. Significant differences to 100 mM NaCl are indicated by an asterisk (P < 0.05 Kruskal-Wallis test followed by post hoc Dunn’s multiple comparison).
The optimum pH for Xds was determined in buffer solutions containing 50 mM Tris/HCl (Figure 3A). The enzyme showed maximum activity at pH 7 to 8. Increasing the pH to 9 or decreasing it to 6 reduced Xds activity. This was also confirmed by measuring the enzyme activity in MES buffer [2-(N-morpholino)ethanesulfonic acid], which provides a higher capacity at pH levels below 7 compared to Tris/HCl (Supplementary Figure 1). AUC measurements (Figure 3B) indicate an optimum pH for exonuclease activity at 7–8. Substrate degradation over time also confirmed pH 7 being the most favorable condition with a turn-over rate of 1.2 ng DNA per minute (Figure 3C), which is concordant with the duration until 50% of the substrate was degraded (Figure 3D). The amount of remaining substrate confirmed pH 7 to 8 to be the optimum condition with approximately 3% DNA left, when compared to other pH conditions with at least 5% DNA measured at the endpoint of the assay (Figure 3E).
FIGURE 3

pH-dependency of Xds activity. (A) Shown are the relative fluorescence units (RFU) in percent indicating SGI bound to dsDNA. 5.1 pmol of purified Xds was incubated with 220 ng dsDNA (substrate) in Tris/HCl buffer (50 mM) and 100 mM NaCl at 25°C with variation in pH, pH 9 (black), pH 8 (red), pH 7 (orange), and pH 6 (gray). Fluorescence was measured every 5 min for 12 h. (B–E) Bar charts summarize the enzyme parameters retrieved from the nuclease assays provided in panel A. Shown are the area under the curve (AUC, B), nanogram of substrate degraded per minute (C), duration to degrade 50% of the substrate (D), endpoint measurement of the remaining substrate in percent (E). The data is presented as median from at least 18 independent experiments. Error bars indicate the interquartile range. Significant differences to pH 7 are indicated by an asterisk (P < 0.05 Kruskal-Wallis test followed by post hoc Dunn’s multiple comparison).
To elucidate the impact of bivalent cations on enzyme activity, different concentrations of MgCl2 and CaCl2 were used in diverse combinations (Figure 4A). No nuclease activity was detected in the absence of CaCl2 (Figure 4A). Presence of 20 mM CaCl2 without addition of MgCl2 showed a slow degradation of DNA after a lag-phase of approximately 3 h. In the presence of both MgCl2 and CaCl2, Xds readily degraded DNA, as highlighted by the rapid decrease in fluorescence. The optimal combination of cofactors for Xds activity was 10 mM MgCl2 and 20 mM CaCl2. This conclusion is supported by (i) a low area under curve (AUC), which reflects an efficient removal of fluorescent substrate (Figure 4B), (ii) fast degradation of DNA per minute (Figure 4C), (iii) relatively short duration until 50% of the substrate was degraded (Figure 4D) and (iv) only minor amounts of substrate remaining at the endpoint (Figure 4E).
FIGURE 4

Xds activity depends on bivalent cations. (A) Shown are the relative fluorescence units (RFU) in percent indicating SGI bound to dsDNA. 5.1 pmol of purified Xds was incubated with 220 ng dsDNA (substrate) in buffer (50 mM Tris/HCl, pH 7; 100 mM NaCl) at 25°C with variation in concentration of MgCl2 and CaCl2. For the assay 40/60 mM MgCl2/CaCl2 (red), 20/40 mM MgCl2/CaCl2 (black), 20/20 mM MgCl2/CaCl2 (gray), 10/20 mM MgCl2/CaCl2 (orange), 10/0 mM MgCl2/CaCl2 (blue), and 0/20 mM MgCl2/CaCl2 (light blue) was used. (B–E) Bar charts summarize the enzyme parameters retrieved from the nuclease assays provided in panel A. Shown are the area under the curve (AUC, B), nanogram of substrate degraded per minute (C), duration to degrade 50% of the substrate (D), endpoint measurement of the remaining substrate in percent (E). The data is presented as median from at least nine independent experiments. Error bars indicate the interquartile range. Significant differences to 10 mM MgCl2 and 20 mM CaCl2 are indicated by an asterisk (P < 0.05 Kruskal-Wallis test followed by post hoc Dunn’s multiple comparison). Data below limit of detections is indicated as not applicable (n. a.).
Finally, we investigated the temperature sensitivity of the enzyme. The enzyme was pre-incubated at 20, 25, 30, 37, or 42°C for 30 min before the substrate was added and the nuclease assay was performed at 25°C (Figure 5). The results indicate that elevated temperatures above 25°C reduce the enzymatic life time of Xds and result in a loss of enzyme activity (Figures 5A–E), highlighted by significantly increased AUC and at least 5 times more substrate remaining at the endpoint of the assay (Figures 5B,E). In addition, pre-incubation at temperatures of 37 and 42°C resulted in a significantly reduced degradation speed in the nuclease assay compared to 25°C (Figures 5C,D).
FIGURE 5

Temperature-dependency of Xds activity. (A) Shown are the relative fluorescence units (RFU) in percent indicating SGI bound to dsDNA. 5.1 pmol of purified Xds was pre-incubated for 30 min at different temperatures 20°C (black), 25°C (orange), 30°C (red), 37°C (gray), 42°C (blue) with 220 ng dsDNA (substrate) in Tris/HCl buffer (50 mM, pH 7). Fluorescence was measured every 5 min for 12 h. (B–E) Bar charts summarize the enzyme parameters retrieved from the nuclease assays provided in panel A. Shown are the area under the curve (AUC, B), nanogram of substrate degraded per minute (C), duration to degrade 50% of the substrate (D), endpoint measurement of the remaining substrate in percent (E). The data is presented as median from at least 18 independent experiments. Error bars indicate the interquartile range. Significant differences to 25°C are indicated by an asterisk (P < 0.05 Kruskal-Wallis test followed by post hoc Dunn’s multiple comparison).
Previous studies using supernatants of V. cholerae deletion mutants and complementation strains indicated that Dns acts as an endonuclease, whereas Xds is only capable of degrading linearized DNA, defining it as exonuclease (
Elucidation of Xds Domains Important for Exonuclease Function
Xds harbors several domains allocated to different protein families, which are connected by large, unstructured linker regions (Figure 1A). The N-terminal part of the enzyme contains a LTD (L30-G134, previously S39-G137), followed by an OB (oligonucleotide binding)-fold (N221-Q300) and the C-terminal domain (G473-I846) allocated to the EEP family (
Therefore, a more sophisticated assay to test nuclease activity was carried out. SGI stained dsDNA was used as substrate to measure DNA degradation by purified Xds-versions in real time in the optimal buffer condition (50 mM Tris/HCl, 100 mM NaCl, 10 mM MgCl2, 20 mM CaCl2, pH 7) (Figure 6). Most efficient degradation of DNA was observed for full-length Xds. Concordant with results obtained by assays described above, protein truncations extending to the start of the OB domain (ΔS39-I200) showed no activity in this assay.
FIGURE 6

Nuclease activity of various Xds truncations and points mutants compared to full-length Xds. (A,B) Shown are RFU in percent indicating SGI bound to dsDNA. 5.1 pmol of purified Xds (full-length) and truncated versions of the protein were incubated with 220 ng dsDNA as a substrate. Fluorescence was measured every 5 min for 12 h in the optimal buffer conditions determined earlier (i.e., 50 mM Tris/HCl pH 7, 100 mM NaCl, 10 mM MgCl2, and 20 mM CaCl2) at 25°C. (A) Shown is the altered enzyme activity of the Xds truncations ΔS39-G137 (red), ΔS39-S184 (gray), ΔS39-I200 (black), ΔL30-S184 (light blue), and ΔL30-I200 (yellow) compared to full-length Xds (orange). (B) Shown is the altered enzyme activity of Xds point-mutants XdsD787A (light blue), XdsH837A (yellow), XdsC188A (blue), XdsC276A (gray), XdsC661A (red), and XdsC684A (black) compared to full-length Xds (orange). (C–F) Bar charts summarize the enzyme parameters retrieved from the nuclease assays provided in panels A and B. Shown are the area under the curve (AUC, C), nanogram of substrate degraded per minute (D), duration to degrade 50% of the substrate (E), endpoint measurement of the remaining substrate in percent (F). The data is presented as median from at least nine independent experiments. Error bars indicate the interquartile range. Significant differences to Xds (full-length) are indicated by an asterisk (P < 0.05 Kruskal-Wallis test followed by post hoc Dunn’s multiple comparison). Data below limit of detections is indicated as not applicable (n. a.).
As mentioned above, the LTD boundaries changed from S39-G137 to L30-G134 during the study (
Furthermore, we constructed several truncated enzymes to remove specific domains, i.e., ΔL30-G134 [deletion of LTD domain according to current annotation (
In summary, activity assays using diverse truncated versions of Xds demonstrate that the LTD domain is dispensable for nuclease activity, whereas the presence of the OB domain is required. The largest truncated protein that was still active comprises a deletion of AAL30 to S184.
Characterization of the Active Center
Additionally, we tried to pinpoint the active center of the exonuclease domain. Two AA D787 and H837, were predicted by Phyre2 analysis to form the active center when compared to other nuclease templates in the PDB. In comparison to full-length Xds, the point mutants XdsH837A and XdsD787A exhibited no or at least, severely decreased enzyme activity (Figure 6B), while immunoblot analyses revealed stable expression of the Xds point mutants (Supplementary Figure 7). These results were also confirmed by testing the mutants on DNase test agar plates, where XdsD787A shows only a slight clearance zone around the expression strain, whereas for the strain expressing XdsH837A no clearance could be observed (Figure 7A). Moreover, the point mutants exhibited no enzymatic activity on linearized DNA as visualized by gel electrophoresis (Figure 7C). Thus, Xds points mutants XdsH837A and XdsD787A are significantly impaired for nuclease activity in all assays.
FIGURE 7

Xds point mutants exhibit different extracellular nuclease activities. (A)V. cholerae strains harboring different truncations were grown on DNase test agar and incubated with 1 N HCl after 48 h. Shown is either the WT strain C6709with empty vector (WT p), C6709ΔxdsΔdns with empty vector (ΔΔ p) or C6709ΔxdsΔdns expressing Xds point mutants as indicated. (B) Diameter of clearing zones are indicated for strains listed above. Shown are medians from at least 12 independent measurements. The error bars indicate the interquartile range. Significant differences between the data sets are marked by asterisk (P < 0.05 Kruskal-Wallis test followed by post hoc Dunn’s multiple comparison). Data below limit of detections is indicated as not applicable (n. a). (C) Supernatants derived from bacterial cultures (listed above) were assayed for their nuclease activity by adding 600 ng of linearized DNA. After incubation for 8 and 16 h the DNA degradation was visualized on agarose gels. Incubation time is indicated on top of each panel.
Further, the AA sequence of Xds postulated four cysteine residues. C188 and C276 are in closer proximity at the N-terminal part of the protein, whereas C661 and C684 are located in the predicted exonuclease domain at the C-terminal part. Cysteine residues can from disulfide bonds which may be involved in correct folding, thereby affecting enzyme activity or their secretion [e.g., via the type 2 secretion machinery (T2SS)]. As bioinformatical analyses of Xds revealed no clear prediction on potential disulfide bond formation, all four cysteines were exchanged to alanine and their function was tested on DNase test agar plates, via gel electrophoresis (Figures 7A–C) as well as via real time nuclease assay (Figure 6B). Immunoblot analyses revealed stable expression in V. cholerae for all Xds point mutants (Supplementary Figure 7). No DNA degradation was detected on DNase test agar plates for strains expressing XdsC188A, XdsC276A, and XdsC661A, whereas a minimal zone of clearance could be detected for the strain expressing XdsC684A (Figure 7A). Notably, the clearance zone of the strain expressing XdsC684A was significantly smaller compared to the strain expressing Xds full-length (Figure 7B). Thus, all four Xds versions with cysteine to alanine exchanges showed less DNA degradation on DNase test agar plates. Concordant with these observations, real time degradation assays revealed impaired activity for XdsC684A and no activity for XdsC661A (Figures 6B–F). In contrast, XdsC188A and XdsC276A showed no significant difference compared to full-length Xds (Figures 6B–F). Reducing conditions using 1.4 dithiotreitol (DTT) did not affect enzyme activity in the real time nuclease assay. Thus, potential disulfide bonds formed by the cysteines seem dispensable for Xds activity (Supplementary Figure 8). Notably, detectable activity on DNase test agar plates and gel electrophoresis assay requires export of the enzyme and proper folding after secretion, which might be affected by the cysteine mutations and could explain these somewhat disparate results. Thus, we aimed to investigate the localization of Xds.
Cellular Localization of Xds
To investigate the localization of Xds in V. cholerae whole cell lysates (WCL), cytoplasmic fractions (CF), periplasmic fractions (PF), membrane fractions (MF) and supernatant were collected. Comparative analyses via Kang-stained gels revealed equal protein amounts for full-length Xds, the LTD deletion, as well as the two cysteine mutations analyzed (Supplementary Figures 9A–D). Samples were subjected to immunoblot analysis for the detection of FLAG-tagged proteins. Fractionation of bacteria expressing Xds full-length revealed the majority of the protein located in the WCL as well as in the MF and only a small amount in the cytoplasm and periplasm (Figure 8A). Despite several attempts using ammonium sulfate and TCA precipitated supernatant samples no detectable signal for Xds could be observed in the supernatant (data not shown). Given the presence of signal peptide for the Sec system, export via the T2SS would be the most likely option. However, a mutant of the T2SS still exhibits decent Xds activity on DNase test agar plates despite the general growth defect of T2SS mutants (Supplementary Figures 10A,B). Thus, Xds of V. cholerae might not be secreted into the supernatant, but rather remain associated to the bacterial surface. Hence, we focused on the residual fractions for localization analyses. In silico analysis of the Xds sequence revealed a N-terminal LTD (Figure 1) (
FIGURE 8

Localization of full-length Xds, the ΔS39-G137 truncation and the cysteine point mutants XdsC188A and XdsC276A through fractionation. Shown are representative immunoblots detecting FLAG-tagged Xds versions in whole cell lysates (WCL), cytoplasmic fraction (CF), periplasmic fractions (PF) and membrane fraction of strain C6709ΔxdsΔdns expressing FLAG-tagged full-length Xds (A), the ΔS39-G137 truncation (B) or the point mutants XdsC188A(C) and XdsC276A(D). Semiquantitative densitometric evaluation of detected FLAG-tagged Xds versions was performed with the Quantity One software (Bio-Rad Laboratories) and is indicated below the representative immunoblots as arbitrary intensity units (AIU) of detected FLAG-Xds normalized to WCL, which was always set to 1. At least four independent whole cell extracts of each strain were analyzed. The data is given as median with maximum (superscript) and minimum (subscript). Equal amounts of proteins for WCL, CF, PF, and MF were loaded to allow direct comparison of the fractions. SDS gels stained with Kang solution as loading control are provided in Supplementary Figure 9.
Discussion
The extracellular nuclease Xds has been recently reported to play key roles in colonization fitness of V. cholerae and biofilm formation (
The optimum pH for the exonuclease was shown to be at pH 7 to 8, which is consistent with the optimum pH for Dns activity (
Using the optimized buffer conditions, several additional enzyme characteristics were elucidated. Purified Xds seems to be heat-sensitive as incubation temperatures above 30°C shortened the life time of the enzyme. Variation of the GC content of the linear dsDNA substrate revealed a higher Xds activity for AT-rich fragments. We speculate that the weaker stability of the A/T hydrogen bonding allows an easier strand separation and results in faster hydrolysis of the DNA to nucleotides. Consistent with a previous report (
Moreover, we constructed point mutations in two residues predicted to lie within the enzymatic active center by in silico analyses, changing D787 and H837 to alanine. Real time activity assays elucidated that XdsD787A is heavily impaired for DNA degradation and XdsH837A shows no nuclease activity. The H837 might have a crucial role to act as the general base in activation of the water molecule for the nucleophilic in-line attack on the phosphorous atom during the nuclease reaction as suggested by other studies (
The present work characterized the V. cholerae extracellular nuclease Xds with regard to the optimum reaction conditions including pH, salt concentration, bivalent cations, and temperature as well as identification of a domain within the protein important for its enzymatic activity. This is a first step toward a better understanding of the enzymatic properties of Xds affecting V. cholerae’s survival fitness in the aquatic environment as well as colonization fitness in the human host.
Statements
Data availability statement
All datasets generated for this study are included in the manuscript and/or the Supplementary Files.
Author contributions
KP, MO, JR, and SS designed the study. KP, FM, DV, and MO performed the experiments and/or the analysis. KP, FM, DV, MO, JR, and SS contributed to the discussion and data evaluation. KP, MO, JR, and SS wrote the manuscript.
Funding
The work was supported by the Austrian Science Fund (FWF) grants: W901 (DK Molecular Enzymology) to KP, DV, JR, and SS, the doc.fund “Molecular Metabolism” to MO and SS as well as P27654 to SS.
Acknowledgments
We are thankful to E. L. Zechner for critical reading of the manuscript and C. Radler for her support along the graphical illustration of the Xds model.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2019.02057/full#supplementary-material
References
1
Allesen-HolmM.BarkenK. B.YangL.KlausenM.WebbJ. S.KjellebergS.et al (2006). A characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms.Mol. Microbiol.591114–1128. 10.1111/j.1365-2958.2005.05008.x
2
Almagro-MorenoS.KimT. K.SkorupskiK.TaylorR. K. (2015). Proteolysis of virulence regulator ToxR is associated with entry of Vibrio cholerae into a dormant state.PLoS Genet.11:e1005145. 10.1371/journal.pgen.1005145
3
AltermarkB.NiiranenL.WillassenN. P.SmalasA. O.MoeE. (2007). Comparative studies of endonuclease i from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae.FEBS J.274252–263.
4
ArcusV. (2002). OB-fold domains: a snapshot of the evolution of sequence, structure and function.Curr. Opin. Struct. Biol.12794–801. 10.1016/s0959-440x(02)00392-5
5
BennishM. L. (1994). “Cholera: pathophysiology, clinical features, and treatment,” in Vibrio Cholerae and Cholera: Molecular to Global Persepectives, edsWachsmuthK. I.BlakeP. A.OlsikO. (Washington, D.C: ASM Press), 229–255. 10.1128/9781555818364.ch15
6
BerkV.FongJ. C.DempseyG. T.DeveliogluO. N.ZhuangX.LiphardtJ.et al (2012). Molecular architecture and assembly principles of Vibrio cholerae biofilms.Science337236–239. 10.1126/science.1222981
7
BinnenkadeL.KreienbaumM.ThormannK. M. (2018). Characterization of ExeM, an extracellular nuclease of Shewanella oneidensis MR-1.Front. Microbiol.9:1761. 10.3389/fmicb.2018.01761
8
BlokeschM.SchoolnikG. K. (2008). The extracellular nuclease Dns and its role in natural transformation of Vibrio cholerae.J. Bacteriol.1907232–7240. 10.1128/JB.00959-08
9
BrinkmannV.ReichardU.GoosmannC.FaulerB.UhlemannY.WeissD. S.et al (2004). Neutrophil extracellular traps kill bacteria.Science3031532–1535. 10.1126/science.1092385
10
Bueren-CalabuigJ. A.CoderchC.RicoE.Jimenez-RuizA.GagoF. (2011). Mechanistic insight into the catalytic activity of betabetaalpha-metallonucleases from computer simulations: vibrio vulnificus periplasmic nuclease as a test case.Chembiochem122615–2622. 10.1002/cbic.201100485
11
CashR. A.MusicS. I.LibonatiJ. P.SnyderM. J.WenzelR. P.HornickR. B. (1974). Response of man to infection with Vibrio cholerae. i. clinical, serologic, and bacteriologic responses to a known inoculum.J. Infect. Dis.12945–52. 10.1093/infdis/129.1.45
12
CeroniA.PasseriniA.VulloA.FrasconiP. (2006). DISULFIND: a disulfide bonding state and cysteine connectivity prediction server.Nucleic Acids Res.34W177–W181.
13
ColwellR. R. (1996). Global climate and infectious disease: the cholera paradigm.Science2742025–2031. 10.1126/science.274.5295.2025
14
ColwellR. R. (2004). Infectious disease and environment: cholera as a paradigm for waterborne disease.Int. Microbiol.7285–289.
15
DengJ.JinY.ChenG.WangL. (2012). Label-free fluorescent assay for real-time monitoring site-specific DNA cleavage by EcoRI endonuclease.Analyst1371713–1717. 10.1039/c2an16287c
16
DonnenbergM. S.KaperJ. B. (1991). Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector.Infect. Immun.594310–4317.
17
DouglasH. C.GunterS. E. (1946). The taxonomic position of Corynebacterium acnes.J. Bacteriol.5215–23.
18
FallingborgJ. (1999). Intraluminal pH of the human gastrointestinal tract.Dan. Med. Bull.46183–196.
19
FocaretaT.ManningP. A. (1991). Distinguishing between the extracellular DNases of Vibrio cholerae and development of a transformation system.Mol. Microbiol.52547–2555. 10.1111/j.1365-2958.1991.tb02101.x
20
FuchsE.YangY. (1999). Crossroads on cytoskeletal highways.Cell98547–550. 10.1016/s0092-8674(00)80041-0
21
FuchsT. A.AbedU.GoosmannC.HurwitzR.SchulzeI.WahnV.et al (2007). Novel cell death program leads to neutrophil extracellular traps.J. Cell. Biol.176231–241. 10.1083/jcb.200606027
22
GodekeJ.HeunM.BubendorferS.PaulK.ThormannK. M. (2011). Roles of two Shewanella oneidensis MR-1 extracellular endonucleases.Appl. Environ. Microbiol.775342–5351. 10.1128/AEM.00643-11
23
GrayE. G. (1975). Synaptic fine structure and nuclear, cytoplasmic and extracellular networks: the stereoframework concept.J. Neurocytol.4315–339. 10.1007/bf01102116
24
GrayH. B.Jr.OstranderD. A.HodnettJ. L.LegerskiR. J.RobbersonD. L. (1975). Extracellular nucleases of Pseudomonas BAL 31. I. characterization of single strand-specific deoxyriboendonuclease and double-strand deoxyriboexonuclease activities.Nucleic Acids Res.21459–1492. 10.1093/nar/2.9.1459
25
GumpenbergerT.VorkapicD.ZinglF. G.PresslerK.LacknerS.SeperA.et al (2016). Nucleoside uptake in Vibrio cholerae and its role in the transition fitness from host to environment.Mol. Microbiol.99470–483. 10.1111/mmi.13143
26
HanahanD. (1983). Studies on transformation of Escherichia coli with plasmids.J. Mol. Biol.166557–580. 10.1016/s0022-2836(83)80284-8
27
HavaD. L.HemsleyC. J.CamilliA. (2003). Transcriptional regulation in the Streptococcus pneumoniae rlrA pathogenicity islet by RlrA.J. Bacteriol.185413–421. 10.1128/jb.185.2.413-421.2003
28
HortonR. M.HuntH. D.HoS. N.PullenJ. K.PeaseL. R. (1989). Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.Gene7761–68. 10.1016/0378-1119(89)90359-4
29
HostackaA.CiznarI.StefkovicovaM. (2010). Temperature and pH affect the production of bacterial biofilm.Folia Microbiol.5575–78. 10.1007/s12223-010-0012-y
30
HuqA.ColwellR. R.RahmanR.AliA.ChowdhuryM. A.ParveenS.et al (1990). Detection of Vibrio cholerae O1 in the aquatic environment by fluorescent-monoclonal antibody and culture methods.Appl. Environ. Microbiol.562370–2373.
31
HuqA.WhitehouseC. A.GrimC. J.AlamM.ColwellR. R. (2008). Biofilms in water, its role and impact in human disease transmission.Curr. Opin. Biotechnol.19244–247. 10.1016/j.copbio.2008.04.005
32
Interpro (2017). InterPro: Protein Sequence Analysis & Classification. Available at: https://www.ebi.ac.uk/interpro/(accessed October 31, 2017).
33
Interpro (2019). InterPro: Protein Sequence Analysis & Classification. Available at: https://www.ebi.ac.uk/interpro/(accessed July 7, 2019).
34
JeffriesC. D.HoltmanD. F.GuseD. G. (1957). Rapid method for determining the activity of microorganisms on nucleic acids.J. Bacteriol.73590–591.
35
KangD.GhoY. S.SuhM.KangC. (2002). Highly sensitive and fast protein detection with coomassie brilliant blue in sodium dodecyl sulfate-polyacrylamide gel electrophoresis.Bull. Kor. Chem. Soc.231511–1512. 10.5012/bkcs.2002.23.11.1511
36
KEGG (2017). Vibrio Cholerae O1 El Tor N16961: VC2621. Available: http://www.genome.jp/dbget-bin/www_bget?vch:VC2621(accessed 31 October, 2017).
37
KelleyL. A.MezulisS.YatesC. M.WassM. N.SternbergM. J. (2015). The Phyre2 web portal for protein modeling, prediction and analysis.Nat. Protoc.10845–858. 10.1038/nprot.2015.053
38
KiedrowskiM. R.KavanaughJ. S.MaloneC. L.MootzJ. M.VoyichJ. M.SmeltzerM. S.et al (2011). Nuclease modulates biofilm formation in community-associated methicillin-resistant Staphylococcus aureus.PLoS One6:e26714. 10.1371/journal.pone.0026714
39
KimS. Y.KohnoT.MoriT.KitanoK.HakoshimaT. (2017). Crystal Structure of Human Phosphodiesterase 12. Available at: https://rcsb.org/structure/4ZKF(accessed 29 Apirl, 2019).
40
KolterR.InuzukaM.HelinskiD. R. (1978). Trans-complementation-dependent replication of a low molecular weight origin fragment from plasmid R6K.Cell151199–1208. 10.1016/0092-8674(78)90046-6
41
KrimmI.OstlundC.GilquinB.CouprieJ.HossenloppP.MornonJ. P.et al (2002). The Ig-like structure of the C-terminal domain of lamin A/C, mutated in muscular dystrophies, cardiomyopathy, and partial lipodystrophy.Structure10811–823. 10.1016/s0969-2126(02)00777-3
42
LinkA. J.LabaerJ. (2011). Trichloroacetic acid (TCA) precipitation of proteins.Cold Spring Harb Protoc.2011993–994.
43
MansB. J.AnantharamanV.AravindL.KooninE. V. (2004). Comparative genomics, evolution and origins of the nuclear envelope and nuclear pore complex.Cell Cycle31612–1637.
44
McDonoughE.KampH.CamilliA. (2015). Vibrio cholerae phosphatases required for the utilization of nucleotides and extracellular DNA as phosphate sources.Mol. Microbiol.99453–469. 10.1111/mmi.13128
45
McDonoughE.LazinskiD. W.CamilliA. (2014). Identification of in vivo regulators of the Vibrio cholerae xds gene using a high-throughput genetic selection.Mol. Microbiol.92302–315. 10.1111/mmi.12557
46
MillerV. L.MekalanosJ. J. (1988). A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.J. Bacteriol.1702575–2583. 10.1128/jb.170.6.2575-2583.1988
47
MitchellA.ChangH. Y.DaughertyL.FraserM.HunterS.LopezR.et al (2015). The InterPro protein families database: the classification resource after 15 years.Nucleic Acids Res.43D213–D221. 10.1093/nar/gku1243
48
MitchellA. L.AttwoodT. K.BabbittP. C.BlumM.BorkP.BridgeA.et al (2019). InterPro in 2019: improving coverage, classification and access to protein sequence annotations.Nucleic Acids Res.47D351–D360. 10.1093/nar/gky1100
49
MulcahyH.Charron-MazenodL.LewenzaS. (2010). Pseudomonas aeruginosa produces an extracellular deoxyribonuclease that is required for utilization of DNA as a nutrient source.Environ. Microbiol.121621–1629. 10.1111/j.1462-2920.2010.02208.x
50
MurzinA. G. (1993). OB(oligonucleotide/oligosaccharide binding)-fold: common structural and functional solution for non-homologous sequences.EMBO J.12861–867. 10.1002/j.1460-2075.1993.tb05726.x
51
NCBI (2015). Extracellular Nuclease [Pseudomonas Aeruginosa PA38182]. Available at: http://www.ncbi.nlm.nih.gov/protein/CDI92373(accessed 29 April, 2019).
52
NeuH. C.HeppelL. A. (1965). The release of enzymes from Escherichia coli by osmotic shock and during the formation of spheroplasts.J. Biol. Chem.2403685–3692.
53
NewlandJ. W.GreenB. A.FouldsJ.HolmesR. K. (1985). Cloning of extracellular DNase and construction of a DNase-negative strain of Vibrio cholerae.Infect. Immun.47691–696.
54
OlivaC.Sanchez-MurciaP. A.RicoE.BravoA.MenendezM.GagoF.et al (2017). Structure-based domain assignment in Leishmania infantum EndoG: characterization of a pH-dependent regulatory switch and a C-terminal extension that largely dictates DNA substrate preferences.Nucleic Acids Res.459030–9045. 10.1093/nar/gkx629
55
OsbornM. J.WuH. C. (1980). Proteins of the outer membrane of Gram-negative bacteria.Annu. Rev. Microbiol.34369–422.
56
PapayannopoulosV.ZychlinskyA. (2009). NETs: a new strategy for using old weapons.Trends Immunol.30513–521. 10.1016/j.it.2009.07.011
57
PrattJ. T.McDonoughE.CamilliA. (2009). PhoB regulates motility, biofilms, and cyclic di-GMP in Vibrio cholerae.J. Bacteriol.1916632–6642. 10.1128/JB.00708-09
58
PresslerK.VorkapicD.LichteneggerS.MalliG.BarilichB. P.CakarF.et al (2016). AAA+ proteases and their role in distinct stages along the Vibrio cholerae lifecycle.Int. J. Med. Microbiol.306452–462. 10.1016/j.ijmm.2016.05.013
59
RobertsA.PearsonG. D.MekalanosJ. J. (1992). “Cholera vaccines strains derived from a 1991 Peruvian isolate of Vibrio cholerae and other(El)Tor strains,” in Proceedings of the. 28th Joint Conference, Japan.
60
RoierS.FenningerJ. C.LeitnerD. R.RechbergerG. N.ReidlJ.SchildS. (2013). Immunogenicity of Pasteurella multocida and Mannheimia haemolytica outer membrane vesicles.Int. J. Med. Microbiol.303247–256. 10.1016/j.ijmm.2013.05.001
61
RoierS.LeitnerD. R.IwashkiwJ.Schild-PrufertK.FeldmanM. F.KrohneG.et al (2012). Intranasal immunization with nontypeable Haemophilus influenzae outer membrane vesicles induces cross-protective immunity in mice.PLoS One7:e42664. 10.1371/journal.pone.0042664
62
SahuP. K.IyerP. S.OakA. M.PardesiK. R.ChopadeB. A. (2012). Characterization of eDNA from the clinical strain Acinetobacter baumannii AIIMS 7 and its role in biofilm formation.ScientificWorldJournal2012:973436. 10.1100/2012/973436
63
SchildS.TamayoR.NelsonE. J.QadriF.CalderwoodS. B.CamilliA. (2007). Genes induced late in infection increase fitness of Vibrio cholerae after release into the environment.Cell Host Microbe.2264–277. 10.1016/j.chom.2007.09.004
64
SeperA.FenglerV. H.RoierS.WolinskiH.KohlweinS. D.BishopA. L.et al (2011). Extracellular nucleases and extracellular DNA play important roles in Vibrio cholerae biofilm formation.Mol. Microbiol.821015–1037. 10.1111/j.1365-2958.2011.07867.x
65
SeperA.HosseinzadehA.GorkiewiczG.LichteneggerS.RoierS.LeitnerD. R.et al (2013). Vibrio cholerae Evades neutrophil extracellular traps by the activity of two extracellular nucleases.PLoS Pathog.9:e1003614. 10.1371/journal.ppat.1003614
66
ShikumaN. J.FongJ. C.OdellL. S.PerchukB. S.LaubM. T.YildizF. H. (2009). Overexpression of VpsS, a hybrid sensor kinase, enhances biofilm formation in Vibrio cholerae.J. Bacteriol.1915147–5158. 10.1128/JB.00401-09
67
SmithM. G.GianoulisT. A.PukatzkiS.MekalanosJ. J.OrnstonL. N.GersteinM.et al (2007). New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.Genes Dev.21601–614. 10.1101/gad.1510307
68
SteichenC. T.ChoC.ShaoJ. Q.ApicellaM. A. (2011). The Neisseria gonorrhoeae biofilm matrix contains DNA, and an endogenous nuclease controls its incorporation.Infect. Immun.791504–1511. 10.1128/IAI.01162-10
69
TamayoR.PatimallaB.CamilliA. (2010). Growth in a biofilm induces a hyperinfectious phenotype in Vibrio cholerae.Infect. Immun.783560–3569. 10.1128/iai.00048-10
70
TamplinM. L.GauzensA. L.HuqA.SackD. A.ColwellR. R. (1990). Attachment of Vibrio cholerae serogroup O1 to zooplankton and phytoplankton of Bangladesh waters.Appl. Environ. Microbiol.561977–1980.
71
TheobaldD. L.Mitton-FryR. M.WuttkeD. S. (2003). Nucleic acid recognition by OB-fold proteins.Annu. Rev. Biophys. Biomol. Struct.32115–133. 10.1146/annurev.biophys.32.110601.142506
72
VlassovV. V.LaktionovP. P.RykovaE. Y. (2007). Extracellular nucleic acids.Bioessays29654–667.
73
WangH.HuangY.WuS.LiY.YeY.ZhengY.et al (2014). Extracellular DNA inhibits Salmonella enterica serovar typhimurium and S. enterica Serovar Typhi biofilm development on abiotic surfaces.Curr. Microbiol.68262–268. 10.1007/s00284-013-0468-5
74
WangH.MoritaM.YangX.SuzukiT.YangW.WangJ.et al (2010). Crystal structure of the human CNOT6L nuclease domain reveals strict poly(A) substrate specificity.EMBO J.292566–2576. 10.1038/emboj.2010.152
75
WatnickP.KolterR. (1999). Steps in the develompent of a Vibrio cholerae El Tor biofilm.Mol. Microbiol.34586–595. 10.1046/j.1365-2958.1999.01624.x
76
WatnickP. I.LaurianoC. M.KloseK. E.CroalL.KolterR. (2001). The absence of a flagellum leads to altered colony morphology, biofilm development and virulence in Vibrio cholerae O139.Mol. Microbiol.39223–235. 10.1046/j.1365-2958.2001.02195.x
77
WilcoxK. W.SmithH. O. (1975). Isolation and characterization of mutants of Haemophilus influenzae deficient in an adenosine 5′-triphosphate-dependent deoxyribonuclease activity.J. Bacteriol.122443–453.
78
WuR.JedrzejczakR.JoachimiakA.Midwest Center for Structural Genomics [MCSG] (2014). The Crystal Structure of Endonuclease/Exonuclease/Phosphatase Form Beutenbergia Cavernae DSM 12333. Available at: http://www.rcsb.org/structure/4ruw(accessed 29 April, 2019).
79
WurmP.TutzS.MutsamB.VorkapicD.HeyneB.GrabnerC.et al (2017). Stringent factor and proteolysis control of sigma factor RpoS expression in Vibrio cholerae.Int. J. Med. Microbiol.307154–165. 10.1016/j.ijmm.2017.01.006
80
YildizF. H.SchoolnikG. K. (1999). Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation.Proc. Natl. Acad. Sci. U.S.A.964028–4033. 10.1073/pnas.96.7.4028
81
ZhengA.LuoM.XiangD.XiangX.JiX.HeZ. (2013). A label-free signal amplification assay for DNA detection based on exonuclease III and nucleic acid dye SYBR Green I.Talanta11449–53. 10.1016/j.talanta.2013.03.080
Summary
Keywords
exonuclease, enzyme domains, enzyme properties, active-center, cholera
Citation
Pressler K, Mitterer F, Vorkapic D, Reidl J, Oberer M and Schild S (2019) Characterization of Vibrio cholerae’s Extracellular Nuclease Xds. Front. Microbiol. 10:2057. doi: 10.3389/fmicb.2019.02057
Received
30 April 2019
Accepted
20 August 2019
Published
10 September 2019
Volume
10 - 2019
Edited by
Felipe Cava, Umeå University, Sweden
Reviewed by
Karl Klose, The University of Texas at San Antonio, United States; Thomas Hollis, Wake Forest School of Medicine, United States
Updates

Check for updates
Copyright
© 2019 Pressler, Mitterer, Vorkapic, Reidl, Oberer and Schild.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Stefan Schild, stefan.schild@uni-graz.at
This article was submitted to Microbial Physiology and Metabolism, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.