Abstract
Cholera toxin (CT) and toxin coregulated pilus (TCP, TcpA is the major subunit) are two major virulence factors of Vibrio cholerae, both of which play critical roles in developing severe diarrhea in human. Expression of CT and TCP is under the tight control of the regulatory cascade known as the ToxR virulence regulon, which is composed of three regulators ToxR, TcpP, and ToxT. Besides, their expression is also regulated by the quorum sensing (QS) master regulator HapR and the regulatory protein Fur. Though transcription of tcpP, toxT, and/or tcpA are reported to be regulated by HapR and Fur, to date there are no studies to verify their direct regulations. In the present study, we showed that HapR directly repress the transcription of tcpP and tcpA by binding to their promoter regions, and possibly repress toxT transcription in an indirect manner. Fur directly activated the transcription of tcpP, toxT, and tcpA by binding to their promoters. Taking account of the sequential expression of hapR, fur, tcpP, toxT, and tcpA in the different growth phases of V. cholerae, we deduce that at the early mid-logarithmic growth phase, Fur binds to the promoters of tcpP, toxT, and tcpA to activate their transcription; while at the later mid-logarithmic growth phase, HapR can bind to the promoters of tcpP and tcpA to repress their transcription. Our study reveals the new recognition in the virulence regulatory pathways in V. cholerae and suggests the complicated and subtle regulation network with the growth density dependence.
Introduction
Vibrio cholerae is a Gram-negative bacterium that naturally inhabits salty coastal waters and estuaries (), and some are the causative agent of cholera. Two virulence factors, cholera toxin (CT) and toxin coregulated pilus (TCP), are considered the most closely connected to cholera. CT, encoded by the ctxAB operon in the V. cholerae lysogenic phage CTXΦ, is an AB5 toxin that consists of a single catalytic A-subunit and a pentamer of B-subunits (). It can enhance the concentration of intracellular cyclic AMP, which then causes an imbalance in electrolyte transport across the intestinal epithelial cell membrane, resulting in the secretion of water and electrolytes into the bowel accompanied by severe watery diarrhea, which may lead to death without timely treatment (). TCP, the subunit of which is encoded by tcpA (in the tcpABQCRDSTEF operon), is essential for colonization of V. cholerae in the small intestine at the early stage of infection (). It also functions as the receptor for the CTXΦ ().
The expression of TCP and CT is tightly regulated by a regulatory cascade, referred to as the ToxR virulence regulon (). Under virulence inducing growth conditions, ToxR cooperates with TcpP to bind to the promoter region of toxT to activate its transcription, and ToxT, in turn, activates the transcription of ctxAB and tcpA (; ; ). ToxR alone also can directly activate ctxAB transcription in the presence of bile acids (). While under non-inducing growth conditions, TcpP and ToxT are proteolytically degraded in order to terminate virulence gene expression (; ). The genes for TCP and CT production are also regulated by quorum sensing (QS) (; ), a cell-to-cell communication process that bacteria use to monitor their cell density by detecting the extracellular concentration of autoinducers (AIs), the signaling molecules (). In vibrios, AphA and LuxR orthologs (referred to as the HCD master regulators, HMRs) represent the terminal master regulator of QS operating at low cell density (LCD) and high cell density (HCD), respectively (). AphA, which has interaction with AphB, binds to the promoter of tcpPH to activate its transcription (). HapR (the homologous protein of LuxR) represses the transcription of tcpPH via binding and repression of aphA transcription (). The global regulator cAMP-CRP represses tcpPH transcription via its ability to influence AphA- and AphB-dependent transcriptional activation of tcpPH. This is because the cAMP-CRP binding site is completely within the binding sites of AphA and AphB (). H-NS also has roles in silencing the expression of TCP and CT by binding and repression of ctx, tcp, and toxT promoters (; ). In addition, the ferric uptake regulator Fur seems to have positive regulatory activity on TCP production, because deletion of fur repressed tcp transcription and exhibited very weak autoagglutination, one indicator of the capacity of V. cholerae infection in vivo ().
Although HapR repression of TCP and CT via repression of AphA has been demonstrated, whether HapR can directly regulate the genes within the ToxR virulence regulon or not, needs to be further investigated. In addition, the mechanisms of the Fur-dependent activation of TCP expression are also unclear. Moreover, transcription of fur was under the direct control of HapR, and HapR coordinates with Fur to regulate hlyA transcription (), suggesting Fur integrated into QS to co-regulate gene expression in V. cholerae.
In the present study, we showed that transcription of tcpP, toxT, and tcpA were all cell-density dependent, which may be due to the coordinated regulation of Fur and HapR (Figure 1). At the OD600 value of about 0.7, Fur binds to the promoters of tcpP, toxT, and tcpA to activate their transcription; while at the OD600 value of about 1.0, the QS regulator HapR directly represses the transcription of tcpP and tcpA, but it indirectly represses toxT transcription. The data enriched the regulatory networks that control the expression of virulence determinants in V. cholerae, which promotes a deeper understanding of the pathogenic mechanisms of the pathogen.
FIGURE 1
Materials and Methods
Bacterial Strains and Cultural Conditions
Vibrio cholerae El Tor serogroup O1 strain C7258 (Peru, 1991) was used as the derivative (wild type, WT). Non-polar fur and hapR single-gene deletion mutants Δfur and ΔhapR derived from the WT strain were constructed in our previous study (
TABLE 1
| Target | Primers (forward/reverse, 5′–3′) |
| Construction of mutants | |
| fur | CGGGATCCTTCGTGTAAGGCAGCAGTAATC/CAGAGCGTAAAGCCTATGGATACTTTCCTGTTGATGTTC |
| GAACATCAACAGGAAAGTATCCATAGGCTTTACGCTCTG/GGACTAGTAGATGAAGATGGTGTGGGAAAC | |
| CGGGATCCTTCGTGTAAGGCAGCAGTAATC/GGACTAGTAGATGAAGATGGTGTGGGAAAC | |
| hapR | GCGGGATCCCCAGCAATACATCTTTACC/GTGCTGCCCAAGAAAAGGGGTATATCCTTGCC |
| GGCAAGGATATACCCCTTTTCTTGGGCAGCAC/GCGACTAGTAACTCACCAAAACCTTC | |
| GCGGGATCCCCAGCAATACATCTTTACC/GCGACTAGTAACTCACCAAAACCTTC | |
| lacZ | GCGGGATCCCACGGAGGGAAGGGTAAA/CCTTAAGGCTCTCTGGCCCCTCAAGCCGAGGAGTAAAG |
| CTTTACTCCTCGGCTTGAGGGGCCAGAGAGCCTTAAGG/GGACTAGTCAGCCCAGACAGTGAAGG | |
| GCGGGATCCCACGGAGGGAAGGGTAAA/GGACTAGTCAGCCCAGACAGTGAAGG | |
| Protein expression | |
| fur | GCGGGATCCATGTCAGACAATAACCAAG/GCGAAGCTTTTATTTCTTCGGCTTGTGAG |
| hapR | GCGGGATCCATGGACGCATCAATCGAAAAAC/GCGAAGCTTCTAGTTCTTATAGATACACAG |
| qPCR | |
| tcpP | GCACAAGATCCAATGAAGCC/CTGGTTCTTTTGATTGCCTGAG |
| tcpA | TGGTCTCAGCGGGTGTTG/CATTTGCGTTTGCGGTAGC |
| toxT | TTTTCAGGGTTCTTCTCG/ACAAATATCTGCCCAACG |
| toxR | TTTGTTTGGCGAGAGCAAGG/TCTTCTTCAACCGTTTCCACTC |
| recA | AAGATTGGTGTGATGTTTGGTA/CACTTCTTCGCCTTCTTTGA |
| Primer extension | |
| tcpA | /CCAGAACAATGATTACTTC-HEX |
| Luminescence assay | |
| tcpP | GCGGAGCTCGTGCCTGCTGAGAACTAA/GCGGGATCCCAAAGGTTATCGGGAAAT |
| tcpA | GCGGAGCTCTCCCGACTACTCAGAAAG/GCGGGATCCATTTATATAACTCCACC |
| toxT | GCGGAGCTCGTGAATGTTGGTGG/GCGGGATCCTGCGTTCTACTCTG |
| toxR | GCGGAGCTCTCCGCACCGTCACCGC/GCGGGATCCCTAATGTCCCAGTATC |
| fur | GCGGAGCTCGCATCAAGGCATAAACGG/GCGACTAGTATACTTTCCTGTTGATGTTC |
| hapR | GCGGAGCTCCCAGCAATACATCTTTACC/GCGACTAGTTGAGGCGATAGCCGAGTT |
| DNase I footprinting | |
| tcpP | GTAAAACGACGGCCAGTCAGGAAAGATAATGTAACC/CAGGAAACAGCTATGACGTGTACCAATCAGCCTTT |
| GTAAAACGACGGCCAGTGTGCCTGCTGAGAACTAA/CAGGAAACAGCTATGACGGGCTTTTTTTAACTTTG | |
| tcpA | GTAAAACGACGGCCAGTTCCCAATTGGTTGGCTC/CAGGAAACAGCTATGACCATATTTATATAACTCCACC |
| toxT | GTAAAACGACGGCCAGTCAGGTCGATTTCTTAC/CAGGAAACAGCTATGACTTCCACTATCTATCC |
| GTAAAACGACGGCCAGTCAGGTCGATTTCTTAC/CAGGAAACAGCTATGACCCTTAAACTGCACATC | |
| toxR | GTAAAACGACGGCCAGTTCCGCACCGTCACCGC/CAGGAAACAGCTATGACCCAATATGACTCATCG |
| M13 | FAM-GTAAAACGACGGCCAGT/CAGGAAACAGCTATGAC-HEX |
Oligonucleotide primers used in this study.
All strains were maintained at −80°C in LB broth [1% tryptone (Oxoid), 0.5% yeast extract (Oxoid), and 1% NaCl (Merck Millipore)] containing 30% glycerol (v/v). Unless stated otherwise, V. cholerae strains were cultured with AKI [1.5% Bacto peptone (BD Biosciences), 0.4% yeast extract (Oxoid), 0.5% NaCl (Merck Millipore), and 0.3% NaHCO3 (Merck Millipore)] of the TCP-induced conditions as previously described (
Competition Assay
In vivo competition assay was performed as previously described (
This work was performed in strict accordance with animal protocols approved by the Ethics Committee of the National Institute for Communicable Disease Control and Prevention, China CDC.
Quantitative PCR (qPCR)
Extraction of bacterial total RNAs, generation of cDNAs, and operation of qPCR were performed as previously described (
Luminescence Assay
For the luminescence assay (
DNase I Footprinting Assay
The recombinant proteins His-Fur and His-HapR were expressed using the pET28a plasmid and the Escherichia coli BL21λDE3 cells (
Primer Extension Assay
The primer extension assay was essentially performed as previously described (
Experimental Replicates and Statistical Methods
The competition assay was done at least three independent times with similar results. The data of DNase I footprinting and primer extension were done at least two independent times. The luminescence assay and qPCR were performed with at least three independent bacterial cultures, and the values were expressed as the mean ± standard deviation (SD). Paired Student’s t-test was used to calculate significant differences, P < 0.01 was considered to indicate statistical significance.
Results
Binding Sites of HapR/Fur Were Predicted Within the Regulatory Regions of tcpP, tcpA, and toxT
Toxin coregulated pilus production is under the control of a tightly regulated signaling cascade composed of ToxR, TcpP/H, and ToxT (
TABLE 2
| Fur box-like sequence | HMRs box-like sequence | ||||||
| Operon | First gene | Position& | Sequence | Score | Position& | Sequence | Score |
| toxRS | toxR | NA | NA | NA | NA | NA | NA |
| toxT | D-611…-593 | AATGAAATTTATCCTCATA | 8.9 | NA | NA | NA | |
| tcpPH | tcpP | D-459…-441 | AATTATTTTTTTTATCATT | 9.4 | R-71…-52 | TTTTAATATAATTATTTGCA | 7.7 |
| tcpA-F | tcpA | D-273…-255 | AACGCATTTTATTTGCATT | 7.0 | D-125…-106 | AAAAATGATATCTGTCAATT | 6.1 |
Predicted HMRs/Fur box-like sequences within target promoters.
&‘D’ indicates the direct sequence while ‘R’ the reverse one; minus numbers denote the nucleotide positions upstream of indicated genes; ‘NA’ represents ‘not applicable.’
We considered that Fur may also possibly to regulate the expression or assembly of TCP, since the fur mutant exhibited reduced TCP expression and weak autoagglutination (
Transcription of hapR, fur, tcpP, toxT, and tcpA Were Cell Density-Dependent in the TCP-Induced AKI Culture Condition
A transcriptional luminescence reporter assay was applied to detect the transcriptional changes of hapR, fur, toxR, tcpP, toxT, and tcpA during the growth periods of V. cholerae in the TCP-induced AKI culture condition. As shown in Figure 2, the transcriptional patterns of all of the genes tested were manifested in a cell-density dependent manner. The highest transcriptional levels of hapR and fur occurred at an OD600 value of around 1.0 and 0.7, respectively, which were consistent with that described in a previous report (
FIGURE 2

Cell density–dependent expression of target genes. The WT strain was transformed with a recombinant pBBRlux vector that contains a promoter DNA region of the target gene. The bacteria were cultivated in the TCP-induced AKI conditions to determine the luminescence activity under various OD600 values.
HapR Repressed Transcription of tcpP and tcpA Directly, and Repressed toxT Indirectly
The qPCR results showed that the mRNA transcription of tcpP, toxT, and tcpA were greatly increased in ΔhapR relative to WT (Figure 3A), while that of toxR manifested no obvious difference between ΔhapR and WT (Supplementary Figure S1A). In addition, the luminescence assays showed that the promoter activities of tcpP, toxT, and tcpA in ΔhapR were much higher than that in WT (Figure 3B), whereas that under the control of toxR promoter showed a similar magnitude in ΔhapR and WT (Supplementary Figure S1B). The DNase I footprinting assay disclosed that His-HapR protected a single DNA region within each of the promoters of tcpP and tcpA, located from 48 to 14 and 127 to 95 upstream of tcpP and tcpA against DNase I digestion (Figure 3C), but no HapR binding sites were detected for toxT and toxR (Figure 3C and Supplementary Figure S1C). Thus, HapR inhibits the transcription of tcpP and tcpA in a direct manner, but it indirectly represses toxT transcription and manifests no regulatory action on toxR transcription.
FIGURE 3

Regulation of tcpP, toxT, and tcpA by HapR. (A) qPCR. Relative mRNA levels of the target genes were compared between ΔhapR and WT. (B) The luminescence assay was done as shown in Figure 2. (C) DNase I footprinting. The promoter DNA fragment of each target gene was labeled with FAM and HEX, respectively, and incubated with increasing amounts of purified His-HapR (L-I, -II, and -III contain 0, 2.31, and 6.92 pmol, respectively). After being digested with DNase I, the fragments were analyzed using an ABI 3500XL DNA analyzer. The protected regions are boxed and marked with positions. The negative and positive numbers indicate the nucleotide positions relative to the translation start site (+1) of the corresponding gene.
Fur Directly Activates the Transcriptions of tcpP, toxT, and tcpA
The qPCR assay was employed to investigate the regulatory effects of Fur on the transcription of toxR, tcpP, toxT, and tcpA, and the results showed that the mRNA levels of tcpP, toxT, and tcpA were obviously decreased in Δfur relative to WT (Figure 4A), while that of toxR manifested no obvious difference between Δfur and WT (Supplementary Figure S2A). These results suggested that Fur activates the transcription of tcpP, toxT, and tcpA, but it seems to have no regulatory activity on toxR transcription. In addition, the promoter DNA region of toxR, tcpP, toxT, and tcpA was each cloned into the pBBRlux plasmid, and then transferred into Δfur and WT, respectively, to test the regulatory actions of Fur on their promoter activities. The results showed that the luminescence under the control of tcpP, toxT, or tcpA promoter in Δfur was much lower than that in WT (Figure 4B), whereas that under the control of toxR promoter showed a similar magnitude in Δfur and WT (Supplementary Figure S2B). As further determined by the DNase I footprinting assay, His-Fur protected a single DNA region within each of the promoters of tcpP, toxT, and tcpA, located from 524 to 446, 626 to 537, and 282 to 198 upstream of tcpP, toxT, and tcpA against DNase I digestion in a dose-dependent manner (Figure 4C), but no binding sites were detected for toxR (Supplementary Figure S2C). Thus, Fur activates the transcription of tcpP, toxT, and tcpA in a direct manner, but has no regulatory activity on toxR transcription.
FIGURE 4

Regulation of tcpP, toxT, and tcpA by Fur. The qPCR (A) and DNase I footprinting assays (C) were done as Figure 3, while the luminescence assay (B) was done as Figure 2. L-I, -II, and -III contain 0, 2.95, and 8.85 pmol of His-Fur, respectively.
Identification of the Transcription Start Site for tcpA
The 500 bp upstream DNA regions of tcpP, toxT, and tcpA in El Tor strain C7258 share a high identity (90, 99, and 87%, respectively) in nucleotide sequences with that of in classical biotype strain O395, in which the transcription start sites of these genes have been previously reported (
Fur but Not HapR Plays a Role in Intestinal Colonization of V. cholerae in Infant Mice
The in vivo competition assay was employed to further investigate the ability of Δfur and ΔhapR strains to colonize the small intestine of infant mice in comparison with the ΔlacZ strain (Figure 5). The results showed that the colonization ability of Δfur was attenuated approximately 10-fold, while that of ΔhapR seemed to have no obvious difference compared to ΔlacZ (CI ≈ 1). The same extent colonization capacity of ΔhapR as wild-type V. cholerae has been previously reported (
FIGURE 5

Infant mouse competition assay using Δfur, ΔhapR, and ΔlacZ cells. The Δfur and ΔhapR were competed against ΔlacZ. The competitive index is the ratio of mutant to ΔlacZ recovered from the intestine calculated by the ratio of input mutant to ΔlacZ (inoculated into the mouse). Each data point represents the competitive index from an individual mouse. The line bar represents the geometric mean. The Δfur strain is significantly attenuated (P < 0.01) by Student t-test.
Discussion
Vibrio cholerae expresses the virulence determinants to establish colonization in the gut and cause disease diarrhea. Expression of TCP and CT is highly regulated by environmental stimuli and a variety of regulators (
In the present study, we found a HMRs box-like sequence for each promoter of tcpP and tcpA, suggesting that the transcription of tcpP and tcpA would be under the direct control of HapR in V. cholerae. We observed that HapR binds to the promoters of tcpP and tcpA to repress their transcription when the bacterial cells were harvested at an OD600 value of about 1.0. The HapR binding site for each tcpP and tcpA promoter overlaps the core −10 and/or −35 elements, and thus HapR repression of tcpP and tcpA transcription would be via blocking the entry or elongation of the RNA polymerase. In addition, we noticed that the HapR binding site for tcpA promoter partly overlaps with the sequence protected by ToxT (
FIGURE 6

Promoter organization of target genes. The sequences were derived from Vibrio cholerae El Tor C7258. The transcription/translation start sites are indicated by bent arrows. The –10 and –35 elements are enclosed in boxes. The binding sites of ToxR and TcpP identified by DNase I digestion were previously reported by
HapR is a global regulator that controls the expression of hundreds of genes, particularly those responsible for the motility, biofilm formation, metabolism, and virulence (
The binding sites of Fur usually contain a 19 bp inverted repeat sequence known as the classic Fur box (
Toxin coregulated pilus mostly contributes to the colonization of V. cholerae in the host intestine (
The highest expression levels of tcpP, toxT, and tcpA occurred at an OD600 value of around 0.4, but the lower expression levels were observed at both LCD and HCD. AphA is the bottom master regulator of QS that operates at LCD (
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.
Ethics statement
The animal study was reviewed and approved by the Ethics Committee of the National Institute for Communicable Disease Control and Prevention, China CDC. Written informed consent was obtained from the owners for the participation of their animals in this study.
Author contributions
HG, YZ, and BK conceived the study and designed experimental procedures. JZ, JLo, JLi, QQ, and QS performed the experiments and carried out data analysis. HG, YZ, and BK wrote the manuscript.
Funding
This study was supported by grants from the National Natural Science Foundation of China (Grant No. 81471917) and the Science Foundation for the State Key Laboratory for Infectious Disease Prevention and Control from China (Grant No. 2015SKLID509).
Acknowledgments
We thank Dr. George Osei-Adjei from the Republic of Ghana for language editing the manuscript.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2020.00709/full#supplementary-material
FIGURE S1Regulation of toxR by HapR. The qPCR (A) and DNase I footprinting assays were done as in Figure 3, while the luminescence assay (B) was done as in Figure 2. L-I, -II, and -III contain 0, 2.31, and 6.92 pmol of His-HapR, respectively.
FIGURE S2Regulation of toxR by Fur. The qPCR (A) and DNase I footprinting assays were done as Figure 3, while the luminescence assay (B) was done as in Figure 2. L-I, -II, and -III contain 0, 2.95, and 8.85 pmol of His-Fur, respectively.
FIGURE S3The nucleotide sequences alignment of the promoter DNA regions of tcpP and toxT. The promoter DNA sequences of tcpP, toxT and tcpA were derived from V. cholerae El Tor biotype strain C7258 and classical biotype strain O395. The different bases were labeledred, while the identical bases were marked with asterisk (*). Shown also were the transcription start sites, -10 and -35 boxes.
FIGURE S4Transcription start site of tcpA in V. cholerae El Tor biotype strain C7258. A 5′-HEX-labeled reverse primer was designed to be complementary to the RNA transcript of tcpA. The primer extension products were analyzed with an ABI 3500XL DNA Genetic analyzer. The transcription start site was marked with asterisks andpositions.
Footnotes
References
1
AbuaitaB. H.WitheyJ. H. (2011). Termination of Vibrio cholerae virulence gene expression is mediated by proteolysis of the major virulence activator, ToxT.Mol. Microbiol.811640–1653. 10.1111/j.1365-2958.2011.07798.x
2
BallA. S.ChaparianR. R.van KesselJ. C. (2017). Quorum sensing gene regulation by LuxR/HapR master regulators in Vibrios.J. Bacteriol.199e105–e117. 10.1128/JB.00105-17
3
ChildersB. M.KloseK. E. (2007). Regulation of virulence in Vibrio cholerae: the ToxR regulon.Future Microbiol.2335–344. 10.2217/17460913.2.3.335
4
ClemensJ. D.NairG. B.AhmedT.QadriF.HolmgrenJ. (2017). Cholera.Lancet3901539–1549. 10.1016/S0140-6736(17)30559-7
5
CraigS. A.CarpenterC. D.MeyA. R.WyckoffE. E.PayneS. M. (2011). Positive regulation of the Vibrio cholerae porin OmpT by iron and fur.J. Bacteriol.1936505–6511. 10.1128/JB.05681-11
6
DaviesB. W.BogardR. W.MekalanosJ. J. (2011). Mapping the regulon of Vibrio cholerae ferric uptake regulator expands its known network of gene regulation.Proc. Natl. Acad. Sci. U.S.A.10812467–12472. 10.1073/pnas.1107894108
7
DavisB. M.QuinonesM.PrattJ.DingY.WaldorM. K. (2005). Characterization of the small untranslated RNA RyhB and its regulon in Vibrio cholerae.J. Bacteriol.1874005–4014. 10.1128/JB.187.12.4005-4014.2005
8
DiRitaV. J.ParsotC.JanderG.MekalanosJ. J. (1991). Regulatory cascade controls virulence in Vibrio cholerae.Proc. Natl. Acad. Sci. U.S.A.885403–5407. 10.1073/pnas.88.12.5403
9
EscolarL.Perez-MartinJ.de LorenzoV. (1999). Opening the iron box: transcriptional metalloregulation by the Fur protein.J. Bacteriol.1816223–6229. 10.1128/jb.181.20.6223-6229.1999
10
FaruqueS. M.BiswasK.UddenS. M.AhmadQ. S.SackD. A.NairG. B.et al (2006). Transmissibility of cholera: in vivo-formed biofilms and their relationship to infectivity and persistence in the environment.Proc. Natl. Acad. Sci. U.S.A.1036350–6355. 10.1073/pnas.0601277103
11
GanzT. (2018). Iron and infection.Int. J. Hematol.1077–15. 10.1007/s12185-017-2366-2
12
GaoH.XuJ.LuX.LiJ.LouJ.ZhaoH.et al (2018). Expression of hemolysin is regulated under the collective actions of HapR, Fur, and HlyU in Vibrio cholerae El Tor serogroup O1.Front. Microbiol.9:1310. 10.3389/fmicb.2018.01310
13
GaoH.ZhangL.Osei-AdjeiG.YangW.ZhouD.HuangX.et al (2017). Transcriptional regulation of Q-mfpABC and mfpABC by CalR in Vibrio parahaemolyticus.Microbiologyopen6:e00470. 10.1002/mbo3.470
14
GaoH.ZhangY.YangL.LiuX.GuoZ.TanY.et al (2011). Regulatory effects of cAMP receptor protein (CRP) on porin genes and its own gene in Yersinia pestis.BMC Microbiol.11:40. 10.1186/1471-2180-11-40
15
GaoH.ZhouD.LiY.GuoZ.HanY.SongY.et al (2008). The iron-responsive Fur regulon in Yersinia pestis.J. Bacteriol.1903063–3075. 10.1128/JB.01910-07
16
GossT. J.MorganS. J.FrenchE. L.KrukonisE. S. (2013). ToxR recognizes a direct repeat element in the toxT, ompU, ompT, and ctxA promoters of Vibrio cholerae to regulate transcription.Infect. Immun.81884–895. 10.1128/IAI.00889-12
17
GossT. J.SeabornC. P.GrayM. D.KrukonisE. S. (2010). Identification of the TcpP-binding site in the toxT promoter of Vibrio cholerae and the role of ToxR in TcpP-mediated activation.Infect. Immun.784122–4133. 10.1128/IAI.00566-10
18
HenkeJ. M.BasslerB. L. (2004). Three parallel quorum-sensing systems regulate gene expression in Vibrio harveyi.J. Bacteriol.1866902–6914. 10.1128/JB.186.20.6902-6914.2004
19
HigginsD. E.DiRitaV. J. (1994). Transcriptional control of toxT, a regulatory gene in the ToxR regulon of Vibrio cholerae.Mol. Microbiol.1417–29. 10.1111/j.1365-2958.1994.tb01263.x
20
HungD. T.MekalanosJ. J. (2005). Bile acids induce cholera toxin expression in Vibrio cholerae in a ToxT-independent manner.Proc. Natl. Acad. Sci. U.S.A.1023028–3033. 10.1073/pnas.0409559102
21
IshihamaA. (2000). Functional modulation of Escherichia coli RNA polymerase.Annu. Rev. Microbiol.54499–518. 10.1146/annurev.micro.54.1.499
22
IwanagaM.YamamotoK.HigaN.IchinoseY.NakasoneN.TanabeM. (1986). Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor.Microbiol. Immunol.301075–1083. 10.1111/j.1348-0421.1986.tb03037.x
23
KirnT. J.LaffertyM. J.SandoeC. M.TaylorR. K. (2000). Delineation of pilin domains required for bacterial association into microcolonies and intestinal colonization by Vibrio cholerae.Mol. Microbiol.35896–910. 10.1046/j.1365-2958.2000.01764.x
24
Kleber-JankeT.BeckerW. M. (2000). Use of modified BL21(DE3) Escherichia coli cells for high-level expression of recombinant peanut allergens affected by poor codon usage.Protein Express. Purif.19419–424. 10.1006/prep.2000.1265
25
KovacikovaG.LinW.SkorupskiK. (2004). Vibrio cholerae AphA uses a novel mechanism for virulence gene activation that involves interaction with the LysR-type regulator AphB at the tcpPH promoter.Mol. Microbiol.53129–142. 10.1111/j.1365-2958.2004.04121.x
26
KovacikovaG.SkorupskiK. (2001). Overlapping binding sites for the virulence gene regulators AphA, AphB and cAMP-CRP at the Vibrio cholerae tcpPH promoter.Mol. Microbiol.41393–407. 10.1046/j.1365-2958.2001.02518.x
27
KovacikovaG.SkorupskiK. (2002). Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter.Mol. Microbiol.461135–1147. 10.1046/j.1365-2958.2002.03229.x
28
KrukonisE. S.YuR. R.DiritaV. J. (2000). The Vibrio cholerae ToxR/TcpP/ToxT virulence cascade: distinct roles for two membrane-localized transcriptional activators on a single promoter.Mol. Microbiol.3867–84. 10.1046/j.1365-2958.2000.02111.x
29
LeeH. J.BangS. H.LeeK. H.ParkS. J. (2007). Positive regulation of fur gene expression via direct interaction of fur in a pathogenic bacterium, Vibrio vulnificus.J. Bacteriol.1892629–2636. 10.1128/JB.01791-06
30
Lo ScrudatoM.BlokeschM. (2013). A transcriptional regulator linking quorum sensing and chitin induction to render Vibrio cholerae naturally transformable.Nucleic Acids Res.413644–3658. 10.1093/nar/gkt041
31
LuR.Osei-AdjeiG.HuangX.ZhangY. (2018). Role and regulation of the orphan AphA protein of quorum sensing in pathogenic Vibrios.Future Microbiol.13383–391. 10.2217/fmb-2017-0165
32
MatsonJ. S.DiRitaV. J. (2005). Degradation of the membrane-localized virulence activator TcpP by the YaeL protease in Vibrio cholerae.Proc. Natl. Acad. Sci. U.S.A.10216403–16408. 10.1073/pnas.0505818102
33
MerrittE. A.HolW. G. (1995). AB5 toxins.Curr. Opin. Struct Biolo.5165–171. 10.1016/0959-440x(95)80071-9
34
MeyA. R.WyckoffE. E.KanukurthyV.FisherC. R.PayneS. M. (2005). Iron and fur regulation in Vibrio cholerae and the role of fur in virulence.Infect. Immun.738167–8178. 10.1128/IAI.73.12.8167-8178.2005
35
MillerM. B.SkorupskiK.LenzD. H.TaylorR. K.BasslerB. L. (2002). Parallel quorum sensing systems converge to regulate virulence in Vibrio cholerae.Cell110303–314. 10.1016/s0092-8674(02)00829-2
36
MillerV. L.MekalanosJ. J. (1988). A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae.J. Bacteriol.1702575–2583. 10.1128/jb.170.6.2575-2583.1988
37
NyeM. B.PfauJ. D.SkorupskiK.TaylorR. K. (2000). Vibrio cholerae H-NS silences virulence gene expression at multiple steps in the ToxR regulatory cascade.J. Bacteriol.1824295–4303. 10.1128/jb.182.15.4295-4303.2000
38
OcchinoD. A.WyckoffE. E.HendersonD. P.WronaT. J.PayneS. M. (1998). Vibrio cholerae iron transport: haem transport genes are linked to one of two sets of tonB, exbB, exbD genes.Mol. Microbiol.291493–1507. 10.1046/j.1365-2958.1998.01034.x
39
RutherfordS. T.van KesselJ. C.ShaoY.BasslerB. L. (2011). AphA and LuxR/HapR reciprocally control quorum sensing in Vibrios.Genes Dev.25397–408. 10.1101/gad.2015011
40
SenguptaC.MukherjeeO.ChowdhuryR. (2016). Adherence to Intestinal Cells Promotes Biofilm Formation in Vibrio cholerae.J. Infect. Dis.2141571–1578. 10.1093/infdis/jiw435
41
StonehouseE. A.HulbertR. R.NyeM. B.SkorupskiK.TaylorR. K. (2011). H-NS binding and repression of the ctx promoter in Vibrio cholerae.J. Bacteriol.193979–988. 10.1128/JB.01343-09
42
SunF.GaoH.ZhangY.WangL.FangN.TanY.et al (2012a). Fur is a repressor of biofilm formation in Yersinia pestis.PLoS One7:e52392. 10.1371/journal.pone.0052392
43
SunF.ZhangY.WangL.YanX.TanY.GuoZ.et al (2012b). Molecular characterization of direct target genes and cis-acting consensus recognized by quorum-sensing regulator AphA in Vibrio parahaemolyticus.PLoS One7:e44210. 10.1371/journal.pone.0044210
44
TamayoR.PatimallaB.CamilliA. (2010). Growth in a biofilm induces a hyperinfectious phenotype in Vibrio cholerae.Infect. Immun.783560–3569. 10.1128/IAI.00048-10
45
TaylorR. K.MillerV. L.FurlongD. B.MekalanosJ. J. (1987). Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin.Proc. Natl. Acad. Sci. U.S.A.842833–2837. 10.1073/pnas.84.9.2833
46
TuK. C.LongT.SvenningsenS. L.WingreenN. S.BasslerB. L. (2010). Negative feedback loops involving small regulatory RNAs precisely control the Vibrio harveyi quorum-sensing response.Mol. Cell37567–579. 10.1016/j.molcel.2010.01.022
47
WaldorM. K.MekalanosJ. J. (1996). Lysogenic conversion by a filamentous phage encoding cholera toxin.Science2721910–1914. 10.1126/science.272.5270.1910
48
WatersC. M.LuW.RabinowitzJ. D.BasslerB. L. (2008). Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels and repression of vpsT.J. Bacteriol.1902527–2536. 10.1128/JB.01756-07
49
WitheyJ. H.DiRitaV. J. (2006). The toxbox: specific DNA sequence requirements for activation of Vibrio cholerae virulence genes by ToxT.Mol. Microbiol.591779–1789. 10.1111/j.1365-2958.2006.05053.x
50
WuR.ZhaoM.LiJ.GaoH.KanB.LiangW. (2015). Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios.Sci. Rep.5:14921. 10.1038/srep14921
51
WyckoffE. E.MeyA. R.PayneS. M. (2007). Iron acquisition in Vibrio cholerae.Biometals20405–416. 10.1007/s10534-006-9073-4
52
XuX.SternA. M.LiuZ.KanB.ZhuJ. (2010). Virulence regulator AphB enhances toxR transcription in Vibrio cholerae.BMC Microbiol.10:3. 10.1186/1471-2180-10-3
53
YuR. R.DiRitaV. J. (2002). Regulation of gene expression in Vibrio cholerae by ToxT involves both antirepression and RNA polymerase stimulation.Mol. Microbiol.43119–134. 10.1046/j.1365-2958.2002.02721.x
54
ZhangY.GaoH.Osei-AdjeiG.ZhangY.YangW.YangH.et al (2017a). Transcriptional regulation of the type VI secretion system 1 genes by quorum sensing and ToxR in Vibrio parahaemolyticus.Front. Microbiol.8:2005. 10.3389/fmicb.2017.02005
55
ZhangY.ZhangY.GaoH.ZhangL.YinZ.HuangX.et al (2017b). Vibrio parahaemolyticus CalR down regulates the thermostable direct hemolysin (TDH) gene transcription and thereby inhibits hemolytic activity.Gene61339–44. 10.1016/j.gene.2017.03.001
56
ZhangY.QiuY.TanY.GuoZ.YangR.ZhouD. (2012). Transcriptional regulation of opaR, qrr2-4 and aphA by the master quorum-sensing regulator OpaR in Vibrio parahaemolyticus.PLoS One7:e34622. 10.1371/journal.pone.0034622
57
ZhouD.QinL.HanY.QiuJ.ChenZ.LiB.et al (2006). Global analysis of iron assimilation and fur regulation in Yersinia pestis.FEMS Microbiol. Lett.2589–17. 10.1111/j.1574-6968.2006.00208.x
58
ZhuJ.MekalanosJ. J. (2003). Quorum sensing-dependent biofilms enhance colonization in Vibrio cholerae.Dev. Cell5647–656. 10.1016/s1534-5807(03)00295-8
59
ZhuJ.MillerM. B.VanceR. E.DziejmanM.BasslerB. L.MekalanosJ. J. (2002). Quorum-sensing regulators control virulence gene expression in Vibrio cholerae.Proc. Natl. Acad. Sci. U.S.A.993129–3134. 10.1073/pnas.052694299
Summary
Keywords
Vibrio cholerae, toxin coregulated pilus, cholera toxin, HapR, Fur
Citation
Gao H, Zhang J, Lou J, Li J, Qin Q, Shi Q, Zhang Y and Kan B (2020) Direct Binding and Regulation by Fur and HapR of the Intermediate Regulator and Virulence Factor Genes Within the ToxR Virulence Regulon in Vibrio cholerae. Front. Microbiol. 11:709. doi: 10.3389/fmicb.2020.00709
Received
16 January 2020
Accepted
26 March 2020
Published
17 April 2020
Volume
11 - 2020
Edited by
Yuji Morita, Meiji Pharmaceutical University, Japan
Reviewed by
Kenneth Milan Peterson, Louisiana State University Health Sciences Center, United States; Jeffrey H. Withey, Wayne State University, United States
Updates

Check for updates
Copyright
© 2020 Gao, Zhang, Lou, Li, Qin, Shi, Zhang and Kan.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yiquan Zhang, zhangyiquanq@163.comBiao Kan, kanbiao@icdc.cn
This article was submitted to Infectious Diseases, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.