ORIGINAL RESEARCH article

Front. Microbiol., 12 August 2020

Sec. Evolutionary and Genomic Microbiology

Volume 11 - 2020 | https://doi.org/10.3389/fmicb.2020.01937

Identification of a Type IV-A CRISPR-Cas System Located Exclusively on IncHI1B/IncFIB Plasmids in Enterobacteriaceae

  • 1. UCL Eastman Dental Institute, University College London, London, United Kingdom

  • 2. Centre for Clinical Microbiology, Royal Free Hospital, University College London, London, United Kingdom

  • 3. Department of Tropical Disease Biology, Liverpool School of Tropical Medicine, Liverpool, United Kingdom

  • 4. Centre for Drugs and Diagnostics, Liverpool School of Tropical Medicine, Liverpool, United Kingdom

Abstract

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) are diverse immune systems found in many prokaryotic genomes that target invading foreign DNA such as bacteriophages and plasmids. There are multiple types of CRISPR with arguably the most enigmatic being Type IV. During an investigation of CRISPR carriage in clinical, multi-drug resistant, Klebsiella pneumoniae, a Type IV-A3 CRISPR-Cas system was detected on plasmids from two K. pneumoniae isolates from Egypt (isolated in 2002–2003) and a single K. pneumoniae isolate from the United Kingdom (isolated in 2017). Sequence analysis of all other genomes available in GenBank revealed that this CRISPR-Cas system was present on 28 other plasmids from various Enterobacteriaceae hosts and was never found on a bacterial chromosome. This system is exclusively located on IncHI1B/IncFIB plasmids and is associated with multiple putative transposable elements. Expression of the cas loci was confirmed in the available clinical isolates by RT-PCR. In all cases, the CRISPR-Cas system has a single CRISPR array (CRISPR1) upstream of the cas loci which has several, conserved, spacers which, amongst things, match regions within conjugal transfer genes of IncFIIK/IncFIB(K) plasmids. Our results reveal a Type IV-A3 CRISPR-Cas system exclusively located on IncHI1B/IncFIB plasmids in Enterobacteriaceae that is likely to be able to target IncFIIK/IncFIB(K) plasmids presumably facilitating intracellular, inter-plasmid competition.

Introduction

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR-Cas) are widespread, adaptive, RNA-mediated, immune systems found in the genomes of prokaryotic organisms (bacteria and archaea) that target invading foreign DNA such as bacteriophages and conjugative plasmids (; ). CRISPR functions through a three-stage process: adaptation involving the acquisition of foreign DNA molecules as spacers, expression and maturation of the short CRISPR RNAs (crRNAs), and the interference with a cognate invading foreign DNA molecule (). The classification of CRISPR-Cas systems is continuously updated to include newly identified subtypes. To date, CRISPR-Cas systems are classified into two classes, six Types (I–VI), and ∼ 33 subtypes (; , ). There is ongoing discovery of multiple, novel class 2 CRISPR-Cas systems (). The two classes differ according to the effector module; class 1 utilizes multi-protein effector Cas complexes, while class 2 utilizes a single-protein effector [Type II contains Cas9; Type V contains Cas 12a (previously known as Cpf1), Cas12b (previously known as C2c1), Cas12c (previously known as C2c3), Cas12d (previously known as CasY), and Cas12e (previously known as CasX); and Type VI contains Cas13a (previously known as C2c2), Cas13b, and Cas13c] (; , ; ). CRISPR-Cas systems are confirmed, or expected, to provide immunity against viruses and other mobile genetic elements (MGEs), except for transposon-encoded CRISPR-Cas systems that lack the interference module and therefore are predicted to perform functions distinct from adaptive immunity (). Most of the CRISPR types target DNA, some types specifically target RNA such as Type VI, while Type III CRISPR systems are unique because they exhibit both RNA interference and DNA interference in vivo to protect their microbial hosts (, ; ; ; ; ; ; ; ; ; ; ; ; ; ; ).

Type IV was previously called the Unknown Type (Type U), due to its rare occurrence and lack of the adaptation module, until an updated classification in 2015 (; ). It was then named Type IV (putative) after its identification in Acidithiobacillus ferrooxidans presenting a different genetic arrangement of Type U cas genes (). In 2017, Type IV classification was updated, after its identification in Thioalkalivibrio sp. K90mix (TK90_2699-TK90_2703), to show an associated repeat-spacer array for a cas loci that have csf4 (dinG), csf5 (cas6-Like), csf1 (cas8-Like), csf2 (cas7), and csf3 (cas5) genetic arrangement, respectively, and was then assigned as Type IV-A (). In 2018, a variant of Type IV that lacks a repeat-spacer array from Rhodococcus jostii RHA1 (RHA1_ro10069-RHA1_ro10072), was assigned as Type IV-B (Figure 1; ). In 2019, the Type IV-C CRISPR-Cas system was formally classified as a distinct subtype after its identification in nine contigs; mostly from thermophilic microorganisms (). Other papers have also proposed the classification of Type IV-D, Type IV-E, and subgroups of Type IV-A(1-4) (; ), however, the suggested subgroups did not have a unified genetic arrangement corresponding for each of the named Type IV-A(1-4) variants. Type IV CRISPR-Cas systems were shown to employ crRNA-guided effector complexes (). Type IV is the only type to possesses csf4 (dinG) in its CRISPR-Cas loci (; ), and it was recognized initially as the signature proteins for Type IV systems, (; ) although recently subtype IV-D has been shown to carry a helicase of the RecD family in place of the archetypal DinG (). To date, Type IV variants (IV-A, IV-B, and IV-C) described above show different genetic arrangements and orientation of cas loci, and they all lack the adaptation module. Also, all Type IV CRISPR-Cas systems are encoded by bacterial plasmids, prophages or other, uncharacterized integrated elements (). Thus, it has been hypothesized that Type IV is similar to an ancestral innate immune system that gained adaptive ability by associating with a transposon-like element containing cas1 and cas2 ().

FIGURE 1

). (B) Type IV (putative) as identified in Acidithiobacillus ferrooxidans in 2015 (), however, the two associated repeat-spacer arrays were identified in this study. (C) Type IV-A identified in Thioalkalivibrio sp. K90mix (TK90_2699-TK90_2703) in 2017 (). (D) Type IV-B identified in Rhodococcus jostii RHA1 (RHA1_ro10069-RHA1_ro10072) in 2017 (). (E) Type IV-C identified in Thermoflexia bacterium D6793_05715-D6793_05700 (). (F) Type IV-A3 as detected in Enterobacteriaceae isolates and genomes in this study. Arrows in different colors represent genes; red represents cas6; bright blue represents dinG; light green represents other essential genes of the system; cas8-like/LS, cas7 and cas5; white represents cas11; blue-yellow pattern represents the direct repeat-spacer loci.

Materials and Methods

Clinical Isolates Sequencing

Three clinical isolates were investigated; Klebsiella pneumoniae-53 and K. pneumoniae-65 were isolated from Egyptian university teaching hospitals (2002–2003), and K. pneumoniae-CR5 from University College London Hospital in the United Kingdom (2017). The bacterial genomic DNA sequencing was conducted at MicrobesNG (Birmingham, United Kingdom). Isolates were sequenced using an Illumina HiSeq 2500 and an Illumina MiSeq instruments, to boost coverage, with a 2 × 250 bp paired end sequencing using Nextera XT library prep.

CRISPR-Cas System Identification and Characterization

DNA sequences were analyzed using CRISPRFinder, CRISPRCasFinder, CRISPRTarget, and Snapgene (GSL Biotech) (; ; ; ). The Cas domain analyses were performed by HHpred (Sensitive protein homology detection, function, and structure prediction based on HMM–HMM comparison) at MPI bioinformatics Toolkit1 (). HHpred was performed using NCBI_Conserved_Domains(CD)_v3.16 and TIGRFAMs_v15.1 databases and Bac_Escherichia_coli_K12_07_Mar_2017 proteome settings. Multi-Locus Sequence Typing, resistance genes and plasmids were identified using MLST, ResFinder, and PlasmidFinder, respectively (). Spacer analysis was performed by BLAST and Geneious (). A phylogenetic UPGMA-based tree was constructed for CRISPR arrays and Cas proteins using MEGA X 10.1 (; ). The alignment of the regions containing protospacers (including 10 bp flanking the protospacer) associated with CRISPR1 repeats were investigated to identify putative protospacer adjacent motif (PAM) signature, as described in . PAMs were identified based on compared alignments of nucleotides immediately preceding each detected protospacer in all or up to ten unique protospacers of all the investigated sequences. The leader sequence was identified by sequence alignment. Direct repeats and PAM conservation were assessed using WebLogo, RNA secondary structure was predicted using RNAfold (; ; ; ). The GC skew plots were generated using the GenSkew online analysis tool2. Presence in other GenBank sequences was investigated by BLASTn3.

CRISPR-Cas System Expression

The CRISPR-Cas loci expression was tested. RT-PCR was performed using LightCycler® RNA Amplification Kit SYBR Green (Roche Diagnostics Ltd., United Kingdom). The primers were designed for fully characterized genes (csf2-fw:AAAATGCGGTCTCAACTTCCG; csf2-rev:TGACGAAGAG TTCCCCGAATG), (dinG-fw:GAGTCTGCCGGATTGTCGTTA; dinG-rev:GTACCAGATAGCCCAGCGTTT), and (cas6-fw:AAT GCGTTTCGGTTGCGTATC; cas6-rev:GAGTACGGCAGCTT CTCTCC).

Results and Discussion

Identification of Type IV-A3 CRISPR-Cas in Clinical and GenBank Isolate Sequences

Type IV-A-3 CRISPR-Cas, based on the gene composition and genetic architecture of the IV-A variants detected in K. pneumoniae as described in , was detected on a total of thirty-one (three clinical isolates and twenty eight sequences from GenBank) IncHI1B/IncFIB(Mar) plasmid sequences within Enterobacteriaceae (Figure 1 and Supplementary Table S1). The IncH1B/IncFIB plasmids are large, low copy number, conjugative plasmids with narrow-host-ranges, which are found in multiple genera of Enterobacteriaceae (; ; ). An important feature of IncH1B/IncFIB plasmid biology is the entry exclusion by which the cells that contain an IncF/IncH plasmid become poor recipients in additional conjugation rounds (; ); which frees a resident plasmid from competition with related plasmids at segregation during bacterial division but may contribute to limiting plasmid dissemination among potential hosts.

This Type IV-A3 CRISPR-Cas is characterized by the presence of a cas loci containing dinG, which is a distinct feature of Type IV-A CRISPR-Cas system that was shown to be a requirement for the system functional activity in Pseudomonas aeruginosa (; ; ), a conserved leader sequence and a CRISPR array in all the detected sequences and they all show homology to each other. These Type IV-A3 CRISPR-Cas systems were initially detected by BLAST that confirmed the presence of three genes; cas7, dinG, and cas6, and further HHpred analysis of other associated ORFs revealed the presence of two more genes; cas5 and cas8-like.

Association Between Type IV-A3 CRISPR-Cas Sequences and IncHI1B/IncFIB(Mar) Plasmids

We also identified partial related Type IV-A3 systems either (cas8-like, cas6, and dinG) or (cas7 and a CRISPR array) occurring on other IncHI1B/IncFIB(Mar) plasmids (Supplementary Table S1). Partial and complete Type IV-A3 system characterization showed occurrence of a range of different IS elements and retrotransposons (group II introns) (Supplementary Table S1). The average GC content of this Type IV-A3 CRISPR-Cas loci (47.7 ± 0.01%) was found to be closer to that of the IncHI1B/IncFIB(Mar) plasmids on which they reside (46.2 ± 0.01%), compared to the chromosomal sequences of the bacterial host (57 ± 0.02%), (Table 1).

TABLE 1

Sequence (strain name, plasmid name, Accession number)Chromosomal Size (bp)Chromosomal GC Content (%)Plasmid Size (bp)Plasmid GC Content (%)New Type IV-A Size (bp)New Type IV-A GC Content (%)
1K. pneumoniae 234-12, pKpn23412-362, CP011314.15,278,25457361,964485,67147
2K. pneumoniae Kp15, pENVA, HG918041.1**253,984476,09347
3E. coli strain Ecol_422, pEC422_1, CP018961.14,747,60751289,903465,86448
4K. pneumoniae 825795-1, unnamed1, CP017986.15,373,05551244,706455,97948
5K. pneumoniae KP_Goe_828304, pKp_Goe_304-1, CP018720.15,373,05658246,757456,03448
6K. pneumoniae Kp_Goe_152021, pKp_Goe_021-1, CP018714.15,373,05558246,756455,97948
7K. pneumoniae Kp_Goe_827026, pKp_Goe_026-1, CP018708.15,373,05657246,756456,03448
8K. pneumoniae Kp_Goe_827024, pKp_Goe_024-1, CP018702.15,374,11857246,753456,03448
9K. pneumoniae Kp_Goe_149832, pKp_Goe_832-1, CP018696.15,373,05757246,755456,03448
10K. pneumoniae MS6671.v1, LN824134.15,402,90057279,305477,04447
11K. pneumoniae, pNDM-MAR, JN420336.1**267,242478,21546
12K. pneumoniae A64477, pKP64477b, MF150122.1**205,089456,28247
13P. gergoviae FB2, pFB2.1, CP014776.15,489,68059242,312455,92148
14K. pneumoniae KPN528, pKPN528-1, CP020854.15,383,01857292,471465,67648
15K. pneumoniae Kp_Goe_149473, pKp_Goe_473-1, CP018687.15,373,05657246,757455,97948
16K. pneumoniae Kp_Goe_822579, pKp_Goe_579-1, CP018313.15,381,43657245,975455,97948
17K. pneumoniae Kp_Goe_154414, pKp_Goe_414-1, CP018339.15,159,81558204,862455,73848
18K. pneumoniae AR_0068, unitig_1, CP020068.15,357,43057276,460475,67848
19K. pneumoniae 11, pIncHI1B_DHQP1300920, CP016921.15,184,82858283,369465,67848
20K. pneumoniae KP617, KP-plasmid1, CP012754.15,416,28257273,628465,67848
21K. pneumoniae PittNDM01, plasmid1, CP006799.15,348,28458283,371465,67848
22K. pneumoniae SKGH01, unnamed 1, CP015501.15,490,61157281,190477,03649
23K. pneumoniae PMK1, pPMK1-NDM, CP008933.15,317,00157304,526478,52146
24K. pneumoniae KPNIH48, pKPN-edaa, CP026398.15,531,97557249,238476,03248
25K. pneumoniae KPN1481, pKPN1481-1, CP020848.15,554,15058347,748478,51848
26K. pneumoniae KSB2_1B, unnamed1, CP024507.15,228,88958310,025475,67848
27K. pneumoniae KPNIH50, pKPN-bbef, CP026172.15,616,60557243,967466,04248
28K. pneumoniae F44, p44-1, CP025462.15,460,46557261,706485,43448
29K. pneumoniae-53, plasmid1, SGOL010000006,501,1775945,187465,67147
30K. pneumoniae-65, plasmid 1, SGOK010000005,850,0215745,574465,67147
31K. pneumoniae-CR5, plasmid 1, SGOJ010000005,871,23859125,699436,28448
AK. pneumoniae K66-45, pK66-45-1, CP020902.15,380,60557338,512486,07846
BK. pneumoniae AR_0158, tig00000727, CP021699.15,165,07158354,705483,17748
CK. pneumoniae LS356, pKP8-2, CP025638.15,409,42558153,586493,13347
DK. oxytoca pKOX3, p1, KY913897.1**239,374471,08548
Average5,422,84457251,03546.25,87547.7
STD286,0430.017269,5790.0121,3210.01

Comparison of the GC content of the CRISPR, host plasmid and host strain chromosome.

GC content comparison among the newly described Type IV-A CRISPR-Cas loci, the IncHI1B/IncFIB(Mar) plasmid and isolate chromosomal sequences of the host. *The strain chromosomal sequence was not available on GenBank; only the plasmid sequence was available.

Characterization of the Type IV-A3 CRISPR-Cas System Found in Enterobacteriaceae

A single CRISPR array (CRISPR1) was identified upstream of all cas loci. The repeats have a predicted stem-loop secondary-structure (Figures 2A,B) and is likely involved in a pre-crRNA Cas6-mediated process. The alignment of the regions around and containing the protospacer, particularly the last six positions preceding the protospacer, associated with CRISPR1 repeats revealed the conservation of the putative PAM signature (AAG) adjacent to the end of the protospacers (Figure 2C). A highly conserved 65 bp leader sequence occurring between the CRISPR-Cas loci and the CRISPR array was observed in all the sequences (Figure 2D). The minor variations in the leader sequence only occurred in two sequences (C in position −63 is A in CP014776.1 Pluralibacter gergoviae, and G in position −41 is A, and C in position −39 is T in K. pneumoniae-CR5 ST-392). The high conservation of the leader sequence is unlike that presented in . RT-PCR of the confirmed cas loci (cas7, dinG, and cas6) demonstrated that they are expressed in all three of the available clinical isolates (Table 2).

FIGURE 2

TABLE 2

IsolateGene‡
rpoB*cas7/csf2dinG/csf4cas6/csf5
K. pneumoniae-CR516.7122.38523.86523.69
K. pneumoniae-CR5 RT-ve CTRL**31.2137.4842.5234.755
K. pneumoniae-5316.59524.225.30525.325
K. pneumoniae-53 RT-ve CTRL**32.6537.7434.3733.61
K. pneumoniae-6517.57523.224.74524.44
K. pneumoniae-65 RT-ve CTRL**32.2342.794634.045

RT-PCR data of the confirmed cas loci (cas7, dinG, and cas6) in the three clinical isolates.

†Genes amplification data represent the average of two experiments at least. The cut-off cycle threshold (Ct) was 30 cycles. *rpoB housekeeping gene was used as the internal positive control. **RT-ve CTRL represent no addition of the reverse transcriptase which was used as the negative control for residual DNA.

We have detected a total of 467 spacers in the 31 CRISPR1 arrays analyzed, out of which 9% (42/467) match to bacteriophages and 25.5% (119/467) match to plasmid sequences. The majority of spacer sequences are present in more than one spacer array and some are present more than once within the same array (Figure 3). Plasmid targeting spacers appeared in every example of this Type IV-A3 associated CRISPR array analyzed. Sequence analysis revealed that spacers correspond to IncFIIK conjugal transfer genes; traN and traL (Figure 3). Limited conservation within the order of the spacer arrays showed that the arrays cluster into two distinct groups which share geographical associations and suggest persistence within the plasmid pool in isolates from certain countries over time (Figure 4).

FIGURE 3

FIGURE 4

The CRISPR system described here is always found associated with IncH1B/IncFIB plasmids in Enterobacteriaceae, has dinG and cas7 (involved in interference), and cas6, cas5, and cas8-like (involved in expression and maturation of short crRNAs) (; ; ; ; ; ). The detection of a csf1/cas8-like in the Type IV-A-variant described here updates the initial () and subsequent () reports of this system. Additionally, our results agree with other reports suggesting a need for Type IV-A variant classification (; ).

Notably, some of the previously described Type IV systems do not possess a dinG or cas8-like (e.g., Type IV-C); however, cas7 genes are consistently found in all the previously and presently described Type IV sequences. Also, Cas7 is the most conserved protein among members of the Type IV CRISPR family (). This highlights the role of cas7 in Type IV identification.

This Type IV-A3 described here has a variable CRISPR array and a conserved leader sequence. The conserved leader sequence occurrence in a wide variety of K. pneumoniae sequence types may reflect their narrow association with IncH1B/IncFIB plasmids. Conserved leader sequences in other types (Type I-E) were shown to increase acquisition efficiency by presumably stabilizing the Cas1–2-leader-repeat interaction (). The order of spacers demonstrated conservation with some polymorphism, and they cluster into two main groups (Figure 4) matching DNA from a variety of geographical sources. Expression of this Type IV-A cas genes suggests immunity to incoming DNA matching the spacers. posit that interference is mediated, similar to type I and type III systems, through multi-subunit complexes composed of Csf proteins and the use of crRNA as a guide to bind complementary nucleic acid forming R-loops. In this case, it was hypothesized that DinG is then recruited to these R-loops, where it either acts directly to destroy the foreign DNA (e.g., a plasmid) or recruits an endogenous nuclease to mediate RNA-guided interference (); however, this needs to be tested. Also, we note that the adaptation module is missing, thus adding new spacers will require cas1 and cas2 from other CRISPR-Cas systems. Like other Type IV systems that cannot function as independent adaptive immune systems (), we suspect that the Type IV-A3 CRISPR-Cas described here is likely to co-operate with other cas loci, whenever they exist within the Enterobacteriaceae host genomes, for spacer acquisition. Those CRISPR-Cas loci could belong to those CRISPR systems that are known to be frequently associated with an Enterobacteriaceae host, such as Type I-E/I-E∗ or Type I-F (). The association between Type IV-A and cas6e and cas6f (cas6 sequences observed in subtypes I-E and I-F, respectively) was previously reported in other bacterial families, suggesting functional links (; ). These functional links were inferred based on the similarities in the leader and the repeat sequences of Type I-E and Type IV-A3 (). Another evidence that supports possible functional co-operation is the presence of Cas6 that shows 99%+ identity to Type I-E Cas6 in Enterobacteriaceae in the Type IV-A3 described here. Furthermore, unlike other Cas proteins associated with Type IV-A3 described here, Cas6 were highly conserved sequences, showing no particular association with interrupting IS elements, which may further support the recruitment of cas6 is form Type I-E. These possible adaptation functional links appear to be a feature that can be switched on/off, which requires the presence of the IncHI1B/IncFIB(Mar) plasmids (that carry this Type IV-A-variant) inside a bacterial host that has a functional CRISPR-Cas system in its genome. Although a previous report suggested that Type IV CRISPR-Cas system-positive plasmids were only found in Enterobacteriaceae with chromosomal Type I-E/I-E∗ CRISPR-Cas (), we could not identify Type I-E/I-E∗ in all the isolate genomes that have Type IV-A3. For example, K. pneumoniae-53, CP011314.1, HG918041.1, JN420336.1, MF150122.1, CP014776.1, CP018339.1, CP026398.1, CP020848.1, CP024507.1, CP026172.1, and CP025462.1 did not have Type I-E/I-E∗ CRISPR-Cas systems. Thus, we assume there is no conditional connection between the presence of Type IV-A3 and Type I-E/I-E∗ CRISPR-Cas systems in Enterobacteriaceae.

Type IV-A3 CRISPR system reported here is exclusively located on IncH1B/IncFIB plasmids. We have also spotted an imperfect spacer target in traN of an IncFIIK plasmid in K. pneumoniae-53 which suggests this plasmid may be able to evade plasmid mediated CRISPR interaction within this strain (). Therefore, these spacers are likely to be involved in plasmid competition; protecting the resident Type IV-A CRISPR-Cas carrying plasmid in Enterobacteriaceae as previously suggested (; ). Recently, some Type IV-A system variants that are associated with P. aeruginosa were shown to target invasive plasmids, which strengthens the involvement of Type IV-A CRISPR-Cas systems in plasmid competition ().

Type IV CRISPR-Cas systems demonstrate a notable diversity of molecular organization (Figure 1) and some appear to have taken on roles in addition to adaptive cellular immunity (). For example, some of the Type IV CRISPR–Cas loci were previously predicted to encode bacterial toxins that together with the Cas proteins of the Type IV systems may contribute to plasmid stabilization (). The Type IV-A3 system described here demonstrates a complex evolutionary connection with MGEs in terms of parasitism and immunity (). The association between this Type IV-A3 system and multiple MGEs, plus the identification of partial cas loci genes with and without the CRISPR array on other IncHI1B/IncFIB(Mar) plasmids (Figure 1 and Supplementary Table S1), plus the identification of similar arrays in different plasmids in the same host from the same country (Figures 3, 4), indicates that dynamic, MGE mediated movement and rearrangement of this CRISPR-Cas Type IV-A system is ongoing. The similarity in the GC content between this Type IV-A and the IncHI1B/IncFIB plasmids in contrast with the higher chromosomal GC content supports the observations that the system is exclusively plasmid associated, both in this study and in others (). Because reporting standard deviations from comparisons of element-wide GC contents across different genomes could be misleading, since the strains are closely related that statistical observations are not independent, we have investigated the GC skew in a reasonably sized sliding window (1000 bp) across the length of the element (Type IV-A3 system and plasmid DNA sequences) in a single genome (K. pneumoniae-65), which also confirmed that the system is exclusively plasmid associated. This demonstrates unique evolutionarily juxtaposed connections between CRISPR-Cas and MGEs which is worthy of further investigation. To our knowledge, this is the first identification of a CRISPR-Cas system exclusively associated with IncHI1B/IncFIB plasmids that demonstrates an evolutionary association with MGEs and is likely to be involved in plasmid competition.

Statements

Author’s note

This manuscript has been released as a pre-print at BioRxiv ().

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found at: https://www.ncbi.nlm.nih.gov/genbank/, SGOJ00000000; https://www.ncbi.nlm.nih.gov/genbank/, SGOK00000000; and https://www.ncbi.nlm.nih.gov/genbank/, SGOL00000000.

Author contributions

EN discovered the CRISPR system within the genomes of her Egyptian isolate collection, analyzed the sequence data, and wrote the first draft of the manuscript. SJ, AA, and VE designed and carried out the experiments to test cas loci expression. AR analyzed the data and wrote the manuscript. All authors critically reviewed and approved the manuscript.

Funding

EN was supported by a grant from the Schlumberger Foundation’s Faculty for the Future Program (2012–2016).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2020.01937/full#supplementary-material

References

Summary

Keywords

Type IV, IncFIIK, IncFIB(K), inter-plasmid competition, mobile genetic element

Citation

Newire E, Aydin A, Juma S, Enne VI and Roberts AP (2020) Identification of a Type IV-A CRISPR-Cas System Located Exclusively on IncHI1B/IncFIB Plasmids in Enterobacteriaceae. Front. Microbiol. 11:1937. doi: 10.3389/fmicb.2020.01937

Received

04 May 2020

Accepted

22 July 2020

Published

12 August 2020

Volume

11 - 2020

Edited by

Kira Makarova, National Center for Biotechnology Information (NLM), United States

Reviewed by

Qunxin She, Shandong University, China; Samuel Henry Sternberg, Columbia University, United States

Updates

Copyright

*Correspondence: Adam P. Roberts,

†Present address: Enas Newire, Institute of Systems, Molecular & Integrative Biology, Faculty of Health and Life Sciences, University of Liverpool, Liverpool, United Kingdom Alp Aydin, Quadram Institute, Norwich, United Kingdom

This article was submitted to Evolutionary and Genomic Microbiology, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics