Abstract
The emerging human enteropathogen Clostridioides difficile is the main cause of diarrhea associated with antibiotherapy. Regulatory pathways underlying the adaptive responses remain understudied and the global view of C. difficile promoter structure is still missing. In the genome of C. difficile 630, 22 genes encoding sigma factors are present suggesting a complex pattern of transcription in this bacterium. We present here the first transcriptional map of the C. difficile genome resulting from the identification of transcriptional start sites (TSS), promoter motifs and operon structures. By 5′-end RNA-seq approach, we mapped more than 1000 TSS upstream of genes. In addition to these primary TSS, this analysis revealed complex structure of transcriptional units such as alternative and internal promoters, potential RNA processing events and 5′ untranslated regions. By following an in silico iterative strategy that used as an input previously published consensus sequences and transcriptomic analysis, we identified candidate promoters upstream of most of protein-coding and non-coding RNAs genes. This strategy also led to refine consensus sequences of promoters recognized by major sigma factors of C. difficile. Detailed analysis focuses on the transcription in the pathogenicity locus and regulatory genes, as well as regulons of transition phase and sporulation sigma factors as important components of C. difficile regulatory network governing toxin gene expression and spore formation. Among the still uncharacterized regulons of the major sigma factors of C. difficile, we defined the SigL regulon by combining transcriptome and in silico analyses. We showed that the SigL regulon is largely involved in amino-acid degradation, a metabolism crucial for C. difficile gut colonization. Finally, we combined our TSS mapping, in silico identification of promoters and RNA-seq data to improve gene annotation and to suggest operon organization in C. difficile. These data will considerably improve our knowledge of global regulatory circuits controlling gene expression in C. difficile and will serve as a useful rich resource for scientific community both for the detailed analysis of specific genes and systems biology studies.
Introduction
Clostridioides difficile (formerly Clostridium difficile) is an emerging human enteropathogen causing nosocomial antibiotic-associated diarrhea in adults (). This pathogen became a key public health issue worldwide. Alarming incidence of C. difficile infections was further accentuated by the recent emergence of antibiotic resistance, of hypervirulent epidemic strains broadening the population at risk and severity of disease, high rate of recurrent infection as well as an overall aging of population in industrial countries (; ). This anaerobic, spore-forming, Gram-positive bacterium can be found in soil and aquatic environments as well as in intestinal tracts of humans and animals (). In humans, the C. difficile carriage may be asymptomatic, but when symptoms appear, they can vary from mild diarrhea to life-threatening pseudomembranous colitis. The main C. difficile virulence factors are two toxins, TcdA and TcdB, produced by toxigenic strains (Vedantam et al., 2012). A binary toxin CDT is also present in some isolates, as well as additional factors that help colonization, like adhesins, pili, and flagella (). Despite recent efforts of research community, a lot of questions remains unanswered on the regulatory processes responsible for the adaptation of C. difficile inside the host. This information is largely missing and urgently needed for our understanding of the success of this pathogen and development of new diagnostic and therapeutic strategies.
Recent advances in high throughput approaches resulted in the accumulation of new invaluable data on the regulatory strategies of pathogenic bacteria at genomic, transcriptomic and metabolomics levels (; ; ). RNA-seq studies notably revealed high complexity of the transcriptome landscape in bacteria (Sorek and Cossart, 2010; ). The precise exploration and interpretation of this large amount of data is essential to improve our understanding of the C. difficile infection cycle. One of the first steps towards the establishment of C. difficile regulatory pathways is the definition of the transcriptional map at a genome-wide level. In particular, the analysis of transcriptome data combined with in silico predictions could provide key information on molecular details of regulatory mechanisms including promoter sequences, type of sigma factor associated to the RNA polymerase (RNAP) involved in the initiation of transcription, as well as other regulatory elements. The genome-wide transcriptional start site (TSS) mapping allows the determination of transcriptional start positions at single-nucleotide resolution (Wurtzel et al., 2010; Sharma and Vogel, 2014). Two methods developed in 2010 have proven their validity for TSS mapping. Differential RNA-seq (dRNA-seq) method largely used in prokaryotes includes two enzymatic steps, i.e., terminator 5′-phosphate-dependent exonuclease (TEX) followed by tobacco acid pyrophosphatase (TAP) treatment for adapter ligation, while 5′-end RNA-seq compares two samples treated or not with TAP enzyme to distinguish between primary 5′-triphosphate and processed 5′-monophosphate transcripts (; ; Sharma and Vogel, 2014; ; ). The 5′-end RNA-seq approach (Wurtzel et al., 2010) that we are using in this study has been successfully implemented for the TSS mapping in Achaea and bacteria including pathogenic and non-pathogenic Listeria (Wurtzel et al., 2012a), Pseudomonas aeruginosa (Wurtzel et al., 2012b), Streptococcus agalactiae (), Streptococcus pyogenes (). The detection of TSS implies the presence of a promoter in its upstream region. This promoter element will define the site directing the RNAP for the initiation of transcription and represents a key element to understand the regulation of gene expression in bacteria. Promoters differ at their consensus sequences depending on the interchangeable RNAP sigma factor, which provides DNA recognition specificity ().
During its infection cycle, C. difficile have to face changing conditions including variations in pH, oxygen content, osmolarity and exposure to various antimicrobial compounds (). The C. difficile 630 genome carries 14 genes encoding sigma factors including two copies of housekeeping SigA and several alternative sigma factors allowing the initiation of transcription under various physiological conditions () (Table 1). These sigma factors belong to the sigma 70 family except for one of them, SigL, belonging to the sigma 54 family (). Four specific sigma factors of sporulation, SigF and SigG in the forespore and SigE and SigK in the mother cell and the sigma factor of transition phase, SigH, which is involved in the initiation of sporulation are present in C. difficile and their inactivation leads to an asporogenous phenotype (, ; ). The sigma factor of the general stress response, SigB, is involved in adaptive strategy during gut colonization and plays a role in resistance to low pH, to antimicrobial peptides, to reactive oxygen species and nitric oxide as well as in oxygen tolerance (). TcdR is an alternative sigma factor required for toxin genes expression (tcdA and tcdB) while tcdR itself is transcribed by RNAP with SigD, which controls flagellar synthesis and motility (; ). 3 extracytoplasmic function (ECF) sigma factors, SigV, CsfU and CsfT are also present (; Sineva et al., 2017). The regulons of several RNAP sigma factors have been recently defined in C. difficile including sporulation specific sigma factors, the general stress-response sigma factor, SigB and the motility-associated sigma factor, SigD (; ; ; ; ). Only two studies have previously shown a role of SigL, belonging to the Sigma 54 family, in the degradation of cysteine associated with a control of toxin production (; ; ). Interestingly, the genes for 24 transcriptional activators (named EBP for enhancer binding proteins activating SigL-dependent promoters) containing a AAA+ domain, which is responsible for ATP hydrolysis and their interaction with SigL (), are present in the genome of C. difficile. Only two EBPs, CsdR and PrdR, controlling cysteine and proline catabolism, respectively, have been experimentally characterized in C. difficile (; ; ).
TABLE 1
| Gene ID | Gene name | Function | Group* | % identity/similarity with sigma factors of B. subtilis | References |
| CD1455 | sigA1 | SigA, exponential growth | 1 | 65/77 | |
| CD1498 | sigA2 | SigA, stationary phase | 1 | 56/74 | |
| CD0011 | sigB | SigB, general stress response | 2 | 34/54 | |
| CD0266 | sigD | SigD, flagella formation | 3 | 30/53 | |
| CD3176 | sigL | SigL, sigma 54 factor | NA | 29/50 | |
| CD0057 | sigH | SigH factor of transition phase | 3 | 63/78 | |
| CD2643 | sigE | SigE factor of sporulation | 3 | 64/77 | ; |
| CD0772 | sigF | SigF factor of sporulation | 3 | 49/72 | ; |
| CD2642 | sigG | SigG factor of sporulation | 3 | 68/86 | ; |
| CD1230 | sigK | SigK factor of sporulation | 3 | 56/77 | ; |
| CD1558 | csfV/sigV | SigV, ECF sigma factor, resistance to lyzozyme | 4 | 57/76 | |
| CD1887 | csfU | ECF sigma factor SigW-like | 4 | 30/48 | |
| CD0677 | csfT | ECF sigma factor | 4 | – | |
| CD0659 | tcdR | Sigma factor of toxin genes | 5 | – |
Sigma factors encoded in the genome of C. difficile strain 630.
Eight additional Sigma factors are annotated in the genome of C. difficile strain 630 (). The genes CD0359, CD0435, CD0510, CD1094, CD1878, CD2223, CD3329, and CD3371 encoding these sigma factors are associated with conjugative transposon. Group∗ of σ70 family sigma factors according to the classification by . “NA” not applicable.
By combining in silico analysis, RNA-seq and genome-wide promoter mapping, we have recently identified more than 200 non-coding RNAs (ncRNAs) in C. difficile from different functional classes including riboswitches, trans- and cis-acting antisense RNAs (Soutourina et al., 2013). However, the global view of C. difficile promoter structure is still missing. To fill the gap in our current understanding of C. difficile genes and transcriptional unit structure and regulation, we present here a transcriptional map of the C. difficile genome including the identification of TSSs, operon structures and promoter motifs. We also defined the SigL regulon. These data would considerably improve our knowledge on the regulons of the major sigma factors and on the global regulatory circuits that control gene expression in C. difficile. This work will be essential for genome-wide and gene-specific studies of the regulatory mechanisms in this emerging pathogen.
Materials and Methods
Bacterial Strains and Growth Conditions
Clostridioides difficile strains were grown anaerobically (5% H2, 5% CO2, and 90% N2) in TY (Bacto tryptone 30 g.l–1, yeast extract 20 g.l–1, pH 7.4) or Brain Heart Infusion (BHI, Difco). For solid media, agar was added to a final concentration of 17 g.L–1. When necessary, cefoxitin (Cfx; 25 μg/ml), erythromycin (Erm; 2.5 μg/ml) and thiamphenicol (Tm; 15 μg/ml) were added to C. difficile cultures. Strains and plasmids used in this study are listed in Supplementary Table S1.
Volatile Fatty Acid Analysis
The end products of fermentation were detected by gas-liquid chromatography. Strain 630Δerm and the sigL::erm mutant were grown in TY for 48 h at 37°C. After centrifugation, supernatants were recovered and mixed with sulfuric acid and ether to extract the volatile fatty acids. For each sample, 5 μl of the supernatants was injected in a gas chromatograph (CP-3380; Varian) equipped with a flame ionization detector and connected to an integrator (model C-55A; Shimadzu). A glass column (2 m by 4 mm) packed with 10% SP 1000 plus 1% H3PO4 on Chromosorb W AW (100/120 mesh) was used. The instrument was operated at 170°C for 18 min. The operating conditions were as follows: injector temperature, 200°C; detector temperature, 200°C; carrier gas (nitrogen); flow rate, 30 ml min–1. Each peak of the GLC patterns was identified by the retention time compared with that obtained with standard (2-Methylpentanoic acid at 10 mM). The amounts of fatty acids were calculated by comparison with an internal standard ().
RNA Extraction, Quantitative Real-Time PCR and 5′ RACE
For the 5′-end RNA-seq experiment, total RNA was isolated from C. difficile 630Δerm strain grown in TY medium either after 4 h or 10 h of growth or under starvation conditions that correspond to a 1 h resuspension of exponentially grown cells (6 h of growth) into PBS buffer for 1 h at 37°C as previously described (; Soutourina et al., 2013). 12 ml of culture for each condition have been used yielding at least 100 μg of total RNA. The analysis of genes controlled by SigL was performed with RNA extracted from cells of strain 630Δerm or 630Δerm sigL::erm mutant () after 4 h of growth in TY. After centrifugation, the culture pellets were resuspended in RNAproTM solution (MP Biomedicals) and RNA extracted using the FastRNA Pro Blue Kit, according to the manufacturer’s instructions. The RNA quality was determined using RNA 6000 Nano Reagents (Agilent). Quantitative real-time PCR analysis was performed as previously described (). In each sample, the quantity of cDNAs of a gene was normalized to the quantity of cDNAs of the dnaF gene (CD1305) encoding DNA polymerase III. The relative change in gene expression was recorded as the ratio of normalized target concentrations (ΔΔCt) (). 5′ RACE experiments were performed as previously described (Soutourina et al., 2013).
RNA-Seq and 5′-End RNA-Seq
Non-orientated library for whole transcript analysis by RNA-seq was realized on a RNA sample extracted from C. difficile 630Δerm strain grown at the late-exponential phase (6 h of growth) as previously described (Wurtzel et al., 2010). For 5′-end RNA-seq, two strand-specific cDNA libraries were generated from mixed RNA samples depleted for rRNAs and treated or not with Tobacco Acid Pyrophosphatase (TAP +/−), as previously described (Soutourina et al., 2013). TAP converts 5′-triphosphates into 5′-monophosphates allowing sequencing adaptor ligation and thus the enrichment with primary transcript reads in the library treated with TAP. The TAP+/− library construction for high-throughput sequencing (5′-end RNA-seq) was realized on mixed sample combining RNAs extracted from three different growth conditions including exponential growth (4 h), entry to a stationary phase (10 h) and nutriment starvation (1h incubation in PBS buffer). We prioritized depth of coverage by combining several conditions in a single 5′-end RNA-seq to maximize the number of genes expressed and thus the number of detectable TSS. 15 μg of total RNA treated with TurboDNAse (Ambion) was used for depletion of ribosomal RNA with the MicrobExpress kit (Ambion) following the manufacturer instructions. RNA depleted for rRNA was divided into two similar fractions and 1500 ng of this partially purified RNA was used for each library preparation. To convert the 5′PPP ends in 5′P ends, RNA was denatured 10 min at 65°C, placed on ice and incubated 1 h at 37°C with 10 units of TAP (Epicenter) (TAP+ library). For TAP− library construction, RNA depleted for rRNA was incubated with buffer alone under the same conditions. Products were purified by phenol/chloroform extraction and ethanol precipitation. cDNA library construction for Illumina sequencing was performed as previously described (). The Illumina reads were first scanned using Tagdust for adaptor removal. To eliminate reads matching the rDNA, sequence reads were mapped to the rDNA operon sequences of C. difficile 630 strain using the Bowtie software. Remaining sequencing reads were mapped to the C. difficile genome as previously described (Soutourina et al., 2013). We have set up a semi-automatic procedure for data analysis. The data were visualized using COV2HTML () at a strand-specific manner (for 5′-end RNA-seq libraries) or as a whole transcript coverage map (for RNA-seq): http://mmonot.eu/COV2HTML/visualisation.php?str_id=-44. This interface allows to visualize the accumulation of the first bases of the reads, which is the signal generated by the 5′-end RNA-seq approach. The sequences were localized on the genome and formed peaks (shown in green, see Figures 1–3, 6) that were easily detectable because the background noise was low. All transcriptional start signals detected by 5′-end RNA-seq were inspected manually to identify potential TSS and cleavage sites helped with a score that is the first base coverage ratio at the given position between the two conditions TAP+/TAP− (normalized by the number of total reads). The analysis consisted of scanning the genome systematically and each time a green peak was detected, we zoomed in the region to access the surrounding sequences for detection of promoter motifs. Following criteria have been taken into consideration for the TSS validation: TAP+/TAP− ratio (cut-off value of 1.5 in 90% of cases), the identification of promoter motifs at defined distance upstream of TSS (in silico promoter prediction score of at least 2 with −10 and −35 boxes positions from TSS separated by 16–18 bp or −12 and −24 consensus motif positions for the SigL promoters), the TSS location with respect to the annotated gene (upstream of the RBS for protein-coding genes) and whole transcript RNA-seq data coverage. We expected a distribution of RNA-seq coverage signal from TSS position to the 3′-end of the transcript provided that the gene was expressed at sufficient level under tested conditions. In case of previously studied sigma factors, an additional criterion has been included on the differential expression in comparative transcriptome analysis between strain inactivated for a given sigma factor and wild type strain [SigH (), SigE-F-G-K (), SigD (), SigB (), Sigma 54 (present study)].
FIGURE 1
FIGURE 2

Examples of cleavage sites detected by TSS-mapping. Representative examples of 5′-end RNA-seq (TAP-/TAP+ profile comparison) and RNA-seq data for potential processing profiles are shown. The RNA-seq and 5′-end RNA-seq data visualization is presented as in Figure 1. Potential cleavage site shown by scissors mark corresponds to a position with large number of reads in both TAP– and TAP+ samples. RBS are shown by green boxes to highlight the positions of potential cleavage sites in the proximity or inside RBS.
FIGURE 3

Examples of promoters controlling regulatory genes detected by TSS-mapping. Representative examples of 5′-end RNA-seq (TAP–/TAP+ profile comparison) data for the identification of TSS for genes encoding important transcriptional regulators are shown. The 5′-end RNA-seq data visualization is presented as in Figure 1. The sequence of promoter region is shown upstream of TSS with the –35 and –10 promoter elements indicated in blue and TSS indicated in red.
Then, we also used the PhageTerm software (
Microarray Design, DNA-Array Hybridization and Transcriptome Analysis
The microarray of C. difficile 630 genome was designed as previously described (
Strategy of Identification of Promoters Upstream of TSS
Identification of the consensus sequences for each of the sigma factors corresponding to transcription start sites (TSSs) was made using a modified procedure from
To validate the assignment of sigma factors to promoters, we used the data on gene expression levels in mutants with knocked out sigma factors: SigH (
Results and Discussion
Genome Wide Mapping of Transcriptional Start Sites by 5′-End RNA-Seq
A total of 3684 genes have been annotated in the genome of C. difficile strain 630 (
This approach allowed us to identify using both the PhageTerm software and manual inspection of sequence data a total of 1562 potential TSS upstream of C. difficile strain 630 genes including 274 TSS upstream of non-coding RNA genes (Soutourina et al., 2013) (Supplementary Tables S2, S3). Among TSS associated with ncRNA genes, 66 are located upstream riboswitches, 7 upstream rRNA and 24 upstream tRNA genes (Supplementary Table S3). For the cluster of highly expressed tRNA genes, a number of suggested TSS could correspond to cleavage sites representing processing events during transcript maturation process.
Together with automatic in silico approaches (
A total number of 1288 protein-coding genes could be associated with a potential TSS through our analysis. The genomic position of all identified TSSs with corresponding genes is listed in Supplementary Table S2. A large proportion of these TSS corresponds to the first gene of C. difficile operons. We have then included the data on possible operon structure for transcriptional unit organization analysis from available gene annotation (Vallenet et al., 2020) and whole RNA-seq expression profiles leading to a total number of more than 2000 genes covered by our TSS mapping (Supplementary Table S2). Additional genes missing in our analysis could be expressed under conditions different from those used in this study, and their TSS identification would require specific expression conditions.
As an example of a large gene cluster, Supplementary Figure S2 depicts the operon map and the promoters of the genes coding for flagella biosynthesis and function. Both one SigA-dependent and three alternative sigma factor SigD-specific promoters could be associated with TSSs for flagella genes (Supplementary Table S2 and Supplementary Figure S2). In the C. difficile 630 genome, three loci encode flagellum-associated proteins : late stage flagellar genes CD0226-CD0240, flagellar glycosylation genes CD0241-CD0244 and early stage flagellar genes CD0245-CD0272 (Stabler et al., 2006;
To further validate our approach for TSS mapping, we compared our data with about 35 TSSs previously mapped by 5′ rapid amplification of cDNA ends (5′RACE) or 3′/5′ RACE approach (Table 2). We also performed 5′RACE experiments that unambiguously identified TSSs for two additional genes (sinR encoding a transcriptional regulator and tcdC encoding protein negatively controlling toxin gene expression). Almost all these TSSs were in agreement with the TSSs identified by 5′-end RNA-seq with only minor deviations in case of multiple possible TSS and/or potential cleavage sites detected. These results and the TSSs already characterized upstream potential ncRNA genes confirmed that we have obtained a robust dataset that describes the transcriptional map of the C. difficile strain 630 (Supplementary Table S3, Soutourina et al., 2013).
TABLE 2
| Gene | 5′ RACE position | 5′-end RNA-seq 5′ position | Orientation | Promoter | References |
| tcdC CD630_06640 | T 805066 | T 805066 | - | This work | |
| A 805037 | |||||
| T 805031 | |||||
| C 805030 | |||||
| A 805028 | |||||
| A 805027 | |||||
| A 805022 | |||||
| T 805505 | |||||
| T 805503 | |||||
| A 805481 | |||||
| tcdR CD630_06590 | A 784644 | A 786444 | + | P-SigD | |
| A 786446 | |||||
| T 786504 | |||||
| A 786505 | P-SigA | ||||
| A 786379 | |||||
| A 786239 | |||||
| sinR CD630_22140 | G 2566722 | G 2566722 | + | P-SigA | This work |
| sigH CD630_00570 | A 82971 | A 82971 | + | P-SigA | |
| spo0A CD630_12140 | T 1412457 | G 1412458 | + | P-SigA | |
| G 1412532 | A 1412531 | + | P-SigH | ||
| spoIIAA CD630_07700 | T 942481 | G 942480 | + | P-SigH | |
| CD630_24920 | A 2877271 | not mapped | − | P-SigH | |
| dnaG CD630_14540 | A 1682862 | not mapped | + | P-SigA | |
| sigA2 CD630_14980 | G 1734857 | A 1734856 | + | P-SigH | |
| sigG CD630_26420 | T 3050599 | A 3050598 | − | P-SigF | |
| CD630_02260 | G 292850 | G 292850 | + | P-SigD | |
| flgM CD630_02290 | A 294568 | A 294568 | + | P-SigD | |
| fliC CD630_02390 | G 300874 | G 300874 | + | P-SigD | |
| CD630_35270 | G 4122554 | G 4122554 | − | P-SigD | |
| CD630_23440 | A 2713978 | A 2713981 | − | P-SigA | |
| glgC CD630_08820 | A 1059909 | T 1060072 | + | ||
| hisZ CD630_15470 | around 1795492 | A 1795496 | + | P-SigA | |
| cdsB CD630_32320 | A 3784442 | A 3784442 | − | P-SigL | |
| cwpV CD630_05140 | A 607231 | A 607231 | + | P-SigA | |
| dltD CD630_28540 | A 3337889 | A 3337889 | − | P-SigA/P-SigV | Woods et al., 2016 |
| A 3337884 | P-SigA/P-SigV | ||||
| CD630_25171 | T 2908422 | T 2908422 | − | P-SigA/P-SigB | |
| A 2908421 | |||||
| CD630_29071 | A 3398599 | A 3398599 | − | P-SigA/P-SigB | |
| CD630_09562 | A 1124042 | A 1124042 | + | P-SigA/P-SigB | |
| SQ1781 (RCd8) | T 2907991 | A 2908006 | + | ||
| T 2908066 | T 2908013 | ||||
| A 2907896 | |||||
| CD630_n00370 (RCd10) | A 1124339 | A 1124339 | − | P-SigA/P-SigB | |
| CD630_n01000 (RCd9) | A 3398302 | A 3398302 | + | P-SigA/P-SigB | |
| CD630_n00860 | A 2908058 | A 2908058 | − | ||
| SQ2025 | A 3306816 | − | |||
| T 3306807 | cleavage T 3306807 | Soutourina et al., 2013 | |||
| A 3306797 | |||||
| G 3306788 | |||||
| CD630_n00210 (RCd4) | A 655066 | + | Soutourina et al., 2013 | ||
| A 655075 | A 655072 | ||||
| G 655119 | |||||
| CD630_n00680 (RCd5) | A 2285913 | A 2285913 | + | Soutourina et al., 2013 | |
| SQ1002 | A 1761105 | A 1761105 | − | Soutourina et al., 2013 | |
| T 1761106 | |||||
| T 1760987 | |||||
| T 1761212 | |||||
| SQ173 | T 308770 | T 308776 | + | Soutourina et al., 2013 | |
| SQ1498 | C 2441928 | T 2441927 | − | Soutourina et al., 2013 | |
| A 2441933 | |||||
| CD630_n00030 (RCd2) | T 241079 | A 241078 | − | Soutourina et al., 2013 | |
| A 241065 | |||||
| T 241067 | |||||
| CD630_n00170 (RCd6) | A 560340 | A 560340 | − | Soutourina et al., 2013 | |
| C 560320 | |||||
Comparison of transcriptional start positions identified by RACE and TSS mapping by 5′-end RNA-seq.
The analysis of the nucleotide composition of TSS identified in this study revealed a strong selection for purine with the majority of A (75%) generally required for efficient initiation of transcription by RNAP and to a lower extent of G (14%) and T (9%) (Supplementary Figure S3). The TSS mapping also allowed us to clarify the position of translational start sites for 10 genes. Indeed, the translational start sites of several genes are located upstream of the TSSs suggesting a mis-annotation for translation initiation. We carefully checked the CDS and identified start codons (ATG, TTG or GTG) with a ribosome-binding site located upstream. For example, we modified the translational start sites for the CD0341, CD1088, CD2055, CD2064, CD2112, CD3271 genes encoding conserved proteins of unknown function, CD1015 and CD1099 genes encoding two-component system response regulator or histidine kinase, CD1234 encoding a small protein contributing to skin element excision during sporulation and msrAB (CD2166) gene encoding peptide methionine sulfoxide reductase. The modified annotations are available on MaGe MicroScope platform (Vallenet et al., 2020).
The 5′ untranslated region (5′UTR) also called mRNA leader region located between TSS and translation initiation codon constitutes often a target for important regulatory processes. This region could carry conserved motifs for RNA-based regulations or binding sites for regulatory proteins that could be involved in various transcriptional and post-transcriptional regulatory mechanisms including repression or attenuation of transcription, mRNA stabilization and degradation, riboswitch-based premature termination of transcription and control of initiation of translation. The length of these regions is usually related to their functional importance in gene expression regulatory processes. We analyzed the length distribution of the 5′UTR of the genes with identified TSS (Supplementary Figure S4). For the majority of C. difficile mRNAs (75% of the TSSs mapped), the first predicted translational start lies within 100-bp region downstream from the TSS. A total of 392 genes had a TSS located within 20–40 bp from the translational start site, and only few potentially leaderless genes (15) could be found. The presence of leaderless mRNAs has been reported in prokaryotes associated with atypical mechanisms of translation initiation (
Identification of Two Promoters Upstream Genes and Internal Promoters
For a total of 83 genes, we detected the possible existence of two TSSs (Supplementary Table S2 column A highlighted in green, Figure 1A, Supplementary Figure S5A). In the majority of cases, these additional TSSs were associated with lower signal from deep-sequencing data and either the same or a different sigma factor recognition motif could be found upstream of the TSSs. We could hypothesize that for these genes two alternative promoters could be used depending on the environmental factors and growth conditions. For example, rpmH (CD3680) gene encoding 50S ribosomal protein L34 is associated with one SigF- and one SigA-dependent promoter having different deep-sequencing signal intensity for both 5-end RNA-seq and whole transcript RNA-seq (Figure 1A). Likewise, for cbpA (CD3145) gene encoding surface-exposed adhesin, a first TSS potentially associated with SigA-dependent promoter is detected with lower signal intensity while a second SigA-dependent TSS is revealed with higher sequence reads number (Figure 1A). Interestingly, at least two potential cleavage sites could be found in 5′-end of cbpA CDS with high intensity signal from both TAP-treated and non-treated samples. In addition, potential internal TSS could be detected inside the coding part of this gene (Figure 1A). Two different promoters associated with different sigma factors were detected upstream of the CD0761 gene encoding a putative ATP-dependent RNA helicase and mreB (CD1145) gene encoding rod-shape determining protein MreB (Supplementary Figure S5A). In these cases, either a SigF- or a SigH-dependent promoter is present in addition to a SigA-dependent promoter (Supplementary Figure S5A and Supplementary Table S2).
A number of internal TSSs in the coding regions of genes was also detected, which further demonstrated a complex transcriptional architecture of C. difficile genome (Supplementary Table S2, column I highlighted in blue, Figure 1B). In many cases, these internal TSS map to the genes with identified primary TSS in accordance with the mechanisms for internal transcription initiation by elongating RNAP complexes suggested in bacteria (
Identification of Cleavage Sites Within Transcripts
In addition to TSS mapping, the comparison of RNA-seq signal intensity between TAP+ and TAP− samples allowed us to suggest several potential cleavage sites corresponding to positions with large number of reads in both samples treated or not with TAP enzyme (TAP+/TAP− ratio close to 1), located downstream from identified TSS and not associated with promoter consensus sequences from bioinformatics search. Examples of these sites potentially cleaved by cellular ribonucleases are shown in Figure 2 and Supplementary Figure S6. Different ribonucleases such as RNase III, RNase Y or RNase J could be involved in these potential processing events and could recognize particular secondary structures rather than specific sequence motifs (Trinquier et al., 2020). In the majority of cases, the potential cleavage sites are situated just downstream from the TSS at 23–62 bp and up to 87 bp distance and from 0 to 54 bp upstream of translation initiation RBS site (Figure 2). The processed mRNA would thus retain in the majority of cases the RBS and codon for translation initiation. For the CD0564 gene encoding ATP-dependent protease, the modA (CD0869) gene encoding molybdenum ABC-type transporter, the gcvTPA (CD1657) glycine decarboxylase operon and the CD2396 gene encoding conserved protein of unknown function the potential cleavage site is situated at 0 to 3 bp from RBS (Figure 2). By contrast, for the CD1392 gene encoding a putative ribonuclease, the potential cleavage site lies at “A” position inside the “GGAGG” RBS (Supplementary Figure S6). Sometimes, it is difficult to distinguish between potential cleavage sites and the presence of additional TSS based on TSS mapping data visualization (Figure 2, Supplementary Figure S6 and data not shown). Conversely, a part of potential TSS (Supplementary Tables S2, S3) could correspond to cleavage sites. A complex profile (Supplementary Figure S6) could be observed with several TSS and potential cleavage sites associated with the same gene, e.g., for the CD3145 adhesin-encoding gene (Figure 1A). CD1329 gene encoding RNaseY, CD1392 gene encoding a putative ribonuclease and ptsH (CD2756) gene encoding HPr protein of PTS system also presented a complex profile with several potential cleavage sites inside the gene (Supplementary Figure S6). Interestingly, a potential cleavage site could be also detected in the 3′-part of the agrB gene encoding accessory gene regulator of a quorum-sensing system (Supplementary Figure S6). This gene is co-transcribed with autoinducer prepeptide agrD gene. The cleavage of the bicistronic agrB-agrD mRNA will result in an agrD transcript and could lead to the stabilization of the processed transcript.
Transcription in the Pathogenicity Locus and Key Regulatory Genes
In C. difficile, the main virulence factors, toxins TcdA and TcdB, as well as toxin expression regulatory components TcdR, TcdC and TcdE are encoded in the 19.6 kb chromosomal region, called pathogenicity locus (PaLoc) (
Figure 3 and Supplementary Figure S7 show representative examples of TSS mapping for several genes encoding regulators such as CcpA, CodY, SigH, RstA, LuxS, LexA, and SinR known to directly or indirectly control toxin gene expression (
In silico Prediction of Promoter Motifs Associated With Different Sigma Factors
14 genes encoding sigma factors (two copies of SigA, SigH, SigF, SigE, SigG, SigK, SigB, SigD, TcdR, SigV, CsfU, CsfT and SigL) are present in the C. difficile 630 genome (Table 1). In addition, eight potential sigma factors associated with mobile genetic elements mainly in conjugative transposons of Tn916, Tn1549 or Tn5397 family are annotated in the genome (
The automatic search for promoters upstream of TSS is known to be difficult due to variations in the distance between −10 and −35 boxes or between the TSS and the −10 element and sometimes degenerated consensus sequences. The AT-rich nature of C. difficile genome especially in intergenic regions (Supplementary Figure S3) also complicates the search for promoters. To identify sigma factors corresponding to TSSs as reliably as possible, positional weight matrices (PWMs) for sigma factors were made on the basis of a set of binding sites in C. difficile genome that are identified by comparing expression profiles of WT strain versus mutants inactivated for each sigma factor. Data were previously obtained for SigK, SigH, SigF, SigG, SigD, SigE, SigB and TcdR (
FIGURE 4

Confusion matrix for the prediction of the sites recognized by the main sigma factors of C. difficile. Rows: actual sigma factors, based on changes in gene expression in knockout mutants. Columns: predicted sigma factors. A prediction was listed as correct if the actual sigma factor was among two best ones, and incorrect otherwise, in the latter case the top-scoring sigma factor was listed as the prediction.
The motifs for SigA-dependent promoter could be found closely upstream of TSS for 743 genes in C. difficile genome as best prediction (Supplementary Tables S2, S3). An extended −10 box with consensus sequence TGNTATAAT could be identified upstream of 245 TSSs (Supplementary Tables S2, S3) (
Based on the PWMs, previously reported transcriptomic data and manual inspection of promoters, we assigned a corresponding sigma factor involved in the transcription for most of the genes (Supplementary Tables S2, S3) and we refined the respective consensus sequences of promoters recognized by individual RNAP associated with specific sigma factors (Figure 5). We will discuss below in more detail the results obtained for SigH, the sigma factors specific of sporulation and SigL.
FIGURE 5

Consensus sequences for promoters recognized by the different sigma factors. These consensus were generated by WebLogo using the data presented in Supplementary Tables S2, S4–S6 and Table 3. The consensus for TcdR (Table 1) was obtained from characterized promoters (
In accordance to our previous analysis (Soutourina et al., 2013), the majority of ncRNA genes could be associated with SigA-dependent promoters. Upstream of a few ncRNA TSS, we predicted the presence of promoters probably recognized by SigD, SigB or sporulation-specific sigma factors (Supplementary Tables S3, S4).
Genes Transcribed by Sigma Factors of the Transition Phase and of Sporulation
Transition from exponential growth toward stationary phase represents a key checkpoint in C. difficile development associated with the induction of toxin production and decisions to initiate sporulation or biofilm formation. By comparing the transcriptome of the C. difficile strain 630Δerm and its isogenic sigH mutant, we have previously identified 286 genes, which are positively controlled by SigH (
TABLE 3
| Gene | Function | Expression ratio&sigH/630Δerm | Promoter recognized by SigH | Score promoter |
| CD0022 fusA1 | Elongation factor G | 0.04 | AAAAGAGGACAATTACCTCCAGATGTAGAAATAAAGCTAGTA | 4.29 |
| CD0142# | RNA-binding protein | 0.14 | AAAAGAGGATTATGAGAGTTCGTGTAGAATATATTATTA | 4.30 |
| CD0148 | Conserved hypothetical protein | 0.42 | GAAAAAGGTATCTACAATATACAGAGCGAATTTATAATA | 4.16 |
| CD0440 cwp27 | Cell wall binding protein | 0.25 | CATAAAGGAAAATATTCTTTTATGTAGAATTATAATATTTAAGTAA | 5.82 |
| CD0572# | Sporulation protein | 0.49 | GATAAAGGTATTTGGAAAAGTATGAAGAATACAGAAATAGA | 3.64 |
| CD0573* | Membrane protein | 0.45 | ATAAAAGCTATCCATATAAAATTAAAAAAATTCTTTTTAA | 1.57 |
| CD0770 spoIIAA | Anti-SigF factor | 0.03 | ATTGAAGGAATAAAAATATAATTATAGAATTGATTAAAAG | 4.93 |
| CD0789 | Conserved hypothetical protein | 0.3 | AATGCAGGAAAATCTACCCTGTTGAACGAATTAATAAAGA | 4.02 |
| CD0838 | DNA-binding protein | 0.26 | GTACAAGGATTTTAAAGATAAATATAGAAATTAATGTTTA | 4 |
| CD0865 | ADP-ribose binding protein | 0.08 | TTAACAGGATTTATGTAGGTGTTTATAGAAATAAATAAATA | 4.7 |
| CD0999 | ABC-type transport system, sulfonate/taurine | 0.35 | AAAGAAGGATTATTCGATAAATTAACAGAAATTAGTATAAA | 4.3 |
| CD1149 minC | Cell division regulator | 0.09 | ATAAAAGGGTTTAAAGCGTATTTGAAGAATATAAATGA | 3.48 |
| CD1214 spo0A# | Stage 0 sporulation protein A | 0.2 | TTAGGAGGAATATAATTTTGGAGTGTCGAATATGCTTTA | 5.79 |
| CD1221 | Membrane protein | 0.5 | ATAAAATGAATAACCCTTTGTCCTAAAGCATACTATTTTATA | 3.41 |
| CD1264 | Conserved hypothetical protein | 0.08 | AAAAGAGGAAAAATCATTTTAATGTAGAATAATTGTACA | 5.2 |
| CD1317 | Conserved hypothetical protein | 0.42 | TTAAAAGGAAAGACAGGATAAATATAGAAATTTTATAACA | 4.55 |
| CD1484 ssuA | ABC-type transport system, alkanesulfonates family | 0.08 | ATAAAAGGATTAAACAATTTAGTGTCGAAGATGAATATAA | 4.42 |
| CD1498 sigA2 | RNA polymerase sigma factor | 0.05 | ATATAAGGAGGATATTGCTGTTAGAAGTAGAATAATATTATA | 4.74 |
| CD1543.1 | Conserved hypothetical protein | 0.07 | TATAAAGGAAAAACCTCTTTTAATGTAGAAACTTATATTG | 5.4 |
| CD1622# | Conserved hypothetical protein | 0.46 | AAAAGAGGCTTGTTTCCATTTTGAGACAGTATAATTTTTATGTA | 2.09 |
| CD1654 lplA | Lipoate-protein ligase | 0.34 | TTTAAAGGAGTTTTTATATTATTGTCGAATTATAAAATTA | 5.43 |
| CD1878 | Sigma factor Tn1549-like | 0.45 | GATGGAGGAAACTTTATGGCAAAAGAGTATTATCTTTATATCA | 2.73 |
| CD1900 | Conserved hypothetical protein | 0.12 | ATAAAAGGAATTTACAAGTTATGTGTTGTATAGATATTGTA | 2.54 |
| CD1935 spoVS | Stage V sporulation protein S | 0.03 | AATAAAGGTTTTCTTAAAACGATTATAGAAGTATATTTTTA | 4.24 |
| CD1941 | Conserved hypothetical protein | 0.05 | TAACAAGGAAACAGAACCCTCTCATAGAAATTAAATTATTA | 3.68 |
| CD1967 | Conserved hypothetical protein | 0.03 | TTAGAAGGAAAATAGCTTTTATCATCAAATTAATAATTA | 5.08 |
| CD2063 | Conserved hypothetical protein | 0.45 | GATAGAGGATTTATAAGTGTTTAAGGTGAATTAAATATAA | 3.48 |
| CD2137 frr | Ribosome-recycling factor | 0.41 | AATAAAGGTATTTGAGCTTACAACAGAGAATATAATAAGA | 3.62 |
| CD2447 | Putative histidine triad protein | 0.06 | GTAGAAGGAATTTTGCTATAACATGTAGAAATTATAATATTTA | 4.83 |
| CD2646 ftsZ | Cell division protein FtsZ | 0.34 | TAAAAAGGAAAATTTACGTTTTTGTGGAATATGTTACTTA | 4.57 |
| CD2650 | Cell division protein Fts-Q type | 0.34 | TTTGTAGGAAAAACAAGCTCTAAAGGTGTATTTATTAACCA | 2.66 |
| CD2656 spoVD | Stage V sporulation protein D | 0.15 | TCTAAATGAATATAAAAATAAAAAAAAGAATAATTATAAAAA | 3.58 |
| CD2657* | Conserved hypothetical protein | 0.36 | TTTAGAGGAAGAAATATGATTAATAACAAATATAGTATA | 1.82 |
| CD2989 ssuA2 | Sulfonate-family ABC-type transporter | 0.39 | AAAGAAGGATTAAGTATGGATGATGTGGAATTTGTTAATA | 4.6 |
| CD3221 | Peptidase, M20D family | 0.16 | GAAACAGGGGAATTATTATTAATGGTGAATTATTTAATA | 2.85 |
| CD3290 | Conserved hypothetical protein | 0.19 | ACAAGAGGGATTGTTGATGATTTTATCGAAATCCTAATTA | 5.02 |
| CD3317 fdhF | Formate dehydrogenase-H | 0.31 | TTAAGAGGAATTGTGAGAAAATTGTTGAATTTAATAGATA | 3.76 |
| CD3458 | Membrane protein | 0.07 | GTTAAAGGAAATTGTAGGTAGTTTATCGAATTGTTTAATCA | 5.13 |
| CD3516 spoVG | Regulator of spore cortex synthesis | 0.01 | AAAAGAGGATATCCCTAGTTGTTCATAGAATTATTTA | 4.89 |
| CD3673 | DNA-binding protein Spo0J-like | 0.21 | TTCTCAGGAAATAATTAAGCTTACTGTAAAAAAACAA | 2.16 |
Promoters transcribed by SigH associated to the RNAP.
# means that two promoters are mapped upstream of the gene. *promoters with a lower score not used to obtain the consensus, which was determined with the promoters with a score > 2. & as determined by transcriptome analysis (
FIGURE 6

Promoters controlled by SigH in C. difficile. Examples of 5′-end RNA-seq (TAP–/TAP+ profile comparison) and RNA-seq data for dual tandem TSSs and/or internal TSSs inside coding sequences corresponding to SigH-dependent promoters are shown. Panel (A): CD1482-CD1484 operon and panel (B): CD0788-CD0789 operon.
Spore formation is a tightly controlled process that constitutes an essential step in C. difficile life cycle for its dissemination and survival. We have previously compared our TSS mapping data (Soutourina et al., 2013) with transcriptomic data done with microarrays comparing wild-type strain with mutants inactivated for sigF, sigE, sigG or sigK genes encoding major sporulation sigma factors at different times during sporulation in liquid media (
SigL-Dependent Promoters in C. difficile
SigL is a sigma 54 type sigma factor. In the genome of C. difficile, an important number of EBPs is present (
TABLE 4
| Gene | Operons | Functions | Fold change sigL::erm/ 630Δerm | Promoter -24,-12 | SigL-dependent associated regulator |
| CD0040 | CD0040-CD0043 | Activator, PTS Galactitol family | ATGGCATATAAGTTGCTAT | CD0040, LevR-type | |
| CD0166 | CD0166-CD0165 | Peptidase, amino acid transporter | 0.17* | ATGGCATAATAATTGCTTA | CD0167, GamR-type |
| CD0284 | CD0284-CD0289 | PTS Mannose/fructose/sorbose family | 0.2 to 0.3 | TTGGCACGGCAATTGCTTA | CD0283, LevR-type |
| CD0395/hadA# | hadAIBC-acdB-etfBA1 | Leucine utilization | < 0.001 (0.00001*) | TTGGCACGATTTATGCTTT | CD0402/LeuR |
| CD0442/ord# | ord-ortAB-oraSEF-orr-nhaC | Ornithine degradation | NR | TTGGCACGATTTATGCTTT | CD0441/OrdR |
| CD0490# | CD0490-CD0494 | Sugar-P-dehydrogenase, PTS mannose/fructose/sorbose family | 0.24* | TTGGCATGAAAGTTGCTTT | CD0516? LevR-type |
| CD0800/crt1# | crt1-CD0801-catB-bcd-etfBA2 | Crotonase, permease, CoA transferase, acyl-CoA dehydrogenase, EtfBA | NR | TTGGCATAGTACTTGCTAT | CD0806/YctR |
| CD0860 | CD0860-CD0863 -malH1 | PTS lactose/cellobiose family- Maltose-6*P glucosidase | CTGGCATAATACTTGCTTA | CD0858° | |
| CD1187# | CD1187-CD1189 | CHP, γ-glutamyl-γ-aminobutyrate hydrolase, amino acid permease | NR | TTGGCATACATATTGCTAA | CD1186 GamR-type |
| CD1413/rhaT# | CD1413 | Membrane protein (RhaT) | 0.31 (0.19*) | ATGGCATAGTTTTTGCTTA | CD1412/XhaQ |
| CD1555# | CD1555 | Putative serine/threonine exchanger | 0.36 (0.5*) | TTGGCATAATATATGCTTA | ? |
| CD1740# | CD1740-CD1741 | Sarcosine reductase complex | NR | TTGGCATAGAAAATGCTTT | CD1739/SarR, TCS SarRS |
| CD2091 # | CD2091-CD2089 | Putative Xanthine/uracile permease (PbuX), adenosine derivate deaminase | NR | TTGGCATTATAATTGCTTC | CD2092-DioR1 |
| CD2279 | CD2279 | Sugar-P dehydrogenase | ATGGCATAGATATTGCTAT | CD2283? | |
| CD2283 | CD2283-CD2280 | Activator, PTS fructose/mannitol family | NR | ATGGCATGATAGTTGCTTA | CD2283 LevR-type |
| CD2327# | CD2327-CD2323 | Arabitol/xylitol PTS, sugar-P dehydrogenases | 0.03* | TTGGCACACAACATGCTTT | CD2328 LevR-type |
| CD2382# | CD2382-iorAB-butK | Aromatic aminotransferase, Indole-pyruvate oxidoreductase, butyrate kinase | 0.2 to 0.02 (0.01*) | TTGGCATAGTAATTGCTTA | CD2383/ZypR |
| CD2699# | CD2699-CD2697 | Membrane proteins, peptidase | 0.03 to 0.09 (0.01*) | TTGGCATAAGTTTTGCTTA | CD2700 |
| CD2733 | CD2733-CD2734.1 | PLP-dependent transferase, Na+/H+ antiporter, membrane protein | TTGGCACGTTGTTTGCTTA | CD2732 | |
| CD2862# | CD2862-CD2860 | dipeptidase, membrane proteins | TTGGCACATCAATTGCTAC | CD2863 | |
| CD2870/ kdgT1 | kdgT1-uxaA° | 2-keto 3-deoxygluconate permease, altronate dehydratase | 0.12 to 0.23 | TTGGCATAGTAATTGCTTT | CD2869/XduR |
| CD3093# | CD3093 | γ-glutamyl-γ-aminobutyrate hydrolase | TTGGTATGCTACTTGCTCT | CD3094 GamR-type | |
| CD3094 | CD3094 | Sigma-54 dependent regulator | TTGGCACAATTTTTGCTTT | CD3094 GamR-type | |
| CD3184/dpaL2 | dpaL2 | Diaminopropionate amonia lyase | 0.3* | TTGGCACGGTAATTGCTTT | CD3186/DioR2 |
| CD3187 | tdcF | Putative regulatory endoribonuclease | TTGGCACGTTAATTGCTT | CD3186/DioR2 | |
| CD2085 | dpaL1 | Diaminopropionate amonia lyase | TTGGCATGTTAATTGCTTA | CD3186/DioR2 | |
| CD3232/cdsB # | cdsB | Cysteine desulfidase | NR% | ATGGCATGTATTTTGCTAT | CD3233/CdsR^ |
| CD3244/prdA | prdA-CD3243-prdBDE-prdE2F CD3236 | Proline utilization | 0.4 to 0.5 | TTGGCATAGGAATTGCTTA | CD3245/PrdR |
| CD3247/ prdC | prdC | Proline utilization | TTGGCATAGAAATTGCTTT | CD3245/PrdR | |
| CD3279 | CD3279-CD3275 | PTS Mannose/fructose/sorbose family, sugar-P isomerase | TTGGCATACTTTTTGCTTT | CD3280 LevR-type |
SigL-dependent promoters in C. difficile 630 based on TSS mapping, transcriptome data and in silico analysis.
# the transcriptional start sites were mapped by 5′-end RNA-seq (see Supplementary Table S2). * as determined by qRT-PCR. °pseudogen in strain 630. % cdsB is controlled by SigL in TY in the presence of cysteine (
SigL-Mediated Control of Gene Expression in C. difficile
To identify genes expressed under the control of SigL, we performed a transcriptome analysis comparing the expression in the strain 630Δerm and the sigL::erm mutant after 4 h of growth in TY. Approximately 7.5 % of the C. difficile genes were found to be differentially expressed between these two strains. 165 genes were up-regulated and 124 genes were down-regulated in the sigL::erm mutant (Supplementary Table S7). We confirmed these results by qRT-PCR analyses for 10 genes (Table 4). Only 27 genes identified as containing a “−24,−12” promoter and very likely controlled by SigL were down-regulated according to the transcriptomic data obtained. We were able to detect 4 additional operons (13 genes) as controlled by SigL using qRT-PCR (Table 4). These results are not surprising since most of the genes transcribed by RNAP associated to SigL respond to specific inducers through their associated EBP activators sensing these signals (
Role of SigL in the Physiology of C. difficile
To complete our view of the role of SigL in the physiology of C. difficile, we combined the data on the control of expression by SigL with those obtained on the identification of “−24,−12” promoters. As described in other firmicutes (
Interestingly, we also observed a large set of genes involved in amino-acid degradation or encoding peptidases and amino-acid permeases that are controlled either directly or indirectly by SigL and/or transcribed by the RNAP associated to SigL (Table 4 and Supplementary Table S7). C. difficile can use some amino acids as energy source through Stickland reactions (
FIGURE 7

Genes involved in peptide and amino-acid catabolism controlled by SigL in C. difficile. Upstream of genes indicated in green, a “–24, –12” promoter was mapped or identified in silico (Table 4). * indicated genes with a “–24, –12” promoter and positively controlled by SigL in transcriptome or in qRT-PCR experiments (Table 4). Genes indicated in blue are positively controlled by SigL in transcriptome but a “–24, –12” promoter is absent upstream of the gene (Supplementary Table S7). Genes indicated in red are negatively controlled by SigL in transcriptome (Supplementary Table S7). Green arrow indicates a compound less detected by Gas-liquid chromatography analysis (Figure 8).
Impact of SigL Inactivation on Growth and End-Fermentation Products
To confirm the role of SigL in C. difficile, we tested the growth of the WT and sigL::erm mutant strains (
FIGURE 8

Growth and fermentation products of the WT and sigL::erm mutant strains. (A) Growth curves of the 630Δerm and the sigL::erm strains in TY and TY + 0.5% glucose. Growth curves are representative of at least three independent experiments. Concentrations of volatile (B) and non-volatile (C) fermentations end products of the 630Δerm and the sigL::erm strains grown 48 h in TY. Gas-liquid chromatography analysis was performed from the supernatant of the culture of both strains as described in materials and methods. The concentration of the fermentation end products was standardized on the OD600nm of the cultures after 48 h of growth. We could not detect butanol nor ethanol by these assays. The error bars represent the standard deviation of the mean. Asterisks indicate statistical significance (t-test or t-test Welch, ∗∗∗p ≤ 0.001, ∗∗p ≤ 0.01, ∗p ≤ 0.05).
To confirm the impact of SigL inactivation on the fermentation processes, we also analyzed the end products of fermentation in the 630Δerm and of the sigL::erm mutant by gas-liquid chromatography after 48 h of growth in TY medium. While the total concentration of volatile acids slightly increased, we observed a drastic decrease of non-volatile acids in the sigL::erm mutant compared to the 630Δerm strain (Figures 8B,C). These results confirmed that SigL inactivation led to important changes in metabolism and metabolite production. We observed a drastic depletion of pyruvic acid (Figure 8C) that can be associated at least partly to a drop-in expression of the genes involved in cysteine and serine uptake and degradation (Figure 7) and to an increased expression of ldh and maybe also adhE (Supplementary Figure S9). In the sigL mutant, the strong decreased production of the end-product of leucine degradation, isocaproic acid, (Figure 8B) correlates with the drastic reduction of expression of the hadA operon (Figure 7). Decreased leucine degradation through the reductive Stickland reactions could redirect leucine catabolism to the oxidative Stickland reactions explaining the significant increase of isovaleric acid in the supernatant of the sigL::erm mutant (Figure 8B) (
Conclusion
In the present study, we provide the first transcriptional map of the C. difficile genome demonstrating a complex structure of transcriptional units and operon organization in this pathogen. We have applied the combination of in silico and experimental strategies to establish the list of proposed TSS that will serve as a start point for further studies in global and gene-specific scale. In addition to primary TSSs, this genome-wide TSS mapping revealed the presence of tandem and internal promoters suggesting alternative ways to accommodate gene expression changes during C. difficile development. This pathogen uses its large arsenal of sigma factors to determine the promoter selectivity. C. difficile has also two housekeeping SigA encoding genes, one transcribed from a SigH-dependent promoter (
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/ Supplementary Material.
Author contributions
OS and IM-V co-designed the study, analyzed the data and wrote the manuscript. OS, TD, and LS performed the experiments. MM, PS, and MG collected and analyzed the data in silico. OS, IM-V, LS, PB, and BD manually analyzed the TSS. TD collected and analyzed the transcriptomic data. BD supervised the experimental work. TD, MM, MG, and BD revised the manuscript. All authors contributed to the article and approved the submitted version.
Funding
This work was supported by the Institut Pasteur, the Université de Paris, the Université Paris-Saclay, the Institute for Integrative Biology of the Cell, the Institut Universitaire de France (to OS and to IM-V), the Agence Nationale de la Recherche (“CloSTARn”, ANR-13-JSV3-0005-01 to OS), the DIM-1HEALTH regional Ile-de-France program (LSP Grant No. 164466), the CNRS-RFBR PRC 2019 (Grant No. 288426 N° 19-54-15003) to OS. The computational analysis was supported by a grant from the Russian Science Foundation (18-14-00358).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2020.01939/full#supplementary-material
FIGURE S1Representative example of TSS identification by PhageTerm software. Cov2HTML (
Operon organization of the genes coding the proteins involved in flagella biosynthesis and function associated with TSS mapping. The flagella genes are organized in several transcriptional units driven by RNAP in complex with alternative flagellum SigD or housekeeping SigA sigma factors. The TSS are shown by broken arrows, SigD-associated promoters are indicated in blue, SigA-associated promoters are shown in green and undefined promoters are depicted in black. Three boxed images show a zoom to the TSS mapping visualization for selected promoters. The genomic region visualization was made with MAGE platform (Vallenet et al., 2020), coding sequences are indicated by ORF in red and previously identified noncoding RNAs are shown by blue-green boxes.
FIGURE S3Nucleotide composition of TSS and frequency of each initiation nucleotide in C. difficile. 100 nucleotide regions (from −99 to +1) upstream of the TSS for C. difficile strain 630 genes have been aligned and the deduced consensus sequence generated with Weblogo program is presented. “+1” indicates TSS position, “−10” indicates the position of −10 promoter element.
FIGURE S4Length distribution of 5′UTR regions in the C. difficile strain 630 genome. The graph shows the length of 5′UTR (distance from the TSS to the translational start) and the number of genes with corresponding 5′UTR length range.
FIGURE S5TSS mapping of dual (A) and internal (B) promoters. Representative examples of 5′-end RNA-seq (TAP−/TAP+ profile comparison) and RNA-seq data for dual tandem TSS and internal TSS inside the coding sequences are shown in panels (A,B), respectively. Cov2HTML (
Examples of cleavage sites detected by TSS-mapping. Representative examples of 5′-end RNA-seq (TAP−/TAP+ profile comparison) and RNA-seq data for complex potential processing profiles are shown. The RNA-seq and 5′-end RNA-seq data visualization is presented as in Figure 1. Potential cleavage site shown by scissors mark corresponds to a position with large number of reads in both TAP− and TAP+ samples. RBS are shown by green boxes to highlight the positions of potential cleavage sites in the proximity or inside RBS.
FIGURE S7Additional examples of promoters controlling regulatory genes detected by TSS-mapping. Representative examples of 5′-end RNA-seq (TAP−/TAP+ profile comparison) data for the identification of TSS for genes encoding important transcriptional regulators are shown. The 5′-end RNA-seq data visualization is presented as in Figure 1. The sequence of promoter region is shown upstream of TSS with the −35 and −10 promoter elements indicated in blue and TSS indicated in red.
FIGURE S8Confusion matrix on training with the standard and strict criterion. Confusion matrices for the training set. (A) Listing scheme as in Figure 4, (B) Strict listing scheme with one top-scoring sigma factor taken as the prediction.
FIGURE S9Carbon metabolism genes controlled by SigL in C. difficile. Upstream of genes indicated in green, a “−24, −12” promoter was mapped or identified in silico (Table 4). ∗ indicated genes with a “−24, −12” promoter (Table 4). Genes in green are positively controlled by SigL in transcriptome or in qRT-PCR experiments as indicated by #. Genes indicated in red are negatively controlled by SigL in transcriptome (Supplementary Table S7). Green arrow indicates a compound less detected by Gas-liquid chromatography analysis (Figure 8).
TABLE S1Strains and plasmids used in this study.
TABLE S2Complete list of TSS and predicted promoters for C. difficile 630 CDS genes.
TABLE S3Complete list of TSS and predicted promoters for C. difficile 630 ncRNA genes.
TABLE S4In silico association of TSS with known sigma factors in C. difficile.
TABLE S5Identification of promoters recognized by SigF and SigG.
TABLE S6Identification of promoters recognized by SigE and/or SigK.
TABLE S7Transcriptomics results for sigL::erm mutant.
Footnotes
References
1
AbtM. C.MckenneyP. T.PamerE. G. (2016). Clostridium difficile colitis: pathogenesis and host defence.Nat. Rev. Microbiol.14609–620. 10.1038/nrmicro.2016.108
2
AmmanF.WolfingerM. T.LorenzR.HofackerI. L.StadlerP. F.FindeissS. (2014). TSSAR: TSS annotation regime for dRNA-seq data.BMC Bioinform.15:89. 10.1186/1471-2105-15-89
3
AndreG.EvenS.PutzerH.BurguiereP.CrouxC.DanchinA.et al (2008). S-box and T-box riboswitches and antisense RNA control a sulfur metabolic operon of Clostridium acetobutylicum.Nucleic Acids Res.365955–5969. 10.1093/nar/gkn601
4
Anjuwon-FosterB. R.TamayoR. (2017). A genetic switch controls the production of flagella and toxins in Clostridium difficile.PLoS Genet.13:e1006701. 10.1371/journal.pgen.1006701
5
AntunesA.CamiadeE.MonotM.CourtoisE.BarbutF.SernovaN. V.et al (2012). Global transcriptional control by glucose and carbon regulator CcpA in Clostridium difficile.Nucleic Acids Res.4010701–10718. 10.1093/nar/gks864
6
AubryA.HussackG.ChenW.KuoleeR.TwineS. M.FultonK. M.et al (2012). Modulation of toxin production by the flagellar regulon in Clostridium difficile.Infect. Immun.803521–3532. 10.1128/iai.00224-12
7
BabskiJ.HaasK. A.Nather-SchindlerD.PfeifferF.ForstnerK. U.HammelmannM.et al (2016). Genome-wide identification of transcriptional start sites in the haloarchaeon Haloferax volcanii based on differential RNA-Seq (dRNA-Seq).BMC Genom.17:629. 10.1186/1471-2105-15-629
8
BanawasS. S. (2018). Clostridium difficile infections: a global overview of drug sensitivity and resistance mechanisms.Biomed. Res. Int.2018:8414257.
9
BenjaminiY.HochbergY. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing.J. R. Stat. Soc. Ser. B57289–300. 10.1111/j.2517-6161.1995.tb02031.x
10
BouillautL.SelfW. T.SonensheinA. L. (2013). Proline-dependent regulation of Clostridium difficile Stickland metabolism.J. Bacteriol.195844–854. 10.1128/jb.01492-12
11
BradshawW. J.BruxelleJ. F.Kovacs-SimonA.HarmerN. J.JanoirC.PechineS.et al (2019). Molecular features of lipoprotein CD0873: a potential vaccine against the human pathogen Clostridioides difficile.J. Biol. Chem.29415850–15861. 10.1074/jbc.ra119.010120
12
BraunV.HundsbergerT.LeukelP.SauerbornM.Von Eichel-StreiberC. (1996). Definition of the single integration site of the pathogenicity locus in Clostridium difficile.Gene18129–38. 10.1016/s0378-1119(96)00398-8
13
BrouwerM. S.WarburtonP. J.RobertsA. P.MullanyP.AllanE. (2011). Genetic organisation, mobility and predicted functions of genes on integrated, mobile genetic elements in sequenced strains of Clostridium difficile.PLoS One6:e23014. 10.1371/journal.pgen.0023014
14
BrowningD. F.BusbyS. J. (2016). Local and global regulation of transcription initiation in bacteria.Nat. Rev. Microbiol.14638–650. 10.1038/nrmicro.2016.103
15
BurgessR. R.AnthonyL. (2001). How sigma docks to RNA polymerase and what sigma does.Curr. Opin. Microbiol.4126–131. 10.1016/s1369-5274(00)00177-6
16
CarlierJ. P.SellierN. (1989). Gas chromatographic-mass spectral studies after methylation of metabolites produced by some anaerobic bacteria in spent media.J. Chromatogr.493257–273. 10.1016/S0378-4347(00)82733-4
17
CarrollK. C.BartlettJ. G. (2011). Biology of Clostridium difficile: implications for epidemiology and diagnosis.Annu. Rev. Microbiol.65501–521.
18
ChaoY.PapenfortK.ReinhardtR.SharmaC. M.VogelJ. (2012). An atlas of Hfq-bound transcripts reveals 3’ UTRs as a genomic reservoir of regulatory small RNAs.EMBO J.314005–4019. 10.1038/emboj.2012.229
19
CuklinaJ.HahnJ.ImakaevM.OmasitsU.ForstnerK. U.LjubimovN.et al (2016). Genome-wide transcription start site mapping of Bradyrhizobium japonicum grown free-living or in symbiosis - a rich resource to identify new transcripts, proteins and to study gene regulation.BMC Genomics17:302. 10.1186/1471-2105-15-302
20
DannheimH.RiedelT.Neumann-SchaalM.BunkB.SchoberI.SproerC.et al (2017). Manual curation and reannotation of the genomes of Clostridium difficile 630Deltaerm and C. difficile 630.J. Med. Microbiol.66286–293. 10.1099/jmm.0.000427
21
DansonA. E.JovanovicM.BuckM.ZhangX. (2019). Mechanisms of sigma(54)-dependent transcription initiation and regulation.J. Mol. Biol.4313960–3974. 10.1016/j.jmb.2019.04.022
22
DeLougheryA.LalanneJ. B.LosickR.LiG. W. (2018). Maturation of polycistronic mRNAs by the endoribonuclease RNase Y and its associated Y-complex in Bacillus subtilis.Proc. Natl. Acad. Sci. U.S.A.115E5585–E5594.
23
DeutscherJ.FranckeC.PostmaP. W. (2006). How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria.Microbiol. Mol. Biol. Rev.70939–1031. 10.1128/mmbr.00024-06
24
DineenS. S.McbrideS. M.SonensheinA. L. (2010). Integration of metabolism and virulence by Clostridium difficile CodY.J. Bacteriol.1925350–5362. 10.1128/jb.00341-10
25
DuboisT.Dancer-ThibonnierM.MonotM.HamiotA.BouillautL.SoutourinaO.et al (2016). Control of Clostridium difficile physiopathology in response to cysteine availability.Infect. Immun.842389–2405. 10.1128/iai.00121-16
26
DupuyB.SonensheinA. L. (1998). Regulated transcription of Clostridium difficile toxin genes.Mol. Microbiol.27107–120.
27
EckweilerD.DudekC. A.HartlichJ.BrotjeD.JahnD. (2018). PRODORIC2: the bacterial gene regulation database in 2018.Nucleic Acids Res.46D320–D326.
28
El MeoucheI.PeltierJ.MonotM.SoutourinaO.Pestel-CaronM.DupuyB.et al (2013). Characterization of the SigD regulon of C. difficile and its positive control of toxin production through the regulation of tcdR.PLoS One8:e83748. 10.1371/journal.pgen.0083748
29
EmersonJ. E.ReynoldsC. B.FaganR. P.ShawH. A.GouldingD.FairweatherN. F. (2009). A novel genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell wall protein.Mol. Microbiol.74541–556. 10.1111/j.1365-2958.2009.06812.x
30
FimlaidK. A.BondJ. P.SchutzK. C.PutnamE. E.LeungJ. M.LawleyT. D.et al (2013). Global analysis of the sporulation pathway of Clostridium difficile.PLoS Genet.9:e1003660. 10.1371/journal.pgen.1003660
31
FonknechtenN.PerretA.PerchatN.TricotS.LechaplaisC.VallenetD.et al (2009). A conserved gene cluster rules anaerobic oxidative degradation of L-ornithine.J. Bacteriol.1913162–3167. 10.1128/jb.01777-08
32
FranckeC.Groot KormelinkT.HagemeijerY.OvermarsL.SluijterV.MoezelaarR.et al (2011). Comparative analyses imply that the enigmatic Sigma factor 54 is a central controller of the bacterial exterior.BMC Genomics12:385. 10.1186/1471-2105-15-385
33
GarneauJ. R.DepardieuF.FortierL. C.BikardD.MonotM. (2017). PhageTerm: a tool for fast and accurate determination of phage termini and packaging mechanism using next-generation sequencing data.Sci. Rep.7:8292.
34
GruberT. M.GrossC. A. (2003). Multiple sigma subunits and the partitioning of bacterial transcription space.Annu. Rev. Microbiol.57441–466. 10.1146/annurev.micro.57.030502.090913
35
GuH.ShiK.LiaoZ.QiH.ChenS.WangH.et al (2018). Time-resolved transcriptome analysis of Clostridium difficile R20291 response to cysteine.Microbiol. Res.215114–125. 10.1016/j.micres.2018.07.003
36
GuH.YangY.WangM.ChenS.WangH.LiS.et al (2017). Novel cysteine desulfidase CdsB involved in releasing cysteine repression of toxin synthesis in Clostridium difficile.Front. Cell Infect. Microbiol.7:531. 10.3389/fcimb.2017.00531
37
GuoM. S.UpdegroveT. B.GogolE. B.ShabalinaS. A.GrossC. A.StorzG. (2014). MicL, a new sigmaE-dependent sRNA, combats envelope stress by repressing synthesis of Lpp, the major outer membrane lipoprotein.Genes Dev.281620–1634. 10.1101/gad.243485.114
38
HardenT. T.WellsC. D.FriedmanL. J.LandickR.HochschildA.KondevJ.et al (2016). Bacterial RNA polymerase can retain sigma70 throughout transcription.Proc. Natl. Acad. Sci. U.S.A.113602–607. 10.1073/pnas.1513899113
39
HoT. D.EllermeierC. D. (2011). PrsW is required for colonization, resistance to antimicrobial peptides, and expression of extracytoplasmic function sigma factors in Clostridium difficile.Infect. Immun.793229–3238. 10.1128/iai.00019-11
40
HorJ.GorskiS. A.VogelJ. (2018). Bacterial RNA biology on a genome scale.Mol. Cell.70785–799. 10.1016/j.molcel.2017.12.023
41
JacksonS.CalosM.MyersA.SelfW. T. (2006). Analysis of proline reduction in the nosocomial pathogen Clostridium difficile.J. Bacteriol.1888487–8495. 10.1128/jb.01370-06
42
JagerD.ForstnerK. U.SharmaC. M.SantangeloT. J.ReeveJ. N. (2014). Primary transcriptome map of the hyperthermophilic archaeon Thermococcus kodakarensis.BMC Genom.15:684. 10.1186/1471-2105-15-684
43
JagerD.SharmaC. M.ThomsenJ.EhlersC.VogelJ.SchmitzR. A. (2009). Deep sequencing analysis of the methanosarcina mazei Go1 transcriptome in response to nitrogen availability.Proc. Natl. Acad. Sci. U.S.A.10621878–21882. 10.1073/pnas.0909051106
44
JanoirC. (2016). Virulence factors of Clostridium difficile and their role during infection.Anaerobe3713–24. 10.1016/j.anaerobe.2015.10.009
45
JorjaniH.ZavolanM. (2014). TSSer: an automated method to identify transcription start sites in prokaryotic genomes from differential RNA sequencing data.Bioinformatics30971–974. 10.1093/bioinformatics/btt752
46
KeessenE. C.GaastraW.LipmanL. J. (2011). Clostridium difficile infection in humans and animals, differences and similarities.Vet. Microbiol.153205–217. 10.1016/j.vetmic.2011.03.020
47
KeiltyS.RosenbergM. (1987). Constitutive function of a positively regulated promoter reveals new sequences essential for activity.J. Biol. Chem.2626389–6395.
48
KintN.JanoirC.MonotM.HoysS.SoutourinaO.DupuyB.et al (2017). The alternative sigma factor sigmaB plays a crucial role in adaptive strategies of Clostridium difficile during gut infection.Environ. Microbiol.191933–1958. 10.1111/1462-2920.13696
49
LivakK. J.SchmittgenT. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.Methods25402–408. 10.1006/meth.2001.1262
50
LoA. W.MorielD. G.PhanM. D.SchulzB. L.KiddT. J.BeatsonS. A.et al (2017). ‘Omic’ approaches to study uropathogenic Escherichia coli virulence.Trends Microbiol.25729–740. 10.1016/j.tim.2017.04.006
51
MaikovaA.PeltierJ.BoudryP.HajnsdorfE.KintN.MonotM.et al (2018). Discovery of new type I toxin-antitoxin systems adjacent to CRISPR arrays in Clostridium difficile.Nucleic Acids Res.464733–4751. 10.1093/nar/gky124
52
ManiN.DupuyB. (2001). Regulation of toxin synthesis in Clostridium difficile by an alternative RNA polymerase sigma factor.Proc. Natl. Acad. Sci. U.S.A.985844–5849. 10.1073/pnas.101126598
53
ManiN.LyrasD.BarrosoL.HowarthP.WilkinsT.RoodJ. I.et al (2002). Environmental response and autoregulation of Clostridium difficile TxeR, a sigma factor for toxin gene expression.J. Bacteriol.1845971–5978. 10.1128/jb.184.21.5971-5978.2002
54
Martin-VerstraeteI.PeltierJ.DupuyB. (2016). The regulatory networks that control Clostridium difficile toxin synthesis.Toxins8:153. 10.3390/toxins8050153
55
MatamourosS.EnglandP.DupuyB. (2007). Clostridium difficile toxin expression is inhibited by the novel regulator TcdC.Mol. Microbiol.641274–1288. 10.1111/j.1365-2958.2007.05739.x
56
MonotM.Boursaux-EudeC.ThibonnierM.VallenetD.MoszerI.MedigueC.et al (2011). Reannotation of the genome sequence of Clostridium difficile strain 630.J. Med. Microbiol.601193–1199. 10.1099/jmm.0.030452-0
57
MonotM.OrgeurM.CamiadeE.BrehierC.DupuyB. (2014). COV2HTML: a visualization and analysis tool of bacterial next generation sequencing (NGS) data for postgenomics life scientists.OMICS18184–195. 10.1089/omi.2013.0119
58
MurakamiK. S.DarstS. A. (2003). Bacterial RNA polymerases: the wholo story.Curr. Opin. Struct. Biol.1331–39. 10.1016/s0959-440x(02)00005-2
59
NakagawaS.NiimuraY.MiuraK.GojoboriT. (2010). Dynamic evolution of translation initiation mechanisms in prokaryotes.Proc. Natl. Acad. Sci. U.S.A.1076382–6387. 10.1073/pnas.1002036107
60
Neumann-SchaalM.HofmannJ. D.WillS. E.SchomburgD. (2015). Time-resolved amino acid uptake of Clostridium difficile 630Deltaerm and concomitant fermentation product and toxin formation.BMC Microbiol.15:281. 10.1186/1471-2105-15-281
61
Neumann-SchaalM.JahnD.Schmidt-HohagenK. (2019). Metabolism the difficile way: the key to the success of the pathogen Clostridioides difficile.Front. Microbiol.10:219. 10.3389/fcimb.2017.00219
62
NieX.DongW.YangC. (2019). Genomic reconstruction of sigma(54) regulons in Clostridiales.BMC Genomics20:565. 10.1186/1471-2105-15-565
63
PapenfortK.ForstnerK. U.CongJ. P.SharmaC. M.BasslerB. L. (2015). Differential RNA-seq of Vibrio cholerae identifies the VqmR small RNA as a regulator of biofilm formation.Proc. Natl. Acad. Sci. U.S.A.112E766–E775.
64
PereiraF. C.SaujetL.TomeA. R.SerranoM.MonotM.Couture-TosiE.et al (2013). The spore differentiation pathway in the enteric pathogen Clostridium difficile.PLoS Genet.9:e1003782. 10.1371/journal.pgen.1003782
65
PishdadianK.FimlaidK. A.ShenA. (2015). SpoIIID-mediated regulation of sigmaK function during Clostridium difficile sporulation.Mol. Microbiol.95189–208. 10.1111/mmi.12856
66
Rosinski-ChupinI.SauvageE.FouetA.PoyartC.GlaserP. (2019). Conserved and specific features of Streptococcus pyogenes and Streptococcus agalactiae transcriptional landscapes.BMC Genomics20:236. 10.1186/1471-2105-15-236
67
Rosinski-ChupinI.SauvageE.SismeiroO.VillainA.Da CunhaV.CaliotM. E.et al (2015). Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.BMC Genomics16:419. 10.1186/1471-2105-15-419
68
RupnikM.WilcoxM. H.GerdingD. N. (2009). Clostridium difficile infection: new developments in epidemiology and pathogenesis.Nat. Rev. Microbiol.7526–536. 10.1038/nrmicro2164
69
SahrT.RusniokC.Dervins-RavaultD.SismeiroO.CoppeeJ. Y.BuchrieserC. (2012). Deep sequencing defines the transcriptional map of L. pneumophila and identifies growth phase-dependent regulated ncRNAs implicated in virulence.RNA Biol.9503–519. 10.4161/rna.20270
70
SalibaA. E.SantosS. C.VogelJ. (2017). New RNA-seq approaches for the study of bacterial pathogens.Curr. Opin. Microbiol.3578–87. 10.1016/j.mib.2017.01.001
71
SaujetL.MonotM.DupuyB.SoutourinaO.Martin-VerstraeteI. (2011). The key sigma factor of transition phase, SigH, controls sporulation, metabolism, and virulence factor expression in Clostridium difficile.J. Bacteriol.1933186–3196. 10.1128/jb.00272-11
72
SaujetL.PereiraF. C.HenriquesA. O.Martin-VerstraeteI. (2014). The regulatory network controlling spore formation in Clostridium difficile.FEMS Microbiol. Lett.3581–10. 10.1111/1574-6968.12540
73
SaujetL.PereiraF. C.SerranoM.SoutourinaO.MonotM.ShelyakinP. V.et al (2013). Genome-wide analysis of cell type-specific gene transcription during spore formation in Clostridium difficile.PLoS Genet.9:e1003756. 10.1371/journal.pgen.1003756
74
SebaihiaM.WrenB. W.MullanyP.FairweatherN. F.MintonN.StablerR.et al (2006). The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome.Nat. Genet.38779–786. 10.1038/ng1830
75
ShaoW.PriceM. N.DeutschbauerA. M.RomineM. F.ArkinA. P. (2014). Conservation of transcription start sites within genes across a bacterial genus.mBio5:e1398-14.
76
SharmaC. M.HoffmannS.DarfeuilleF.ReignierJ.FindeissS.SittkaA.et al (2010). The primary transcriptome of the major human pathogen Helicobacter pylori.Nature464250–255. 10.1038/nature08756
77
SharmaC. M.VogelJ. (2014). Differential RNA-seq: the approach behind and the biological insight gained.Curr. Opin. Microbiol.1997–105. 10.1016/j.mib.2014.06.010
78
SierroN.MakitaY.De HoonM.NakaiK. (2008). DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information.Nucleic Acids Res.36D93–D96.
79
SinevaE.SavkinaM.AdesS. E. (2017). Themes and variations in gene regulation by extracytoplasmic function (ECF) sigma factors.Curr. Opin. Microbiol.36128–137. 10.1016/j.mib.2017.05.004
80
SmythG. K.SpeedT. (2003). Normalization of cDNA microarray data.Methods31265–273. 10.1016/s1046-2023(03)00155-5
81
SorekR.CossartP. (2010). Prokaryotic transcriptomics: a new view on regulation, physiology and pathogenicity.Nat. Rev. Genet.119–16. 10.1038/nrg2695
82
SoutourinaO. A.MonotM.BoudryP.SaujetL.PichonC.SismeiroO.et al (2013). Genome-wide identification of regulatory RNAs in the human pathogen Clostridium difficile.PLoS Genet.9:e1003493. 10.1371/journal.pgen.1003493
83
StablerR. A.GerdingD. N.SongerJ. G.DrudyD.BrazierJ. S.TrinhH. T.et al (2006). Comparative phylogenomics of Clostridium difficile reveals clade specificity and microevolution of hypervirulent strains.J. Bacteriol.1887297–7305. 10.1128/jb.00664-06
84
StevensonE.MintonN. P.KuehneS. A. (2015). The role of flagella in Clostridium difficile pathogenicity.Trends Microbiol23275–282. 10.1016/j.tim.2015.01.004
85
StulkeJ.ArnaudM.RapoportG.Martin-VerstraeteI. (1998). PRD–a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria.Mol. Microbiol.28865–874. 10.1046/j.1365-2958.1998.00839.x
86
SudarsanN.LeeE. R.WeinbergZ.MoyR. H.KimJ. N.LinkK. H.et al (2008). Riboswitches in eubacteria sense the second messenger cyclic di-GMP.Science321411–413.
87
TrinquierA.DurandS.BraunF.CondonC. (2020). Regulation of RNA processing and degradation in bacteria.Biochim. Biophys. Acta Gene Regul. Mech.1863:194505. 10.1016/j.bbagrm.2020.194505
88
VallenetD.CalteauA.DuboisM.AmoursP.BazinA.BeuvinM.et al (2020). MicroScope: an integrated platform for the annotation and exploration of microbial gene functions through genomic, pangenomic and metabolic comparative analysis.Nucleic Acids Res.48D579–D589.
89
VedantamG.ClarkA.ChuM.McquadeR.MallozziM.ViswanathanV. (2012). Clostridium difficile infection: toxins and non-toxin virulence factors, and their contributions to disease establishment and host response.Gut Microb.3121–134. 10.4161/gmic.19399
90
WoodsE. C.NawrockiK. L.SuarezJ. M.McbrideS. M. (2016). The Clostridium difficile Dlt pathway is controlled by the extracytoplasmic function sigma Factor sigmaV in response to Lysozyme.Infect. Immun.841902–1916. 10.1128/iai.00207-16
91
WurtzelO.SapraR.ChenF.ZhuY.SimmonsB. A.SorekR. (2010). A single-base resolution map of an archaeal transcriptome.Genome Res.20133–141. 10.1101/gr.100396.109
92
WurtzelO.SestoN.MellinJ. R.KarunkerI.EdelheitS.BecavinC.et al (2012a). Comparative transcriptomics of pathogenic and non-pathogenic Listeria species.Mol. Syst. Biol.8:583. 10.1038/msb.2012.11
93
WurtzelO.Yoder-HimesD. R.HanK.DandekarA. A.EdelheitS.GreenbergE. P.et al (2012b). The single-nucleotide resolution transcriptome of Pseudomonas aeruginosa grown in body temperature.PLoS Pathog.8:e1002945. 10.1371/journal.pgen.1002945
Summary
Keywords
transcription initiation, transcription unit architecture, sigma factors, sigma 54, amino acid catabolism
Citation
Soutourina O, Dubois T, Monot M, Shelyakin PV, Saujet L, Boudry P, Gelfand MS, Dupuy B and Martin-Verstraete I (2020) Genome-Wide Transcription Start Site Mapping and Promoter Assignments to a Sigma Factor in the Human Enteropathogen Clostridioides difficile. Front. Microbiol. 11:1939. doi: 10.3389/fmicb.2020.01939
Received
28 April 2020
Accepted
23 July 2020
Published
13 August 2020
Volume
11 - 2020
Edited by
Miroslav Patek, Academy of Sciences of the Czech Republic, Czechia
Reviewed by
Björn Voß, University of Stuttgart, Germany; Masaya Fujita, University of Houston, United States
Updates

Check for updates
Copyright
© 2020 Soutourina, Dubois, Monot, Shelyakin, Saujet, Boudry, Gelfand, Dupuy and Martin-Verstraete.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Olga Soutourina, olga.soutourina@i2bc.paris-saclay.frIsabelle Martin-Verstraete, isabelle.martin-verstraete@pasteur.fr
†These authors have contributed equally to this work
‡Present address: Thomas Dubois, UMR UMET, INRA, CNRS, Univ. Lille 1, Villeneuve d’Ascq, France Laure Saujet, Pherecydes Pharma, Romainville, France Pierre Boudry, Université Paris-Saclay, CEA, CNRS, Institute for Integrative Biology of the Cell (I2BC), Gif-sur-Yvette, France
This article was submitted to Microbial Physiology and Metabolism, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.