ORIGINAL RESEARCH article

Front. Microbiol., 02 February 2021

Sec. Antimicrobials, Resistance and Chemotherapy

Volume 12 - 2021 | https://doi.org/10.3389/fmicb.2021.631426

Targeting Salmonella Typhimurium Invasion and Intracellular Survival Using Pyrogallol

  • 1. Laboratory of Veterinary Pharmacokinetics and Pharmacodynamics, College of Veterinary Medicine, Kyungpook National University, Daegu, South Korea

  • 2. Development and Reproductive Toxicology Research Group, Korea Institute of Toxicology, Daejeon, South Korea

Abstract

Salmonella enterica serovar Typhimurium, an intracellular pathogen, evades the host immune response mechanisms to cause gastroenteritis in animals and humans. After invading the host cells, the bacteria proliferate in Salmonella-containing vacuole (SCV) and escapes from antimicrobial therapy. Moreover, Salmonella Typhimurium develops resistance to various antimicrobials including, fluoroquinolones. Treating intracellular bacteria and combating drug resistance is essential to limit the infection rate. One way of overcoming these challenges is through combination therapy. In this study, Pyrogallol (PG), a polyphenol, is combined with marbofloxacin (MAR) to investigate its effect on Salmonella Typhimurium invasion and intracellular survival inhibition. The Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of PG against Salmonella Typhimurium were 128 and 256 μg/mL, respectively. The lowest fractional inhibitory concentration (FIC) index for a combination of PG and MAR was 0.5. The gentamycin protection assay revealed that PG (30 μg/mL) alone and in combination with sub-MIC of MAR inhibited 72.75 and 76.18% of the invading bacteria in Caco-2 cells, respectively. Besides, the intracellular survival of Salmonella Typhimurium was reduced by 7.69 and 74.36% in treatment with PG alone and combined with sub-MIC of MAR, respectively, which was visualized by the confocal microscopy. PG has also shown to increase the intracellular accumulation of fluoroquinolone by 15.2 and 34.9% at 30 and 100 μg/mL concentration, respectively. Quantitative real-time PCR demonstrated PG suppressed the genetic expression of hilA, invF, sipB, and acrA by 14.6, 15.4, 13.6, and 36%, respectively. However, the downregulation of hilA, invF, sipB, and acrA increased to 80, 74.6, 78, and 70.1%, in combination with sub-MIC of MAR, respectively. Similarly, PG combined with MAR inhibited the expression of sdiA, srgE, and rck genes by 78.6, 62.8, and 61.8%, respectively. In conclusion, PG has shown antimicrobial activity against Salmonella Typhimurium alone and in combination with MAR. It also inhibited invasion and intracellular survival of the bacteria through downregulation of quorum sensing, invading virulence, and efflux pump genes. Hence, PG could be a potential antimicrobial candidate which could limit the intracellular survival and replication of Salmonella Typhimurium.

Introduction

Salmonella enterica subsp. enterica serovar Typhimurium, an intracellular Gram-negative bacterium, is a non-typhoidal Salmonella serotype known to cause diarrhea and intestinal inflammation in humans and animals (). Upon ingestion, salmonella adhere to epithelial lining of the ilium and colon to cause gastrointestinal infection (). In the small intestine, the bacteria invade specialized epithelial cells called M cells. It triggers membrane ruffling and actin rearrangement which leads to bacterial internalization upon injecting its effector proteins (). The T3SS-1 genes plays a significant role to invade the intestinal epithelial cells and mediate bacterial entry and their persistence in the host cells (). Successful adherence and invasion of the host cell are essential to cause infections. Salmonella Typhimurium invades epithelial cells either through cytoskeletal rearrangement known as the “Trigger” mechanism or receptor-mediated entry “Zipper” mechanism (). Internalization is facilitated by several Salmonella secreted effector proteins (). After internalization Salmonella resides in the Salmonella-containing vacuoles to shield from host innate immune responses (). Hence, inhibition of bacterial adhesion, invasion, and intracellular survival is critical in controlling infections. However, effective delivery of antimicrobial agents within the host cells is the main challenge (). Hence, identifying natural compounds with a higher penetration capacity has significant importance ().

Besides, Salmonella Typhimurium developed resistance against fluoroquinolones, including marbofloxacin (MAR), which is a widely used antibacterial agent against intracellular bacteria in veterinary medicine (). Antimicrobial resistance has become a common trend worldwide, and most of the bacteria have been developing resistance to the commonly utilized antibacterial agents (). To worsen the situation, the introduction of newly invented antimicrobials into the market is declining. Hence, designing alternative methods to overcome these challenges is critical. One means of tackling the alarmingly overgrowing drug resistance is through a combination therapy of currently available antimicrobials, either with other existing antimicrobials or using natural compounds ().

Polyphenols are phytochemicals found richly in natural, edible plants. They are known for their antioxidant properties, antibacterial activity, and prevention of non-communicable diseases like cancer, cardiovascular, and neurodegenerative diseases (; ). Furthermore, polyphenols inhibit angiogenesis, and aging, maintains blood pressure and sugar level, and have anti-inflammatory properties, regulate enzyme function, and stimulate cell receptors (; ; ). Recently, polyphenols like methyl gallate showed to prevent microbial adhesion, invasion, and intracellular survival of microbial agents through inhibition of biofilm formation and quorum sensing signals (; ).

Pyrogallol (benzene-1,2,3-triol, PG) is a hydroxylated polyphenol compound that contains three hydroxyl groups in the ortho position of a benzene ring. It is also present in various fruits and vegetables. PG is mostly used in pharmaceutical and pesticide manufacturing companies for medicinal purposes as a topical antipsoriatic (). PG exhibits both prooxidant and antioxidant activity. The earlier role of PG involves generating reactive oxygen species and critical for its antimicrobial activity (; ). Besides, PG acts through enzymatic inhibition of oxidized compounds ().

Previously PG showed to inhibit Helicobacter pylori urease () and Vibrio harveyi quorum sensing (). Its acethlycholinesterase inhibitory activity shows its importance in treating Alzheimer’s disease (). Moreover, PG prevents the HeLa cells cytotoxicity induced by V. vulnificus and inhibits bacterial growth (). Furthermore, it showed a synergistic activity when combined with norfloxacin and gentamicin against Staphylococcus aureus ().

However, to our understanding, there are no reports on the effect of PG on bacterial intracellular survival and its antiinvasive mechanism. Hence, in this study, we evaluated the pharmacodynamics of PG and its inhibitory activity against Salmonella Typhimurium invasion and intracellular survival alone and in combination with MAR. Moreover, we have studied the mechanisms of bacterial invasion and intracellular survival inhibition.

Materials and Methods

Bacterial and Cell Culture Conditions

Two field strains of Salmonella enterica serovar Typhimurium, (KU325552 (S-2) and KU325565 (S-15), isolated from swine clinical infections as described earlier (), in which one is susceptible while the other was intermediately resistant to MAR (Fluka, Germany) and ATCC 14028 strain were used. All the bacteria were cultured in Luria-Bertani (LB) broth or agar (Difco, BD, MD, United States) unless otherwise stated, at 37oC for various time lengths according to the purpose of the experiment. Two cell lines, RAW 264.7 and Caco-2 cells were used for the bacterial invasion and intracellular survival assays. RAW 264.7 cells were grown in RPMI 1640 medium (Sigma, United Kingdom) supplemented with 10% fetal bovine serum (FBS, Gibco, United States) and 1% penicillin-streptomycin (P/S) whereas, the Caco-2 cell was grown in minimum essential medium (MEM, Gibco, United States) supplemented with 1% nonessential amino acids (Sigma-Aldrich, MO, United States), 20% FBS, and 1% P/S and both cell lines were incubated at 37°C in a humidified atmosphere with 5% CO2.

Cell Viability Assay

The cell viability assay was performed using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. Confluent cells (105 cells/mL) were cultured onto a 96-well plate and incubated for 24 h at 37oC with 5% CO2. The medium was substituted with a new medium containing twofold dilutions of PG (Sigma, China) before incubated overnight at 37oC with 5% CO2. Finally, 0.45% of MTT reagent in cell culture media was substituted and incubated for 4 h before adding 100 μL of 100× DMSO. The plate was read at 570 nm after 5 min using Versamax (molecular devices, United States). The rate of cell viability was calculated using the following formula:

Minimum Inhibitory Concentration and Minimum Bactericidal Concentration Determination

The minimum inhibitory concentration (MIC) of MAR and PG was done using the micro-broth dilution method as described by the Clinical Laboratory and Standard Institute (CLSI) (). A two-fold dilution of MAR and PG in Muller Hinton broth II (MHBII, Difco, BD, United States) and RPMI medium were added to 105 CFU/mL of the three strains of S. Typhimurium. The bacteria were cultured for 24 h at 37oC aerobically and the results were read using a plate reader at 600 nm. To determine the minimum bactericidal concentration (MBC), 20 μL of the suspension from the microplate starting from the MIC onwards were taken and plated to LB agar. The plates were incubated at 37oC for 48 h to determine the possible slowly growing bacteria. The test was conducted three times in duplicate.

Fractional Inhibitory Concentration Determination

The fractional inhibitory concentration (FIC) of the combination of MAR with PG was conducted using a checkerboard method (). A final concentration of 105 CFU/mL of the bacteria was added to the various fractional concentration of MAR and PG. The dilution was made in a 96-well plate and incubated aerobically overnight at 37oC. Finally, the results were read both visually and on a plate reader at 600 nm.

Time-Kill Assay

A time-kill assay was done as previously described with minor modifications (). An overnight grown Salmonella Typhimurium was inoculated into a 5 mL LB broth and incubated for 4 h at 37oC to obtain the logarithmic growing phase of bacteria. The bacteria were added to MHBII containing various concentrations of MAR and PG to make a final bacterial concentration of 105 CFU/mL. The bacteria were cultured at 37oC and sampled at 0, 0.5, 1, 2, 4, 8, 12, and 24 h and cultured on LB agar plates for 48 h after serially diluted. The results were read and recorded after a bacterial count.

Bacterial Invasion and Intracellular Inhibition Assay

For bacterial invasion inhibition experiments, the gentamicin protection assay was performed as previously described with minor modifications (). Briefly, PG (30 μg/mL) alone or with sub-MIC of MAR (0.015 μg/mL for susceptible and 0.25 μg/mL for MAR resistant bacteria) was added to the fully confluent Caco-2 cells and RAW 264.7 cells (105 cells/mL) before incubating for 30 min. Salmonella Typhimurium (107 CFU/mL) was added and incubated for another 45 min after centrifuged at 500 g for 5 min. Gentamicin (100 μg/mL) was added and incubated for 30 min before cells were lysed by 0.1% Triton® x-100 (Sigma, United States) for 10 min. Cells were washed with PBS at least three-times in each step. The solution was serially diluted and cultured on a LB agar plate for a bacterial count after overnight incubation.

For intracellular killing experiments, RAW 264.7 cells (105 cells/mL) were grown on 24 well plates. The cells were infected with Salmonella Typhimurium (107 CFU/mL) and incubated for 1 h after centrifugation at 500 g for 5 min. Then the cells were washed, and PG (30 μg/mL) alone or combined with the sub-MIC of MAR were added and incubated for 1 h at 37°C and 5% CO2. Finally, the cells were treated with gentamicin (100 μg/mL) for 1 h and lysed in 0.1% Triton® x-100 before serially diluted and incubated on an agar plate overnight at 37oC for a bacterial count.

Confocal Microscopy

Caco-2 cells (105 cells/mL) were cultured on 12 mm glass coverslips in 24-well plates as described . The cells were prepared and treated as mentioned above for the bacterial intracellular inhibition assay. The cells were rinsed gently in 0.1 M 3-(N-morpholino) propanesulfonic acid (MOPS), pH 7.2, containing 1 mM MgCl2 (MOPS/MgCl2). The rinsing solution from the cells were aspirated, and 0.5 mL Live/Dead Staining Solution containing 5 μM SYTO9, 30 μM propidium iodide (IP) (Invitrogen, United States), and 0.1% saponin in MOPS/MgCl2 were added. The cells incubated for 15 min at room temperature in the dark and rinsed with MOPS/MgCl2. The coverslips were inverted face down onto glass slides, and images were acquired using a fluorescence microscope (Carl Zeiss, LSM700, IL, United States) with excitation of 488 and 555 nm and emission range of 515–555 nm and 560–600 nm for SYTO9 and propidium iodide, respectively. The thicknesses of the optical sections of the confocal microscopy were 12.2 and 13.2 μm for PI and SYTO-9 fluorescence, respectively. Non-treated cells were used as a negative control. Comparison was made upon counting of green fluorescence.

Fluoroquinolone Accumulation in Intact Bacteria

The accumulation of fluoroquinolone in intact bacteria was determined as previously described () using ciprofloxacin due to its increased yield of fluorescent signal intensity. Salmonella Typhimurium was grown at 37°C in LB to mid-exponential phase. The bacterial suspension was centrifuged at 6,000 × g for 15 min and concentrated tenfold in 50 mM sodium phosphate buffer at pH 7 supplemented with 5 mM MgCl2 (NaPi–MgCl2 buffer) to obtain a density of 6 × 109 CFU/mL. In glass culture tubes, 2.4 ml of the bacterial suspension was incubated for 5 min at 37°C with ciprofloxacin at 10 μg/mL, or 100 μg/mL (final volume 3 ml), in the absence or in the presence of PG and a positive control, the efflux inhibitor PAβN (Phenylalanine-arginine β-naphthylamide) used at 40 μg/mL. Bacterial suspensions incubated without antibiotics was used as negative controls. Suspensions (800 μl) were then transferred to 1,100 μL of NaPi–MgCl2 buffer and centrifuged at 9,000 × g for 5 min at 4°C and the pelleted bacteria was collected. After centrifugation, pellets corresponding to 800 μl of bacterial suspensions were lysed with 500 μl of 0.1M Glycin-HCl pH 3 overnight at room temperature. After a centrifugation for 15 min at 9,000 × g at 4°C, 400 μl of lysates were mixed with 600 μl of Glycin-HCl buffer, and emission spectra were measured with a spectrofluorimeter (F-2500 Fluorescence Spectrophotometer, Hitachi, Japan). Excitation/emission range wavelengths (nm) used for detection of ciprofloxacin fluorescence signal with spectrofluorimetry was 275/435–450.

Total RNA Extraction and Virulence Gene Expression

For virulence gene expression, Salmonella Typhimurium was cultured in LB broth containing 3M of NaCl and incubated with different concentrations of PG and sub-MIC of MAR at 37oC for 13 h. The total RNA was extracted using Trizol® (Ambion®, life technologies, United States) reagent. The RNA purity and concentration were determined using Nanodrop measurement. RT-PCR premix (pioneer, Korea) was used to synthesize bacterial cDNA by adding random hexamers. Quantification of RNA was performed on CFX96 TouchTM real-time PCR detection systems (Biorad, United States) using IQTM SYBR® Green supermix for real-time PCR (Biorad, Singapore). The qRT-PCR condition was set for 95oC for 3 min and 40 cycles of 95oC for 10 s, 58oC for 15 s, and 72oC for 30 s for hilA, invF, sipB, and acrA genes. The primers used in the study are listed in Table 1.

TABLE 1

Target genePrimers
hilA5′-CGGAAGCTTATTTGCGCCATGCTGAGGTAG-3′ 5′-GCATGGATCCCCGCCGGCGAGATTGTG-3′
invF5′-ACAGTGCTCGTTTACGACCTGAAT-3′ 5′-AGACGACTGGTACTGATCGATAAT-3′
sipB5′-ACGCGCAAAGCCGAGGAAAC-3′ 5′-CCCGTCGCCGCCTTCAC-3′
sdiA5′- TTACATTGGGATGACGTGCT-3′ 5′- AACTGCTACGGGAGAACGAT-3′
acrA5′-CGCAGTACTATGTCGGTGAATTTACAGGCG-3′
5′-CGCGGATCCGTCTTAACGGCTCCTGTTTAA-3′,
rck5′-GTTGTATCCCGGCATGCTGAT-3′
5′-ATATGCCCAGAGCCGGATAGAG-3′
rrsG5′-GTTACCCGCAGAAGAAGCAC-3′
5′- CACATCCGACTTGACAGACC 3′

Primers used to detect invasion virulence genes of Salmonella Typhimurium.

Quorum Sensing Gene Inhibition

To determine the effect of PG on the genetic expression of quorum sensing genes of Salmonella Typhimurium (), N-Acyl homoserine lactone (AHL, 1 μmol/mL) was added to the LB broth containing bacteria and incubated with 30, 100 μg/mL of PG and in combination with sub-MIC of MAR for 8 h. Furanone at 10 μg/mL (Sigma, St. Louis, MO, United States) was used as a positive control for quorum sensing inhibition. Whereas bacteria exposed to AHL without treatment with PG and MAR was used as a negative control. The suspension was centrifuged, and the pellet was processed for RNA extraction using Trizol reagent as described above. The qRT-PCR was set at a denaturation temperature of 95oC for 30 s, followed by 40 cycles of 95oC for 5 s, 60oC for 30 s, and dissociation of 95oC for 15 s and 60oC for 30 s.

Prediction of Ligand-Protein Docking

The prediction of the binding and affinity of PG to the virulence and quorum sensing proteins of Salmonella Typhimurium was performed using iGEMDOCK (Version 2.1; NCTU, Hsinchu City, Taiwan) a graphical environment for recognizing pharmacological interactions and virtual screening (). The chemical structure depiction for PG was retrieved from the PubChem database (). Whereas the sequences of the bacterial virulence proteins were retrieved from the NCBI database. The protein structure was retrieved from PDB database (; ) and predicted by RaptorX (,, ; ; ). In addition, for the interactive visualization and analysis of molecular structures UCSF Chimera (Chimera, version 1.15, RBVI, San Francisco, CA, United States) was used ().

Statistical Analysis

Graphpad prism 7 (GraphPad Software, La Jolla, CA, United States) was used to analyze the data and one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test was used to compare between treatment groups and compute the p-value. P-value was considered significant if P < 0.05.

Results

To determine the effect of PG on mammalian cell growth, cell viability was investigated using the MTT reagent. PG at a concentration of 2,048 μg/mL did not show any significant cytotoxic activity on the viability of both Caco-2 and RAW 264.7 cells. The cell viability was more than 100% for concentrations less than 256 μg/mL (Figure 1).

FIGURE 1

The MIC and MBC of PG for all three strains were 128 and 256 μg/mL, respectively. The MIC of MAR against Salmonella Typhimurium ATTC 14028 and field isolate strain 2 (S-2) was 0.031 μg/mL, whereas it was 0.5 μg/mL for field isolate strain 15 (S-15). The MBC of MAR against ATTC 14028 and S-2 was 0.125 but 2 μg/mL for S-15. The log IC50 for MAR was −1.793, −0.5955, and −1.478, whereas it was 1.82, 1.459, and 1.511 for PG against ATCC 14028, S-15, and S-2 strains, respectively. The lowest FIC index results obtained for MAR in combination with PG in all the three strains were 0.5 (Table 2). Thus, for the consecutive experiments, we selected a concentration of 30 μg/mL of PG, which showed no antibacterial activity.

TABLE 2

StrainPG_MIC (μg/mL)MAR_MIC (μg/mL)PG_MBC (μg/mL)MAR_MBC (μg/mL)FICindex
S-2*1280.0312560.1250.5
ATTC 140281280.0312560.1250.52
S-15**1280.525620.75

MIC, MBC, and FICindex of pyrogallol and marbofloxacin.

*S-2 field strain of Salmonella Typhimurium susceptible to marbofloxacin. **S-15 field strain of Salmonella Typhimurium resistant to marbofloxacin. PG, pyrogallol; MAR, marbofloxacin; MIC, minimum inhibitory concentration; MBC, minimum bactericidal concentration; FIC, fractional inhibitory concentration.

The time-kill assay was performed to detect the combined effect of sub_MIC of MAR with different concentrations of PG in a dynamic model. The test was conducted for 24 h. The sub-MIC of MAR in combination with 128 μg/mL of PG reduce Salmonella Typhimurium (ATCC 14028) CFU/mL by 2-log within 8 h. Whereas, the 2-log reduction for the S-2 strain was achieved after 4 h of incubation at all tested concentrations of PG except the 64 μg/mL. The 2-log reduction for the S-15 strain was observed after 12 h of incubation by the same concentration of PG and MAR (Figure 2). In strain ATCC 14028 and S-15, the combination of PG (256 μg/mL) and sub-MIC of MAR showed early killing of the bacteria in comparison with PG (256 μg/mL) used alone. However, PG (64 and 128 μg/mL) alone did not show to inhibit the growth of Salmonella Typhimurium strains tested.

FIGURE 2

For the bacterial invasion inhibition assay, PG at a concentration of 30 μg/mL alone and in combination with sub-MIC of MAR was used. PG (30 μg/mL) inhibited 72.75 and 44.8% of Salmonella Typhimurium invasion in Caco-2 and Raw 264.7 cells, respectively. Whereas, for the combination of PG with sub-MIC of MAR, the inhibition percentage was increased to 76.19 and 59.3% in Caco-2 and Raw 264.7 cells, respectively. A significant difference (P < 0.05) was observed in the inhibition of Salmonella Typhimurium invasion in both cell lines by PG alone and combination with MAR. However, no significant difference was observed between Caco-2 and Raw 264.7 cells (Figures 3A,B).

FIGURE 3

Likewise, PG (30 μg/mL) inhibited 7.69% of intracellular Salmonella Typhimurium in RAW264.7 cells. Whereas in combination with sub-MIC of MAR, the suppression of the intracellular survival of Salmonella Typhimurium increased to 74.36%. A significant difference (P < 0.05) was indicated in cells treated with the combination of PG with sub-MIC of MAR (Figure 3C).

In compliance with the above findings, the confocal microscopy had also revealed the percentage of intracellular bacteria was significantly suppressed by the activity of PG alone and its combination with sub-MIC of MAR (Figure 4).

FIGURE 4

The fluoroquinolone accumulation assay indicated that PG (30 μg/mL) increased the accumulation of ciprofloxacin by 15.2%. The accumulation was increased to 34.9% upon increasing the concentration of PG to 100 μg/mL which showed a significant difference in comparison with the negative control (Figure 5).

FIGURE 5

The genetic expression level of different virulent invasion genes of Salmonella Typhimurium was evaluated using qRT-PCR. The result indicated that bacteria treated with PG (30 μg/mL) have a reduction of gene expression of hilA, invF, sipB, and acrA genes by 14.6, 15.4, 13.6, and 36%, respectively. The suppression of the gene expression level was dose dependent. At a higher concentration of PG (100 μg/mL), the inhibition was increased significantly to 59.3, 78.1, 46.7, and 63.8% for hilA, invF, sipB, and acrA genes, respectively. Whereas the combination of PG with sub-MIC of MAR showed a significant difference in suppressing the expression of hilA, invF, sipB, and acrA genes by 80, 74.6, 78, and 70.1%, respectively (Figures 6A–D).

FIGURE 6

The effect of PG on the quorum sensing genes of Salmonella Typhimurium was evaluated using AHL as an inducer of quorum sensing signaling. The genetic expression levels of sdiA, srgE, and rck genes were reduced by 14.9, 31.6, and 41.2% upon treatment with PG (30 μg/mL), respectively. However, the inhibition was increased to 78.6, 62.8, and 61.8% for a higher concentration of PG (100 μg/mL), respectively. Whereas the combination of PG (30 μg/mL) with the sub-MIC of MAR inhibited the expression level of sdiA, srgE, and rck genes by 55.5, 48.1, and 46.7%, respectively (Figures 6E–G).

The binding energy affinity of PG to the suppressed proteins of acrA, hilA, invF, sdiA, sipB, and rck, proteins of Salmonella Typhimurium is presented in Table 3. The binding of PG with the amino acid residues showed a hydrogen bond linkage for of acrA, hilA, invF, sdiA, and rck, proteins (Figure 7).

TABLE 3

ProteinsBinding energy (Kcal)Van der waalsHydrogen bond
acrA−67.2353−41.2766−25.9587
hilA−72.176−62.6−9.57602
invF−70.1798−56.8533−13.3265
sdiA−71.2049−66.4945−4.7104
rck−73.9291−47.754−26.1751
sipB−49.8305−43.3426−6.48786

Binding affinity of pyrogallol to Salmonella Typhimurium virulence proteins.

FIGURE 7

Discussion

Treatment of intracellular bacteria is a major health challenge globally. Besides, these bacteria developed strategies to evade the host defense mechanism, invade the cells and reside intracellularly. Moreover, regardless of the possibility of developing new antimicrobials, microbial agents acquire resistance to various drugs (). Even though quinolones are referred to as the therapeutic options against intracellular pathogens, multiple bacteria are developing resistance against these conserved groups of antimicrobial agents (). Similarly, Salmonella Typhimurium developed resistance against fluoroquinolones (). Hence, searching for an active compound that targets bacterial invasion and intracellular survival has paramount significance. In consequence, combination therapies are emerging as an alternative for the treatment of intracellular residing and multidrug-resistant microbes ().

Polyphenols are characterized by the presence of multiple hydroxyl groups in their benzene ring and are known for their antioxidant properties and modulation of enzymatic and cell receptors (). PG, a polyphenol, possesses antioxidant, antimicrobial activity, quorum sensing inhibition, and suppression of cytotoxicity properties (; ; ). Therefore, in this study, we discovered the effect of PG alone or in combination with MAR in the invasion and intracellular survival of Salmonella Typhimurium isolated from pigs.

The determination of cytotoxicity is critical in detecting the potential toxic effect of a given compound in mammalian cells. In our findings, PG did not show any cytotoxic activity against both Caco-2 and Raw 264.7 cells even at a more significant concentration. In agreement with this, PG also did not show any cytotoxicity on the growth of HeLa cells ().

The anti-infective activity of polyphenols has been described in various bacterial and fungal agents (; ). They have indicated strong inhibitory activity against both Gram-negative and positive bacteria. In this study, we have indicated the antibacterial activity of PG against two field strains of Salmonella Typhimurium isolated from a clinical infection of pigs and ATCC control strains. In all the cases, PG exhibited similar antibacterial activity against Salmonella Typhimurium isolates at the same concentration. In the same way, PG has shown antibacterial activity against Pseudomonas putida, P. pyocyanea, Corynebacterium xerosis, Vibrio parahaemolyticus, V. vulnificus, and Staphylococcus aureus (; ; ; ). This indicated the likelihood of PG in the making of a novel antibacterial agent against infectious agents ().

Moreover, in combination with the sub-MIC of MAR, which remains a widely used drug in veterinary medicine, PG resulted in the most substantial effect and presented self-induced synergism. Our findings agree with previous reports that PG has shown a synergistic effect with norfloxacin and gentamicin against S. aureus (). Currently, there is a shortage of newly discovered antibiotics against multidrug-resistant bacteria and to worsen the situation, bacteria, particularly Gram-negative bacteria, develop resistance to most of the currently available antimicrobials (; ). Thus, to alleviate this challenge, a combination of antimicrobial agents with other antimicrobials or other compounds is critical (). The potentiation effect of PG delivers a significant contribution to overcoming antimicrobial resistance. Hence, the antimicrobial activity observed by PG could have a significant contribution to reducing drug resistance and become an alternative to the currently available drugs ().

For successful treatment of intracellular bacteria, once the antimicrobial agents traverse the host cell membrane, they must be maintained and amass at adequate concentrations for a specified time (). The accumulation of a drug is dependent on the suppression or expression of acrAB (). PG increased the accumulation of fluoroquinolone in intact Salmonella Typhimurium cells. The presence of a higher concentration of fluoroquinolone suggests the inhibition of an active efflux pump (). This could be due to the downregulation of an efflux inhibitor acrA genes by PG. This indeed will increase the effectiveness of the drug in killing intracellular bacteria.

In addition to its antibacterial activity, the in vitro cell culture experiments demonstrated the potential of PG to inhibit Salmonella invasion and its intracellular survival. At the lowest concentration (30 μg/mL), four times less than its MIC, specifically in combination with sub-MIC of MAR, PG inhibited about 70% of Salmonella Typhimurium invasion in epithelial cells and intracellular survival in the macrophages. Methyl gallate, which is a polyphenol also inhibited bacterial adhesion, invasion and intracellular survival (). This also agrees with the works of who described the inhibition of Salmonella Typhimurium invasion by flavonoids like baicalein and quercetin. This inhibition targeted the SPI-1 T3SS substrates of the bacteria. This more considerably extends the role of PG in the production of a potent antimicrobial agent.

It is indicated that PG has downregulated the genetic expression of hilA and invF genes, critical for invading host cells and entering their cytoplasm. Salmonella Typhimurium activates the SPI-1 T3SS for entering the intestinal epithelium cells. HilA is the central regulator of invasion of epithelial cells and a transcriptional activator of SPI-1 genes including invF (; ). The most common mechanisms of inhibition by polyphenols are downregulating the genetic expression of virulence factors, quorum sensing signal inhibition, biofilm formation, and decreasing bacterial swarm motility (; ; ; ). InvF is essential for the expression of the SPI-1 gene, which encodes effector proteins and their translocation into the cytosol (). Hence, the downregulation of these genes by PG could suppress the activity of other SPI-1 genes of Salmonella Typhimurium involved in cell invasion and intracellular survival and leads to the killing of the bacteria.

Furthermore, PG suppressed the expression of the sipB gene, which is critical for encoding and translocating other SPI-1 T3SS Salmonella Typhimurium secreted effector proteins and is essential for mammalian cell invasion (). Furthermore, sipB expedite adherance of Salmonella Typhimurium to target host cells (). Hence, the downregulation of sipB by PG might play a significant role in decreasing the invasion and intracellular bacteria.

PG also suppressed the level of expression of Salmonella Typhimurium acrA gene which is a resistance nodulation cell division gene (). It encodes for a membrane fusion protein, which is an efflux pump responsible for decreasing intracellular accumulation of drugs and results in antimicrobial resistance (; ). The downregulation of acrA by PG will further confirm its paramount importance in preventing antimicrobial resistance and could be considered as an efflux pump inhibitor.

Furthermore, PG suppressed the quorum sensing related genes of Salmonella. SdiA, a LuxR homolog, is a quorum-sensing signal detector and regulator in Salmonella Typhimurium and activates srgE and rck genes (; ). Rck confers adhesiveness and invasiveness to intestinal epithelial cells (; ). In addition, rck mediates the zipper-like internalization of Salmonella into the host cells (). This further signifies the potential of PG in inhibiting bacterial invasion and combat clinical infections.

The decreased energy value of the protein-ligand interaction showed the high binding affinity of PG to the virulence and quorum sensing proteins of Salmonella Typhimurium. Although PG did not show to totally block the expression of virulence genes, it could have the potential to bind the remaining translated Salmonella effector proteins. This also indicates the likely chance of interfering with their activity and limiting the pathogenicity of the bacteria. Which further inhibits its invasion and intracellular survival.

Conclusion

In conclusion, in this study, we have indicated the antimicrobial and anti-invasive activity of PG against Salmonella Typhimurium in vitro study. PG is effective in killing intracellular bacteria alone and in combination with MAR. Furthermore, it increased the accumulation of fluoroquinolones. PG suppresses the virulence and quorum sensing genes of Salmonella Typhimurium, which are critical for invasion and intracellular survival of the bacteria and subsequently establish infection in the host cells. PG showed a self-induced potentiation effect to the most conserved drug of veterinary importance, MAR, in which certain bacterial agents are currently developing resistance against it. This suggests PG could be a potential efflux pump inhibitor and a candidate as an antimicrobial agent to prevent bacterial invasion, its intracellular survival, and antimicrobial resistance. However, further in vivo pharmacokinetic and pharmacodynamic studies should be conducted for comprehensive understanding before its preclinical trial.

Statements

Data availability statement

The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.

Author contributions

BB designed and carried out the experiment, analyzed the results, and wrote the manuscript. E-BL analyzed the results and reviewed the manuscript. S-JL and S-CP designed the study and revised the manuscript. All authors read and approved the final draft.

Funding

This research is funded in part by the National Research Foundation of Korea (NRF) through the Ministry of Education (2019R1A2C2006277) and in part by a grant (Z-1543081-2020-22-02) from the Animal and Plant Quarantine Agency, Ministry of Agriculture, Food and Rural Affairs, Republic of Korea. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1

    AgborT. A.MccormickB. A. (2011). Salmonella effectors: Important players modulating host cell function during infection.Cell. Microbiol.1318581869. 10.1111/j.1462-5822.2011.01701.x

  • 2

    BaruahK.Duy PhongH. P. P.NorouzitallabP.DefoirdtT.BossierP. (2015). The gnotobiotic brine shrimp (Artemia franciscana) model system reveals that the phenolic compound pyrogallol protects against infection through its prooxidant activity.Free Radic. Biol. Med.89593601. 10.1016/j.freeradbiomed.2015.10.397

  • 3

    BermanH. M.WestbrookJ.FengZ.GillilandG.BhatT. N.WeissigH.et al (2000). The protein data bank.Nucleic Acids Res.28235242.

  • 4

    BirhanuB. T.ParkN. H.LeeS. J.HossainM. A.ParkS. C. (2018). Inhibition of Salmonella Typhimurium adhesion, invasion, and intracellular survival via treatment with methyl gallate alone and in combination with marbofloxacin.Vet Res.49:101.

  • 5

    BurleyS. K.BermanH. M.BhikadiyaC.BiC.ChenL.Di CostanzoL.et al (2019). RCSB Protein Data Bank: Biological macromolecular structures enabling research and education in fundamental biology, biomedicine, biotechnology and energy.Nucleic Acids Res.47D464D474.

  • 6

    CirilloD. M.HeffernanE. J.WuL.HarwoodJ.FiererJ.GuineyD. G. (1996). Identification of a domain in Rck, a product of the Salmonella typhimurium virulence plasmid, required for both serum resistance and cell invasion.Infect. Immun.6420192023. 10.1128/iai.64.6.2019-2023.1996

  • 7

    CLSI (2017). M100-S23 Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement An informational supplement for global application developed through the Clinical and Laboratory Standards Institute consensus process, 27 Edn, edsPatelJ.WeinsteinM.GeorgeE.JenkinsS.LewisJ.LimbagoB. (Wayne, PA: Clinical and Laboratory Standards Institute).

  • 8

    DagliaM. (2012). Polyphenols as antimicrobial agents.Curr. Opin. Biotechnol.23174181. 10.1016/j.copbio.2011.08.007

  • 9

    DarwinK. H.MillerV. L. (2000). The putative invasion protein chaperone SicA acts together with InvF to activate the expression of Salmonella typhimurium virulence genes.Mol. Microbiol.35949960. 10.1046/j.1365-2958.2000.01772.x

  • 10

    de JongA.StephanB.SilleyP. (2012). Fluoroquinolone resistance of Escherichia coli and Salmonella from healthy livestock and poultry in the EU.J. Appl. Microbiol.112239245. 10.1111/j.1365-2672.2011.05193.x

  • 11

    DyszelJ. L.SmithJ. N.LucasD. E.SoaresJ. A.SwearingenM. C.VrossM. A.et al (2010). Salmonella enterica serovar typhimurium can detect acyl homoserine lactone production by Yersinia enterocolitica in mice.J. Bacteriol.1922937. 10.1128/jb.01139-09

  • 12

    EllisM. J.TrusslerR. S.CharlesO.HanifordD. B. (2017). A transposon-derived small RNA regulates gene expression in Salmonella Typhimurium.Nucleic Acids Res.4554705486. 10.1093/nar/gkx094

  • 13

    FischbachM. A. (2011). Combination therapies for combating antimicrobial resistance.Curr. Opin. Microbiol.14519523. 10.1016/j.mib.2011.08.003

  • 14

    Freire-MoranL.AronssonB.ManzC.GyssensI. C.SoA. D.MonnetD. L.et al (2011). Critical shortage of new antibiotics in development against multidrug-resistant bacteria – Time to react is now.Drug Resist Updat.2011118124. 10.1016/j.drup.2011.02.003

  • 15

    FriedmanM.HenikaP. R.LevinC. E.MandrellR. E.KozukueN. (2006). Antimicrobial activities of tea catechins and theaflavins and tea extracts against Bacillus cereus.J. Food Protect.2006354361. 10.4315/0362-028x-69.2.354

  • 16

    GuérinF.LallementC.IsnardC.DhalluinA.CattoirV.GiardJ. C. (2016). Landscape of resistance-nodulation-cell division (RND)-type efflux pumps in Enterobacter cloacae complex.Antimicrob Agents Chemother.6023732382. 10.1128/aac.02840-15

  • 17

    HaragaA.OhlsonM. B.MillerS. I. (2008). Salmonellae interplay with host cells.Nat. Rev. Microbiol.65366.

  • 18

    HaywardR. D.McGhieE. J.KoronakisV. (2000). Membrane fusion activity of purified SipB, a Salmonella surface protein essential for mammalian cell invasion.Mol. Microbiol.37727739. 10.1046/j.1365-2958.2000.02027.x

  • 19

    HossainM. A.LeeS. J.ParkN. H.MechessoA. F.BirhanuB. T.KangJ.et al (2017). Impact of phenolic compounds in the acyl homoserine lactone-mediated quorum sensing regulatory pathways.Sci. Rep.7116.

  • 20

    HrvatinV. (2017). Combating antibiotic resistance: New drugs or alternative therapies?CMAJ? 189:E1199. 10.1002/9783527622931.ch1

  • 21

    JohnsonM. B.CrissA. K. (2013). Fluorescence microscopy methods for determining the viability of bacteria in association with mammalian cells.J. Vis. Exp.50729. 10.3791/50729

  • 22

    KamaruzzamanN. F.KendallS.GoodL. (2017). Targeting the hard to reach: challenges and novel strategies in the treatment of intracellular bacterial infections.Br. J. Pharmacol.17422252236. 10.1111/bph.13664

  • 23

    Kang-MuL. E. E.Wan-SeokK. I. M.JeesunL. I. M.SunyoungN. A. M.YounM. I. N.Seong-WonN. A. M.et al (2009). Antipathogenic properties of green tea polyphenol epigallocatechin gallate at concentrations below the MIC against enterohemorrhagic escherichia coli O157:H7.J. Food Prot.72325331. 10.4315/0362-028x-72.2.325

  • 24

    KimS.ChenJ.ChengT.GindulyteA.HeJ.HeS.et al (2019). PubChem 2019 update: Improved access to chemical data.Nucleic Acids Res.47D1102D1109.

  • 25

    KocaçalişkanI.TalanI.TerziI. (2006). Antimicrobial activity of catechol and pyrogallol as allelochemicals.Zeitschr. Naturf. Sect. C J. Biosci.61639642. 10.1515/znc-2006-9-1004

  • 26

    Lara-TejeroM.GalánJ. E. (2009). Salmonella enterica serovar typhimurium pathogenicity island 1-encoded type III secretion system translocases mediate intimate attachment to nonphagocytic cells.Infect Immun.7726352642. 10.1128/iai.00077-09

  • 27

    LauplandK. B.SchønheyderH. C.KennedyK. J.LyytikäinenO.ValiquetteL.GalbraithJ.et al (2010). Salmonella enterica bacteraemia: a multi-national population-based cohort study.BMC Infect Dis.10:95.

  • 28

    LeberA. L. (2016). Clinical Microbiology Procedures Handbook, 4 Edn, ed.LeberA. L. (Columbus, OH: ASM Press).

  • 29

    LeeJ. H.JeongS. H.ChaS.-S.LeeS. H. (2009). New Disturbing trend in antimicrobial resistance of gram-negative pathogens.PLoS Pathog.5:e1000221. 10.1371/journal.ppat.1000221

  • 30

    LeeS. J.ParkN. H.MechessoA. F.LeeK. J.ParkS. C. (2017). The phenotypic and molecular resistance induced by a single-exposure to sub-mutant prevention concentration of marbofloxacin in Salmonella typhimurium isolates from swine.Vet. Microbiol.2072935. 10.1016/j.vetmic.2017.05.026

  • 31

    LiG.YanC.XuY.FengY.WuQ.LvX.et al (2014). Punicalagin inhibits Salmonella virulence factors and has anti-quorum-sensing potential.Appl. Environ. Microbiol.8062046211. 10.1128/aem.01458-14

  • 32

    LimJ. Y.KimC.-M.RheeJ. H.KimY. R. (2016). Effects of pyrogallol on growth and cytotoxicity of wild-type and katg mutant strains of vibrio vulnificus.PLoS One11:e0167699. 10.1371/journal.pone.0167699

  • 33

    LimaV. N.Oliveira-TintinoC. D. M.SantosE. S.MoraisL. P.TintinoS. R.FreitasT. S.et al (2016). Antimicrobial and enhancement of the antibiotic activity by phenolic compounds: Gallic acid, caffeic acid and pyrogallol.Microb. Pathog.995661. 10.1016/j.micpath.2016.08.004

  • 34

    LiuY.JiaY.YangK.WangZ. (2020). Heterogeneous strategies to eliminate intracellular bacterial pathogens.Front. Microbiol.11:563.

  • 35

    ManachC.ScalbertA.MorandC.RémésyC.JiménezL. (2004). Polyphenols: food sources and bioavailability.Am. J. Clin. Nutr.79727747. 10.1093/ajcn/79.5.727

  • 36

    MasonT. L.BruceP. W. (1987). Inactivation of red beet β-glucan synthase by native and oxidized phenolic compounds.Phytochemistry2621972202. 10.1016/s0031-9422(00)84683-x

  • 37

    MendesV.VilaçaR.De FreitasV.FerreiraP. M.MateusN.CostaV. (2015). Effect of myricetin, pyrogallol, and phloroglucinol on yeast resistance to oxidative stress.Oxid Med. Cell Longev.2015:782504.

  • 38

    MichaelB.SmithJ. N.SwiftS.HeffronF.AhmerB. M. M. (2001). SdiA of Salmonella enterica is a LuxR homolog that detects mixed microbial communities.J. Bacteriol.18357335742. 10.1128/jb.183.19.5733-5742.2001

  • 39

    MiddletonE.KandaswamiC.TheoharidesT. (2000). The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease, and cancer.Pharmacol. Rev.52673751.

  • 40

    MoyleC. W. A.CerezoA. B.WinterboneM. S.HollandsW. J.AlexeevY.NeedsP. W.et al (2015). Potent inhibition of VEGFR-2 activation by tight binding of green tea epigallocatechin gallate and apple procyanidins to VEGF: Relevance to angiogenesis.Mol. Nutr. Food Res.59401412. 10.1002/mnfr.201400478

  • 41

    NiN.ChoudharyG.LiM.WangB. (2008). Pyrogallol and its analogs can antagonize bacterial quorum sensing in Vibrio harveyi.Bioorganic. Med. Chem. Lett.1815671572. 10.1016/j.bmcl.2008.01.081

  • 42

    NishinoK.LatifiT.GroismanE. A. (2006). Virulence and drug resistance roles of multidrug efflux systems of Salmonella enterica serovar typhimurium.Mol. Microbiol.59126141. 10.1111/j.1365-2958.2005.04940.x

  • 43

    OkusuH.MaD.NikaidoH. (1996). AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants.J. Bacteriol.178306308. 10.1128/jb.178.1.306-308.1996

  • 44

    Ozturk SarikayaS. B. (2015). Acethylcholinesterase inhibitory potential and antioxidant properties of pyrogallol.J. Enzyme Inhib. Med. Chem.30761766. 10.3109/14756366.2014.965700

  • 45

    PandeyK. B.RizviS. I. (2009). Plant polyphenols as dietary antioxidants in human health and disease.Oxidat. Med. Cell. Long.2270278. 10.4161/oxim.2.5.9498

  • 46

    PatelJ. C.GalánJ. E. (2005). Manipulation of the host actin cytoskeleton by Salmonella – All in the name of entry.Curr. Opin. Microbiol.81015. 10.1016/j.mib.2004.09.001

  • 47

    PenheiterK. L.MathurN.GilesD.FahlenT.JonesB. D. (1997). Non-invasive Salmonella typhimurium mutants are avirulent because of an inability to enter and destroy M cells of ileal Peyer’s patches.Mol. Microbiol.24697709. 10.1046/j.1365-2958.1997.3741745.x

  • 48

    PettersenE. F.GoddardT. D.HuangC. C.CouchG. S.GreenblattD. M.MengE. C.et al (2004). UCSF Chimera – A visualization system for exploratory research and analysis.J. Comput. Chem.2516051612. 10.1002/jcc.20084

  • 49

    RibetD.CossartP. (2015). How bacterial pathogens colonize their hosts and invade deeper tissues.Microbes Infect.17173183. 10.1016/j.micinf.2015.01.004

  • 50

    RosselinM.Virlogeux-PayantI.RoyC.BottreauE.SizaretP. Y.MijouinL.et al (2010). Rck of Salmonella enterica, subspecies enterica serovar Enteritidis, mediates Zipper-like internalization.Cell Res.20647664. 10.1038/cr.2010.45

  • 51

    SendiP.RuppenC.SendiP. (2015). Time kill assays for Streptococcus agalactiae and synergy testing.Protoc. Exch.28126.

  • 52

    TaguriT.TanakaT.KounoI. (2006). Antibacterial spectrum of plant polyphenols and extracts depending upon hydroxyphenyl structure.Biol. Pharm. Bull.2922262235. 10.1248/bpb.29.2226

  • 53

    ThiennimitrP.WinterS. E.BäumlerA. J. (2012). Salmonella, the host and its microbiota.Curr. Opin. Microbiol.12108114. 10.1016/j.mib.2011.10.002

  • 54

    TinhT. H.NuidateT.VuddhakulV.RodkhumC. (2016). Antibacterial activity of pyrogallol, a polyphenol compound against vibrio parahaemolyticus isolated from the central region of thailand.Proc. Chem.18162168. 10.1016/j.proche.2016.01.025

  • 55

    TsouL. K.Lara-TejeroM.RosefiguraJ.ZhangZ. J.WangY. C.YountJ. S.et al (2016). Antibacterial flavonoids from medicinal plants covalently inactivate type iii protein secretion substrates.J. Am. Chem. Soc.13822092218. 10.1021/jacs.5b11575

  • 56

    Van BambekeF.MichotJ. M.Van EldereJ.TulkensP. M. (2005). Quinolones in 2005: An update.Clin. Microbiol. Infect.11256280. 10.1111/j.1469-0691.2005.01131.x

  • 57

    VarmaJ. K.GreeneK. D.OvittJ.BarrettT. J.MedallaF.AnguloF. J. (2005). Hospitalization and antimicrobial resistance in Salmonella outbreaks, 1984-2002.Emerg. Infect. Dis.11943946. 10.3201/eid1106.041231

  • 58

    VelgeP.WiedemannA.RosselinM.AbedN.BoumartZ.ChausséA. M.et al (2012). Multiplicity of Salmonella entry mechanisms, a new paradigm for Salmonella pathogenesis.Microbiologyopen1243258.

  • 59

    VergalliJ.AtzoriA.PajovicJ.DumontE.MallociG.MasiM.et al (2020). The challenge of intracellular antibiotic accumulation, a function of fluoroquinolone influx versus bacterial efflux.Commun. Biol.3:198.

  • 60

    VergalliJ.DumontE.CinquinB.MaigreL.PajovicJ.BacquéE.et al (2017). Fluoroquinolone structure and translocation flux across bacterial membrane.Sci. Rep.7:9821.

  • 61

    WangS.LiZ.YuY.XuJ. (2017a). Folding membrane proteins by deep transfer learning.Cell Syst.5202211.e3.

  • 62

    WangS.SunS.LiZ.ZhangR.XuJ. (2017b). Accurate de novo prediction of protein contact map by ultra-deep learning model.PLoS Comput. Biol.13:e1005324. 10.1371/journal.pcbi.1005324

  • 63

    WangS.SunS.XuJ. (2018). Analysis of deep learning methods for blind protein contact prediction in CASP12.Prot. Struct. Funct. Bioinforma.86(Suppl. 1) 6777. 10.1002/prot.25377

  • 64

    WorthingtonR. J.MelanderC. (2013). Combination approaches to combat multidrug-resistant bacteria.Trends Biotechnol.31177184. 10.1016/j.tibtech.2012.12.006

  • 65

    WuJ.PughR.LaughlinR. C.Andrews-PolymenisH.McClellandM.BäumlerA. J.et al (2014). High-throughput assay to phenotype salmonella enterica typhimurium association, invasion, and replication in macrophages.J. Vis. Exp.14:51759.

  • 66

    XiaoZ. P.MaT. W.FuW. C.PengX. C.ZhangA. H.ZhuH. L. (2010). The synthesis, structure and activity evaluation of pyrogallol and catechol derivatives as Helicobacter pylori urease inhibitors.Eur. J. Med. Chem.4550645070. 10.1016/j.ejmech.2010.08.015

  • 67

    XuJ. (2019). Distance-based protein folding powered by deep learning.Proc. Natl. Acad. Sci. U.S.A.1161685616865. 10.1073/pnas.1821309116

  • 68

    XuJ.WangS. (2019). Analysis of distance−based protein structure prediction by deep learning in CASP13.Prot. Struct. Funct. Bioinform.8710691081. 10.1002/prot.25810

  • 69

    YamasakiS.NagasawaS.Hayashi-NishinoM.YamaguchiA.NishinoK. (2011). AcrA dependency of the AcrD efflux pump in Salmonella enterica serovar typhimurium.J. Antibiot (Tokyo).64433437. 10.1038/ja.2011.28

  • 70

    YanagawaY.YamamotoY.HaraY.ShimamuraT. (2003). A combination effect of epigallocatechin gallate, a major compound of green tea catechins, with antibiotics on Helicobacter pylori growth in vitro.Curr. Microbiol.47244249. 10.1007/s00284-002-3956-6

  • 71

    YangJ. M.ChenC. C. (2004). Gemdock: a generic evolutionary method for molecular docking.Prot. Struct. Funct. Genet.55288304. 10.1002/prot.20035

Summary

Keywords

intracellular inhibition, invasion, marbofloxacin, pharmacodynamic, pyrogallol

Citation

Birhanu BT, Lee E-B, Lee S-J and Park S-C (2021) Targeting Salmonella Typhimurium Invasion and Intracellular Survival Using Pyrogallol. Front. Microbiol. 12:631426. doi: 10.3389/fmicb.2021.631426

Received

20 November 2020

Accepted

07 January 2021

Published

02 February 2021

Volume

12 - 2021

Edited by

Nagendran Tharmalingam, Rhode Island Hospital, United States

Reviewed by

Paul Ugalde Silva, Rhode Island Hospital, United States; Selvaraj Arokiyaraj, Sejong University, South Korea; Debayan Dey, Emory University, United States

Updates

Copyright

*Correspondence: Seung-Jin Lee, Seung-Chun Park,

These authors have contributed equally to this work

This article was submitted to Antimicrobials, Resistance and Chemotherapy, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics