ORIGINAL RESEARCH article

Front. Microbiol., 03 March 2021

Sec. Physiology and Metabolism of Microorganisms

Volume 12 - 2021 | https://doi.org/10.3389/fmicb.2021.634895

Natural Transformation of Riemerella columbina and Its Determinants

  • 1. Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, China

  • 2. Research Centre of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, China

  • 3. Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, China

Abstract

In a previous study, it was shown that Riemerella anatipestifer, a member of Flavobacteriaceae, is naturally competent. However, whether natural competence is universal in Flavobacteriaceae remains unknown. In this study, it was shown for the first time that Riemerella columbina was naturally competent in the laboratory condition; however, Flavobacterium johnsoniae was not naturally competent under the same conditions. The competence of R. columbina was maintained throughout the growth phases, and the transformation frequency was highest during the logarithmic phase. A competition assay revealed that R. columbina preferentially took up its own genomic DNA over heterologous DNA. The natural transformation frequency of R. columbina was significantly increased in GCB medium without peptone or phosphate. Furthermore, natural transformation of R. columbina was inhibited by 0.5 mM EDTA, but could be restored by the addition of CaCl2, MgCl2, ZnCl2, and MnCl2, suggesting that these divalent cations promote the natural transformation of R. columbina. Overall, this study revealed that natural competence is not universal in Flavobacteriaceae members and triggering of competence differs from species to species.

Introduction

Naturally competent bacteria can actively take up naked DNA from their environment and integrate it into the genome, which is called natural transformation (Mell and Redfield, 2014). As one of the three horizontal gene transfer mechanisms, natural transformation facilitates bacterial acquisition of virulence genes and antibiotic-resistant cassettes to help bacteria adapt to the environment (Wiedenbeck and Cohan, 2011; Seitz and Blokesch, 2013a). Natural transformation was first discovered in Streptococcus pneumoniae in 1928 (Griffith, 1928). Currently, at least 83 species have been found to have natural competence (Johnston et al., 2014; Liu et al., 2017).

In Gram-positive and Gram-negative bacteria, there are different mechanism to take up DNA. Naturally competent Gram-negative bacteria, such as Neisseria species and Haemophilus influenzae, use type IV pili (T4P) to take up exogenous double-stranded DNA (dsDNA), in contrast to Helicobacter pylori, which uses a type IV secretion system (T4SS) (Hofreuter et al., 2000), and Campylobacter jejuni, which uses a type II secretion system (T2SS) (Wiesner et al., 2003) to take up exogenous dsDNA. Gram-positive bacteria, such as S. pneumoniae and Bacillus subtilis, use a competence pseudopilus, a structure similar to T4P, to take up dsDNA (Hahn et al., 2005). Once dsDNA is transported across the outer membrane in Gram-negative bacteria or the peptidoglycan layer in Gram-positive bacteria, dsDNA is degraded to single-stranded DNA (ssDNA) and transported through the pore protein ComEC into the cytoplasm (Johnston et al., 2014). Internalized ssDNA is presumably bound by DNA-processing protein A (DprA), which recruits the recombinase RecA to mediate homologous recombination by facilitating strand exchange (Johnston et al., 2014; Huang et al., 2019). At present, the natural transformation of H. influenzae in Pasteurellaceae, Vibrio cholerae in Vibrionaceae, and S. pneumoniae in Streptococcaceae are well studied (Redfield et al., 2006; Blokesch, 2012; Johnston et al., 2014). Among the six genera of Pasteurellaceae, only the genera Actinobacillus and Haemophilus are naturally competent (Redfield et al., 2006). In Streptococcaceae, both Streptococcus and Lactococcus show natural competence (Griffith, 1928; Dalia et al., 2017). Within the genus Haemophilus, when H. influenzae is transferred from rich medium to defined competence medium (M-IV) or the cell culture reaches stationary phase, it becomes naturally competent (Herriott et al., 1970; Redfield, 1991). However, natural transformation of Haemophilus parasuis was readily induced by nutrient-rich medium (Zhang et al., 2015; Li et al., 2016). All information suggests that the occurrence of natural transformation is different among bacteria, even within the same genus.

In a previous study, it was shown that one member of the Flavobacteriaceae family, Riemerella anatipestifer (R. anatipestifer, RA), which causes septicemic diseases in ducks, geese, turkeys, and other birds (Huang et al., 2017), is naturally competent (Liu et al., 2017). However, whether other Flavobacteriaceae species are also naturally competent and under which condition natural transformation is induced remains unknown. Here, Flavobacterium johnsoniae (F. johnsoniae), a common soil and aquatic bacterium (McBride, 2004), and Riemerella columbina (R. columbina), widely distributed species among pigeon populations (Rubbenstroth et al., 2013), were selected as models to explore the occurrence of natural transformation and its influencing factors.

Materials and Methods

Bacterial Strains, Primers, and Growth Conditions

Riemerella columbina and Flavobacterium johnsoniae were purchased from the Culture Collection of the University of Gothenburg (CCUG) and the China General Microbiological Culture Collection Center (CGMCC), respectively. The bacterial strains and primers used in this study are listed in Table 1. The culture conditions for R. columbina and F. johnsoniae were identical to those used for R. anatipestifer described in a previous study (Huang et al., 2019). Briefly, R. columbina was cultured in GC broth (GCB) medium with shaking or GCB agar plates and LB plates supplemented with 5% sheep blood (blood plates) at 37°C, however, F. johnsoniae was cultured in GCB medium with shaking or GCB plates at 25°C. When required, erythromycin was added into the medium at a final concentration of 1 μg/ml for R. columbina and 50 μg/ml for F. johnsoniae.

TABLE 1

StrainGenotype or descriptionSource
F. johnsoniaeF. johnsoniae ATCC 17061CGMCC
R. columbinaR. columbina CCUG 47689CCUG
R. columbinaΔC237_RS0105470::ErmR. columbinaΔC237_RS0105470, ErmRThis study
R. anatipestifer ATCC11845R. anatipestifer ATCC11845, KanRThis study
R. anatipestifer CH-1R. anatipestifer ATCC11845, KanR, ErmRThis study

PrimerSequenceSource

Up(gldH) P1TAGCCGGACAATGTGGTAAACTAAAATGCTF. johnsoniae
Up(gldH) P2GACTGGAAAGTGGTTTTTTGTGATAATTATAGGTTTTF. johnsoniae
Erm(gldH) P1ATAATTATCACAAAAAACCACTTTCCAGTCTTACGAAR. anatipestifer CH-1
Erm(gldH) P2ATAACTATTTTTCGACTTTGAACTACGAAGGATGAAAR. anatipestifer CH-1
Down(gldH) P1GTAGTTCAAAGTCGAAAAATAGTTATGGCTGCTAAAAF. johnsoniae
Down(gldH) P2TTTTGAGAAATAGGTTTGTGCTGCTGAGCTF. johnsoniae
RC-Up P1CCCACATAGTTTGCGTAGAGATTATTTTGCCR. columbina
RC-Up P2CTGGAAAGTGGTAGAAACAAATGTAATAAATTTTTCGR. columbina
RC-Erm P1TTATTACATTTGTTTCTACCACTTTCCAGTCTTACGAR. anatipestifer CH-1
RC-Erm P2GATTTTATAGCGTCGACTTTGAACTACGAAGGATR. anatipestifer CH-1
RC-Down P1TAGTTCAAAGTCGACGCTATAAAATCACGATTAAAAR. columbina
RC-Down P2TGTCGGATTTCCCTTGTGGGTCAAAR. columbina
RC-16S rRNA P1ATGGAATTAATACAGCAACATTTTGR. columbina
RC-16S rRNA P2TCAAATATGCCCTTTAGAAAGGTAR. columbina
C237_RS0105470 P1ATGAATACTGAAGAAATTTTATATGCTAR. columbina
C237_RS0105470 P2AATTGAATATAAGCGTCCCGAR. columbina

Strains and primers used in this study.

Preparation of Donor DNA

The homologous gene of dprA (C237_RS0105470) in R. columbina, which protects ssDNA and loads RecA to facilitate homologous recombination (Mirouze et al., 2013), and the gliding motility gene gldH in F. johnsoniae were selected as targeted deletion gene, since they are not essential for the growth of bacteria and can be deleted (McBride et al., 2003; Hovland et al., 2017; Huang et al., 2019). Donor DNA was composed of upstream of target gene, an antibiotic resistance cassette and downstream of target gene. Briefly, the ∼620 bp upstream sequence and ∼620 bp downstream sequence of C237_RS0105470 were amplified from the genome of R. columbina using the primers RC-Up P1 and RC-Up P2, RC-Down P1 and RC-Down P2, respectively. The ∼620 bp upstream sequence and ∼620 bp downstream sequence of gldH were amplified from the genome of F. johnsoniae using the primers Up(gldH) P1 and Up(gldH) P2, Down(gldH) P1 and Down(gldH) P2, respectively. An erythromycin resistance cassette was amplified from the genome of R. anatipestifer CH-1 using the primers RC-Erm P1 and RC-Erm P2 or Erm(gldH) P1 and Erm(gldH) P2, respectively (Liao et al., 2015; Luo et al., 2015). The three fragments were fused using overlapping PCR (Xiong et al., 2006; Huang et al., 2017, 2019). The fused fragments served as donor DNA for natural transformation.

Natural Transformation Procedure

The procedure of natural transformation was similar to that used for R. anatipestifer described in a previous study (Liu et al., 2017; Huang et al., 2019). Briefly, R. columbina and F. johnsoniae were cultured in GCB liquid with shaking at 37°C for R. columbina and at 25°C for F. johnsoniae. The bacteria were collected during the logarithmic phase (OD600 = 3–4 for R. columbina, OD600 = 1–1.5 for F. johnsoniae) and adjusted to an optical density (OD) of 1. The growth curve of F. johnsoniae in GCB was shown in Supplementary Figure 1. The donor DNA was added to the bacterial cells and incubated for 1 h at 37°C for R. columbina and at 25°C for F. johnsoniae. Then, 100 μl of cells were plated on GCB agar plates supplemented with erythromycin (1 μg/ml for R. columbina; 50 μg/ml for F. johnsoniae) to count transformants. Then, 10 μl of cells were serially diluted with PBS and plated on GCB agar plates to count viable bacteria. The transformation frequency (TF) was calculated as transformants divided by viable bacteria. Then, 100 μl of cells were plated on GCB supplemented with the corresponding concentration of erythromycin to check for spontaneous mutants.

Determination of Growth Curves

The bacteria were streaked on blood plates or GCB agar plates. A single colony was cultured in 5 ml of GCB liquid medium with shaking at 37°C for 14 h. The bacterial cells were transferred into 20 ml of GCB with or without peptone, phosphate or iron at an OD of 0.05 and cultured at 37°C with shaking. The OD600 was determined every 2 h for 14 h, and natural transformation was performed at the corresponding times.

The Effect of Components of GCB on Natural Transformation in R. columbina

Bacterial cells were cultured to the logarithmic phase (OD600 = 3–4) and adjusted to an OD600 of 1. The bacterial cells were collected and resuspended in GCB medium depleted of vitamin B1 (VB1), glucose, L-glutamine, NaCl, peptone, or phosphate. After the bacteria were incubated at 37°C for 30 min, donor DNA was added to the cultured cells, and natural transformation was performed. Iron is essential for the growth of most bacteria (Liao et al., 2016). To investigate whether iron affects the growth and natural transformation of R. columbina, the growth curve of R. columbina in GCB supplemented with different concentrations of iron chelator ethylenediamine-N,N’-bis(2-hydroxyphenylacetic acid) (EDDHA) according to the method mentioned previously (Press et al., 2001; Liu et al., 2016, 2019) and natural transformation were performed after the bacteria were incubated into GCB supplemented with the corresponding concentration of EDDHA at 37°C for 30 min. The viable bacteria and transformants were counted, and the TF was calculated.

EDTA Treatment

Bacterial cells were cultured until the logarithmic phase (OD600 = 3–4) at 37°C with shaking and adjusted to an OD600 of 1. Three hundred microliters of bacteria were collected and resuspended in GCB medium supplemented with 0.5 mM EDTA. Natural transformation was performed after the bacteria were incubated at 37°C for 30 min. The TF was calculated according to the method described previously. To investigate which divalent cation affects the natural transformation of R. columbina, different concentrations of CaCl2, MgCl2, ZnCl2, MnCl2, or CuCl2 were added into the GCB medium supplemented with the corresponding concentration of EDTA. The bacterial cells were first incubated in the above medium at 37°C for 30 min, and natural transformation was then performed. The TF was calculated as described previously.

Statistics

Statistical analysis was performed using GraphPad Prism 8.0 (GraphPad Software Inc., La Jolla, United States). An unpaired two-tailed Student’s t-test was used to compare two groups, and a value of P < 0.05 was considered significant. Data represent the mean and standard deviation (SD) from at least three independent experiments.

Results

R. columbina, but Not F. johnsoniae, Is Naturally Competent Under the Same Conditions

To assay whether other members of Flavobacteriaceae were able to undergo natural transformation, R. columbina and F. johnsoniae were selected. We used the same method as described in a previous study for R. anatipestifer to determine the natural competence of these two species (Liu et al., 2017). After R. columbina incubated with donor DNA which contains the upstream sequence of C237_RS0105470, an erythromycin resistance cassette and the downstream sequence of C237_RS0105470 (Figure 1A), many resistant colonies grew on the plate with erythromycin. However, no resistant colonies appeared in the control group without donor DNA (the spontaneous mutation rate of erythromycin resistance was lower than the detection limitation). Random single colonies were verified using PCR to ensure that the target gene was replaced by the erythromycin resistance cassette through homologous recombination. As shown in Figure 1B, compared to the wild-type strain, the resistant colonies contained an erythromycin resistance gene but not a target gene. It was suggested that the target gene has been replaced by the erythromycin resistance cassette and that the target sequence of the R. columbina strain was lost. It was strongly supported that R. columbina was naturally competent and that natural transformation could be used to efficiently generate targeted gene disruptions in R. columbina, with a TF of 4.14 (±0.5) × 10–6.

FIGURE 1

After F. johnsoniae incubated with donor DNA containing the upstream sequence of gldH, an erythromycin resistance cassette and the downstream sequence of gldH, the transformants were selected on GCB plates supplemented with 50 μg/ml erythromycin (the MIC of erythromycin for F. johnsoniae is 16 μg/ml). However, no resistant colony appeared with or without donor DNA. It has been shown that gldH can be deleted in F. johnsoniae through other methods (McBride et al., 2003), suggesting that this gene is not essential for the survival of the bacteria. Overall, it was suggested that F. johnsoniae could not perform natural transformation using the same method as R. columbina under the same conditions.

Searching for the Components of the Natural Transformation Machinery in the Genome of F. johnsoniae

To investigate whether F. johnsoniae contains the homologous proteins that involved in natural transformation. We aligned the amino acids sequences of T4SS from H. pylori and Agrobacterium tumefaciens, T4P from V. cholerae, T2SS from C. jejuni, and other hypothetical competence proteins from R. anatipestifer with genome of F. johnsoniae. As shown in Table 2, only the homolog of ComB11 in T4SS, which is a putative VirB11-homologous ATPase (Karnholz et al., 2006), was found in F. johnsoniae and showed 40.8% identity with the ComB11 of H. pylori. Based on the T4P of V. cholerae (Seitz and Blokesch, 2013b), only the homologs of PilB, PilC, PilF, PilQ and PilT were discovered in F. johnsoniae and shared 48.41, 29.62, 25.98, 27.43, and 43.33% with each relative protein of V. cholerae, respectively. PilB and PilT are polymerization and depolymerization ATPases, respectively (Seitz and Blokesch, 2013b). PilC was an inner membrane platform protein which interacts with PilB and PilT to control both pilus assembly and disassembly (Takhar et al., 2013). PilF is pilolin protein which is essential for pilus biogenesis (Matthey and Blokesch, 2016). PilQ is a secretion pore, which plays a role in translocating pilus on the cell surface (Wolfgang et al., 2000). Furthermore, only the homologs of CtsD and CtsF were found in F. johnsoniae based on the T2SS of C. jejuni (Wiesner et al., 2003). CtsD is an outer membrane protein which has homology to the PilQ protein (Wiesner et al., 2003). CtsF is an inner membrane protein and shares similarity to PilG of N. gonorrhoeae which has homology to the PilC of V. cholerae (Tønjum et al., 1995). Other hypothetical competence protein of R. anatipestifer, like DprA, ComEC, RecA, Ssb, ComM and RadC is also present in F. johnsoniae (Liu et al., 2017). These results indicated that these homologs of F. johnsoniae may be sufficient to encode a T4P-type DNA uptake system in addition to the proteins usually needed for DNA translocation and cytoplasmic processing.

TABLE 2

T4SSProtein IDHomologsaIdentityb
VirB1AAZ50518.1NoneNone
ComB2HP_0015NoneNone
ComB3HP_0016NoneNone
ComB4HP_0017NoneNone
VirB5AAZ50522.1NoneNone
ComB6HP_0037NoneNone
VirB7AAZ50524.1NoneNone
ComB8HP_0038NoneNone
ComB9HP_0039/40NoneNone
ComB10HP_0041/42NoneNone
ComB11HP_1421WP_012022707.140.80%
VirD4HP_0524NoneNone

T4PProtein IDHomologsaIdentityb

PilAVC_2423NoneNone
PilBVC_2424WP_012022707.148.41%
PilEVC_0857NoneNone
FimTVC_0858NoneNone
VC_0859VC_0859NoneNone
VC_0860VC_0860NoneNone
PilVVC_0861NoneNone
PilFVC_1612WP_012024651.125.98%
PilQVC_2630WP_012022708.127.43%
PilPVC_2631NoneNone
PilOVC_2632NoneNone
PilNVC_2633NoneNone
PilMVC_2634NoneNone
PilCVC_2425WP_012022704.129.62%
PilTVC_0462WP_012022707.143.33%

T2SSProtein IDHomologsaIdentityb

CtsDCj1474cWP_012022708.123.51%
CtsFAAP87276.1WP_01202270424.21%
CtsPCj1473cNoneNone
CtsRCj1475cNoneNone
CtsWCj1028cNoneNone
CtsGCj1343cNoneNone
CtsECj1471cNoneNone

OthersProtein IDHomologsaIdentityb

DprARA0C_RS05130WP_012023081.137.91%
ComECRA0C_RS04895WP_012023505.124.45%
RecARA0C_RS04870WP_012023074.177.08%
ComMRA0C_RS07335WP_012024210.174.56%
SsbRA0C_RS02530WP_012022955.165.71%
RadCRA0C_RS03540WP_012022505.156.89%

Homologs of T4SS, T4P, T2SS, and other competence proteins in F. johnsoniae.

aHomologs in F. johnsoniae.

bAmino acids identity between F. johnsoniae and the example in the table.

Natural Transformation of R. columbina Increases During the Logarithmic Phase

We were wondering whether natural transformation was able to occur in all growth phases in R. columbina, the TF was assayed. Natural transformation was performed at each time point by adding the same amount of donor DNA. As shown in Figure 2, natural formation of R. columbina occurred in all growth phases, and the TF was the highest during the logarithmic phase [TF = 6.45 (±0.55) × 10–6] and lowest in the lag phase [TF = 6.35 (±0.5) × 10–8]. The number of transformants in different growth phases were included in the Supplementary Data Sheet 2. To investigate the saturated concentration of donor DNA for logarithmic growth period bacteria, R. columbina was cultured to the logarithmic phase and mixed with different amounts of donor DNA (0.1, 1, 10, 100, 200, 500, 1,000, 2,000, or 4,000 ng). As shown in Figure 3, the TF increased with increasing DNA concentration when the amount was lower than 1,000 ng. However, when the DNA amount was higher than 1,000 ng, the TF no longer increased. The number of transformants were included in the Supplementary Data Sheet 2. These results suggested that 1,000 ng of donor DNA was saturating for natural transformation in R. columbina.

FIGURE 2

FIGURE 3

R. columbina Preferentially Takes Up Its Own DNA Over Heterologous DNA

It has been reported that some bacteria, such as H. influenzae and Neisseria, preferentially take up DNA containing short motifs known as uptake signal sequences (USSs) or DNA uptake sequences (DUSs) (Scocca et al., 1974; Sisco and Smith, 1979). These short motifs have accumulated in the genome to high densities over evolutionary time (Mell and Redfield, 2014). To determine whether R. columbina also preferentially takes up its own DNA, a natural transformation competition experiment was performed. In this experiment, the genome of R. columbina ΔC237_RS0105470 was used as the donor DNA. As shown in Figure 4, when 1 μg of donor DNA was mixed with 1 μg of genomic DNA of R. columbina, the TF was decreased two-fold compared to the control in which without competition DNA was added; Moreover, the TF was decreased with the increase of competing DNA. However, the TF showed no significant changes when 1 μg donor of DNA was mixed with 1 μg of R. anatipestifer or E. coli genomic DNA compared to that when only 1 μg of donor DNA was added. The TF was decreased significantly only when the R. anatipestifer or E. coli genomic DNA was increased to 10 μg, which can be considered as unspecific effect. The number of transformants were included in the Supplementary Data Sheet 2. To further investigate whether R. columbina, F. johnsoniae or R. anatipestifer contain putative DUSs or USSs, Jellyfish1 was to be used to count the numbers of occurrences of individual kmers in both strands of their genome, respectively, with a parameter that limited the length of kmers to less than 10 bp. As shown in Table 3, sequences with the top three repeats for 10 bp, 9 bp, 8 bp, and 7 bp were listed, respectively. It was found that hundreds of repeat sequences or its complement were present in their genomes. The frequency of the 9-bp repeat sequence is 0.6/kb for R. anatipestifer, 0.5/kb for R. columbina and 0.5/kb for F. johnsoniae, respectively, which is much higher than the frequency of 0.1/kb expected for a random sequence of this base composition for them. Whether this sequence has the function of DUSs or USSs needs to be further investigated.

FIGURE 4

TABLE 3

kmerR. anatipestifer
R. columbina
F. johnsoniae
SequenceRepeatsExpected repeatsaSequenceRepeatsExpected repeatsaSequenceRepeatsExpected repeatsa
10AAAAATAAAA30156AAAAAGAAAA20330AAAAAATAAA759183
AAAAAATAAA23556AAAAAAATAA19654AAAAACAAAA74395
AAAAAAATAA20156AAAATTAAAA19654AAAAAAATAT479183
9AAAATAAAA650175AAAAATAAA666171TTTTAAAAA1769558
AAAAAATAA534175AAAAAATAA551171AAAAAATAA1591558
AAAAAAATA520175AAAAAAATA514171AAAAACAAA1569288
8AAAAATAA1428538AAAAAATA1534535TTTAAAAA45931694
AAAATAAA1424538AAAAATAA1522535AAAAAATA40951694
AAAAAATA1412538AAAATAAA1510535AAAAAAAT39101694
7AAAAATA38721657AAAAATA42101674TTTAAAA137245141
AAAATAA31851657AAAAAAT41141674AAAAAAA114355141
AAAAAAA28811657AAAATAA34451674AAAAAAT112135141

Analysis of putative DUSs or USSs in R. anatipestifer, R. columbina and F. johnsoniae.

aExpected repeats is calculated directly from the base composition and length of the genome.R. columbina (2436790 bp) and F. johnsoniae (6096872 bp) and the GC content of each strain: R. anatipestifer (35%), R. columbina (36%) and F. johnsoniae (34.1%).

The TF of R. columbina Is Increased Under Peptone-Restrictive or Phosphate-Restrictive Conditions

To investigate the effect of the nutrients on natural transformation, natural transformation was conducted in GCB depleted for each component, including vitamin B1 (VB1), glucose, L-glutamine, NaCl, peptone and phosphate. As shown in Figure 5A, the TF of R. columbina was 1.9 (±0.1) × 10–5 in GCB depleted of peptone, which increased five-fold compared to that in GCB. The TF of R. columbina was 9.05 (±0.5) × 10–6 in GCB depleted of phosphate, which increased approximately two-fold compared to that in GCB. However, compared to the TF of R. columbina in GCB, there was no significant difference when VB1, glucose, L-glutamine or NaCl was removed from GCB (Figure 5A). The number of transformants were included in the Supplementary Data Sheet 2.

FIGURE 5

Next, we investigated whether the change in TF was associated with the growth ability of bacteria. Therefore, the growth curve of bacteria was determined when peptone, phosphate, NaCl, glucose, L-glutamine or VB1 was removed from GCB. The results showed that bacteria did not grow in GCB without peptone or VB1, whereas the growth of bacteria was significantly decreased in GCB without phosphate; however, there were no significant differences when NaCl, glucose, or L-glutamine was removed from GCB (Figure 5B). To investigate whether iron affects the natural transformation of R. columbina, different concentrations of iron chelator EDDHA were supplemented into the GCB medium. As shown in Figure 5A, the TF did not change compared to that of the control (without EDDHA). The number of transformants were included in the Supplementary Data Sheet 2. However, the growth of R. columbina was significantly inhibited in iron-depleted medium (GCB supplemented with 200 μM EDDHA), suggesting that iron is essential for the growth of R. columbina (Figure 5B). Overall, these results suggested that peptone-restrictive or phosphate-restrictive medium had an effect on the natural transformation and this effect is not directly related to the growth ability.

Ca2+, Mg2+, Zn2+, and Mn2+ but Not Cu2+ Promote the Natural Transformation of R. columbina

Iron has no effect on natural transformation, and we wondered if other divalent cations influence the natural transformation of R. columbina. Natural transformation was conducted in GCB medium with 0.5 mM EDTA, which had no effect on the survival of bacteria (Supplementary Figure 2). The results showed that the TF in GCB with 0.5 mM EDTA was 5.75 (±0.75) × 10–7, which was decreased approximately 4-fold compared to that in GCB [TF = 2.5(±0.1) × 10–6], suggesting that 0.5 mM EDTA had a significant inhibitory effect on natural transformation in R. columbina (Figure 6A). To investigate which divalent cation has an effect on natural transformation, different concentrations of CaCl2, MgCl2, ZnCl2, MnCl2, or CuCl2 were supplemented into the cell culture after incubation with EDTA. The addition of 0.5 mM Ca2+ basically restored transformation, and the TF increased as the concentration of Ca2+ increased (Figure 6B). The addition of 0.5 mM Mg2+ completely restored the TF; however, the frequency did not increase as the concentration of Mg2+ increased (Figure 6B), suggesting that 0.5 mM was likely a saturating concentration of Mg2+ for natural transformation in R. columbina. The TF gradually increased as the concentration of Zn2+ increased from 0.1 mM to 0.5 mM. The TF was the highest at 0.5 mM Mn2+(Figure 6B). However, the addition of different concentrations of Cu2+ did not restore the natural transformation but instead inhibited natural transformation (Figure 6B). The number of transformants were included in the Supplementary Data Sheet 2. Therefore, it was shown that Ca2+, Mg2+, Zn2+, and Mn2+ were required for the natural transformation of R. columbina, but Cu2+ was not.

FIGURE 6

Discussion

Riemerella anatipestifer is the first bacterium of Flavobacteriaceae to be reported to have natural competence (Liu et al., 2017). To check whether other bacteria in Flavobacteriaceae are also naturally competent, F. johnsoniae and R. columbina were selected. The results showed that R. columbina was able to undergo natural transformation; however, F. johnsoniae was not competent under the same conditions. One possibility is that the natural transformation of F. johnsoniae does not occur at all growth phases but only at a certain time point, for example natural transformation happens to S. pneumoniae, in which natural transformation is not constitutive, as synthesis and assembly of the uptake apparatus is a transient and regulated process (Mirouze et al., 2013). Another possibility is that the PCR fragments are not suitable substrates, such as occurs with C. jejuni, which takes up only methylated DNA but not PCR fragments (Beauchamp et al., 2017), and H. influenzae and Neisseria gonorrhoeae, which preferentially take up DNA with an USS or DUS over other sources of DNA (Mell et al., 2012; Berry et al., 2013; Frye et al., 2013; Mell and Redfield, 2014). The third possibility is that natural transformation in F. johnsoniae must be induced by special substrates, such as occurs with natural transformation of Vibrio cholerae, which is induced by chitin (Meibom et al., 2005). The fourth possibility is that we did not choose the correct isolates. It has been reported that even for the competent bacteria, some isolates are non-transformable (Evans and Rozen, 2013; Dalia et al., 2015). The last possibility is that F. johnsoniae does not undergo natural transformation because of the lack of some essential genes for natural transformation.

Consistent with the natural transformation of R. anatipestifer (Liu et al., 2017), the natural transformation of R. columbina is also constitutive, although the TF is different at the different growth phases. This phenomenon might occur because the expression of genes involved in natural transformation in R. columbina is different at the different growth phases. Similar to R. anatipestifer, R. columbina preferentially takes up self-sourced genomic DNA, suggesting that each bacterium might use a certain mechanism, such as a restriction modification (R-M) system (Aras et al., 2002; Zhang and Blaser, 2012) or other systems, to prevent the uptake of excessive extracellular DNA that may overload the bacteria, subverting the bacterial genome with extracellular DNA from competing strains.

Originally, the function of natural transformation was hypothesized as “DNA for food” (Redfield, 2001), because the natural competence of H. influenzae and B. subtilis was activated under nutrient-limited condition (Bobb, 1963; Herriott et al., 1970). However, this hypothesis is questionable, since the natural competence of some other bacteria, such as A. baumannii, requires a nutrient-rich condition (Traglia et al., 2016). In the case of R. columbina, we showed that the TF of R. columbina was significantly increased under peptone-restrictive or phosphate-restrictive conditions, suggesting that the uptake of DNA may be “food” for R. columbina to supplement the nitrogen and phosphorus.

A more plausible hypothesis for the function of natural transformation is “DNA for repair”(Michod et al., 2008; Engelmoer et al., 2013), since the natural transformation of some bacteria, such as H. pylori (Dorer et al., 2010), S. pneumoniae (Prudhomme et al., 2006) and B. subtilis (Zhang et al., 2018), was activated by antibiotics or DNA damage reagent. Here, we also investigated the effects of antibiotics such as ampicillin (inhibitor of cell wall biosynthesis), kanamycin (inhibitor of protein biosynthesis), nalidixic acid (inhibitor of DNA replication) and mitomycin C (intercalation with DNA) during the natural transformation of R. columbina. We showed that none of the antibiotics affected natural TF of R. columbina did not change after treatment with antibiotics (Supplementary Figure 3), suggesting that the antibiotics used here cannot trigger natural transformation of R. columbina.

Our systematic investigation of natural transformation in the Flavobacteriaceae family shows that it is widely distributed. However, the environmental conditions that trigger natural transformation vary from species to species. In this family, natural transformation appears to play a major role in HGT. The discovery of natural transformation in R. columbina represents the basis for the establishment of gene editing and cloning system in this bacterium.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.

Author contributions

ML, DZ, and AC conceived and designed the experiments. LH, LX, MH, CX, SZ, QG, DS, and BT performed the experiments. MW, RJ, SC, XZ, QY, and YW analyzed the data. JH, XO, and SM contributed to reagents, materials, and analysis tools. ML, FB, and AC wrote the manuscript. All authors have reviewed the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32072825), China Agricultural Research System (CARS-42-17), Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2020-18), and Integration and Demonstration of Key Technologies for Goose Industrial Chain in Sichuan Province (2018NZ0005).

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2021.634895/full#supplementary-material

References

  • 1

    ArasR. A.SmallA. J.AndoT.BlaserM. J. (2002). Helicobacter pylori interstrain restriction-modification diversity prevents genome subversion by chromosomal DNA from competing strains.Nucleic Acids Res.3053915397. 10.1093/nar/gkf686

  • 2

    BeauchampJ. M.LevequeR. M.DawidS.DiRitaV. J. (2017). Methylation-dependent DNA discrimination in natural transformation of Campylobacter jejuni.Proc. Natl. Acad. Sci. U.S.A.114E8053E8061. 10.1073/pnas.1703331114

  • 3

    BerryJ. L.CehovinA.McDowellM. A.LeaS. M.PelicicV. (2013). Functional analysis of the interdependence between DNA uptake sequence and its cognate ComP receptor during natural transformation in Neisseria species.PLoS Genet.9:e1004014. 10.1371/journal.pgen.1004014

  • 4

    BlokeschM. (2012). Chitin colonization, chitin degradation and chitin-induced natural competence of Vibrio cholerae are subject to catabolite repression.Environ. Microbiol.1418981912. 10.1111/j.1462-2920.2011.02689.x

  • 5

    BobbD. (1963). Overnight incubation technique for obtaining transformable Bacillus subtilus cells of reproducible competency.Nature199828829. 10.1038/199828a0

  • 6

    DaliaA. B.SeedK. D.CalderwoodS. B.CamilliA. (2015). A globally distributed mobile genetic element inhibits natural transformation of Vibrio cholerae.Proc. Natl. Acad. Sci. U.S.A.1121048510490. 10.1073/pnas.1509097112

  • 7

    DaliaT. N.YoonS. H.GalliE.BarreF. X.WatersC. M.DaliaA. B. (2017). Enhancing multiplex genome editing by natural transformation (MuGENT) via inactivation of ssDNA exonucleases.Nucleic Acids Res.4575277537. 10.1093/nar/gkx496

  • 8

    DorerM. S.FeroJ.SalamaN. R. (2010). DNA damage triggers genetic exchange in Helicobacter pylori.PLoS Pathog.6:e1001026. 10.1371/journal.ppat.1001026

  • 9

    EngelmoerD. J.DonaldsonI.RozenD. E. (2013). Conservative sex and the benefits of transformation in Streptococcus pneumoniae.PLoS Pathog.9:e1003758. 10.1371/journal.ppat.1003758

  • 10

    EvansB. A.RozenD. E. (2013). Significant variation in transformation frequency in Streptococcus pneumoniae.ISME J.7791799. 10.1038/ismej.2012.170

  • 11

    FryeS. A.NilsenM.TonjumT.AmburO. H. (2013). Dialects of the DNA uptake sequence in Neisseriaceae.PLoS Genet.9:e1003458. 10.1371/journal.pgen.1003458

  • 12

    GriffithF. (1928). The significance of pneumococcal types.J. Hyg.27113159. 10.1017/s0022172400031879

  • 13

    HahnJ.MaierB.HaijemaB. J.SheetzM.DubnauD. (2005). Transformation proteins and DNA uptake localize to the cell poles in Bacillus subtilis.Cell1225971. 10.1016/j.cell.2005.04.035

  • 14

    HerriottR. M.MeyerE. M.VogtM. (1970). Defined nongrowth media for stage II development of competence in Haemophilus influenzae.J. Bacteriol.101517524. 10.1128/jb.101.2.517-524.1970

  • 15

    HofreuterD.OdenbreitS.PulsJ.SchwanD.HaasR. (2000). Genetic competence in Helicobacter pylori: mechanisms and biological implications.Res. Microbiol.151487491. 10.1016/s0923-2508(00)00164-9

  • 16

    HovlandE.BeyeneG. T.FryeS. A.HombersetH.BalasinghamS. V.Gomez-MunozM.et al (2017). DprA from Neisseria meningitidis: properties and role in natural competence for transformation.Microbiology16310161029. 10.1099/mic.0.000489

  • 17

    HuangL.TianX.LiuM.WangM.BivilleF.ChengA.et al (2019). DprA is essential for natural competence in riemerella anatipestifer and has a conserved evolutionary mechanism.Front. Genet.10:429. 10.3389/fgene.2019.00429

  • 18

    HuangL.YuanH.LiuM. F.ZhaoX. X.WangM. S.JiaR. Y.et al (2017). Type B chloramphenicol acetyltransferases are responsible for chloramphenicol resistance in Riemerella anatipestifer, China.Front. Microbiol.8:297. 10.3389/fmicb.2017.00297

  • 19

    JohnstonC.MartinB.FichantG.PolardP.ClaverysJ. P. (2014). Bacterial transformation: distribution, shared mechanisms and divergent control.Nat. Rev. Microbiol.12181196. 10.1038/nrmicro3199

  • 20

    KarnholzA.HoeflerC.OdenbreitS.FischerW.HofreuterD.HaasR. (2006). Functional and topological characterization of novel components of the comB DNA transformation competence system in Helicobacter pylori.J. Bacteriol.188882893. 10.1128/jb.188.3.882-893.2006

  • 21

    LiJ.YuanX.XuL.KangL.JiangJ.WangY. (2016). Efficient construction of Haemophilus parasuis mutants based on natural transformation.Can. J. Vet. Res.80281286.

  • 22

    LiaoH.ChengX.ZhuD.WangM.JiaR.ChenS.et al (2015). TonB energy transduction systems of Riemerella anatipestifer are required for iron and hemin utilization.PLoS One10:e0127506. 10.1371/journal.pone.0127506

  • 23

    LiaoH.LiuM.ChengX.ZhuD.WangM.JiaR.et al (2016). The detection of hemin-binding proteins in Riemerella anatipestifer CH-1.Curr. Microbiol.72152158. 10.1007/s00284-015-0932-5

  • 24

    LiuM.HuangM.HuangL.BivilleF.ZhuD.WangM.et al (2019). New perspectives on Galleria mellonella larvae as a host model using Riemerella anatipestifer as a proof of concept.Infect. Immun.87:e00072-19. 10.1128/IAI.00072-19

  • 25

    LiuM.WangM.ZhuD.WangM.JiaR.ChenS.et al (2016). Investigation of TbfA in Riemerella anatipestifer using plasmid-based methods for gene over-expression and knockdown.Sci. Rep.6:37159. 10.1038/srep37159

  • 26

    LiuM.ZhangL.HuangL.BivilleF.ZhuD.WangM.et al (2017). Use of natural transformation to establish an easy knockout method in Riemerella anatipestifer.Appl. Environ. Microbiol.83:e000127-17. 10.1128/AEM.00127-17

  • 27

    LuoH.LiuM.WangL.ZhouW.WangM.ChengA.et al (2015). Identification of ribosomal RNA methyltransferase gene ermF in Riemerella anatipestifer.Avian Pathol.44162168. 10.1080/03079457.2015.1019828

  • 28

    MattheyN.BlokeschM. (2016). The DNA-Uptake process of naturally competent Vibrio cholerae.Trends Microbiol.2498110. 10.1016/j.tim.2015.10.008

  • 29

    McBrideM. J. (2004). Cytophaga-flavobacterium gliding motility.J. Mol. Microbiol. Biotechnol.76371. 10.1159/000077870

  • 30

    McBrideM. J.BraunT. F.BrustJ. L. (2003). Flavobacterium johnsoniae GldH is a lipoprotein that is required for gliding motility and chitin utilization.J. Bacteriol.18566486657. 10.1128/jb.185.22.6648-6657.2003

  • 31

    MeibomK. L.BlokeschM.DolganovN. A.WuC. Y.SchoolnikG. K. (2005). Chitin induces natural competence in Vibrio cholerae.Science31018241827. 10.1126/science.1120096

  • 32

    MellJ. C.HallI. M.RedfieldR. J. (2012). Defining the DNA uptake specificity of naturally competent Haemophilus influenzae cells.Nucleic Acids Res.4085368549. 10.1093/nar/gks640

  • 33

    MellJ. C.RedfieldR. J. (2014). Natural competence and the evolution of DNA uptake specificity.J. Bacteriol.19614711483. 10.1128/JB.01293-13

  • 34

    MichodR. E.BernsteinH.NedelcuA. M. (2008). Adaptive value of sex in microbial pathogens.Infect. Genet. Evol.8267285. 10.1016/j.meegid.2008.01.002

  • 35

    MirouzeN.BergeM. A.SouletA. L.Mortier-BarriereI.QuentinY.FichantG.et al (2013). Direct involvement of DprA, the transformation-dedicated RecA loader, in the shut-off of pneumococcal competence.Proc. Natl. Acad. Sci. U.S.A.110E1035E1044. 10.1073/pnas.1219868110

  • 36

    PressC. M.LoperJ. E.KloepperJ. W. (2001). Role of iron in rhizobacteria-mediated induced systemic resistance of cucumber.Phytopathology91593598. 10.1094/PHYTO.2001.91.6.593

  • 37

    PrudhommeM.AttaiechL.SanchezG.MartinB.ClaverysJ. P. (2006). Antibiotic stress induces genetic transformability in the human pathogen Streptococcus pneumoniae.Science3138992. 10.1126/science.1127912

  • 38

    RedfieldR. J. (1991). sxy-1, a Haemophilus influenzae mutation causing greatly enhanced spontaneous competence.J. Bacteriol.17356125618. 10.1128/jb.173.18.5612-5618.1991

  • 39

    RedfieldR. J. (2001). Do bacteria have sex?Nat. Rev. Genet.2634639. 10.1038/35084593

  • 40

    RedfieldR. J.FindlayW. A.BosseJ.KrollJ. S.CameronA. D.NashJ. H. (2006). Evolution of competence and DNA uptake specificity in the Pasteurellaceae.BMC Evol. Biol.6:82. 10.1186/1471-2148-6-82

  • 41

    RubbenstrothD.RyllM.HotzelH.ChristensenH.KnoblochJ. K.RautenschleinS.et al (2013). Description of Riemerella columbipharyngis sp. nov., isolated from the pharynx of healthy domestic pigeons (Columba livia f. domestica), and emended descriptions of the genus Riemerella, Riemerella anatipestifer and Riemerella columbina.Int. J. Syst. Evol. Microbiol.63(Pt 1), 280287. 10.1099/ijs.0.036798-0

  • 42

    ScoccaJ. J.PolandR. L.ZoonK. C. (1974). Specificity in deoxyribonucleic acid uptake by transformable Haemophilus influenzae.J. Bacteriol.118369373. 10.1128/jb.118.2.369-373.1974

  • 43

    SeitzP.BlokeschM. (2013a). Cues and regulatory pathways involved in natural competence and transformation in pathogenic and environmental Gram-negative bacteria.FEMS Microbiol. Rev.37336363. 10.1111/j.1574-6976.2012.00353.x

  • 44

    SeitzP.BlokeschM. (2013b). DNA-uptake machinery of naturally competent Vibrio cholerae.Proc. Natl. Acad. Sci. U.S.A.1101798717992. 10.1073/pnas.1315647110

  • 45

    SiscoK. L.SmithH. O. (1979). Sequence-specific DNA uptake in Haemophilus transformation.Proc. Natl. Acad. Sci. U.S.A.76972976. 10.1073/pnas.76.2.972

  • 46

    TakharH. K.KempK.KimM.HowellP. L.BurrowsL. L. (2013). The platform protein is essential for type IV pilus biogenesis.J. Biol. Chem.28897219728. 10.1074/jbc.m113.453506

  • 47

    TønjumT.FreitagN. E.NamorkE.KoomeyM. (1995). Identification and characterization of pilG, a highly conserved pilus−assembly gene in pathogenic Neisseria.Mol. Microbiol.16451464. 10.1111/j.1365-2958.1995.tb02410.x

  • 48

    TragliaG. M.QuinnB.SchrammS. T.Soler-BistueA.RamirezM. S. (2016). Serum Albumin and Ca2+ are natural competence inducers in the human pathogen Acinetobacter baumannii.Antimicrob. Agents Chemother.6049204929. 10.1128/AAC.00529-16

  • 49

    WiedenbeckJ.CohanF. M. (2011). Origins of bacterial diversity through horizontal genetic transfer and adaptation to new ecological niches.FEMS Microbiol. Rev.35957976. 10.1111/j.1574-6976.2011.00292.x

  • 50

    WiesnerR. S.HendrixsonD. R.DiRitaV. J. (2003). Natural transformation of Campylobacter jejuni requires components of a type II secretion system.J. Bacteriol.18554085418. 10.1128/jb.185.18.5408-5418.2003

  • 51

    WolfgangM.van PuttenJ. P.HayesS. F.DorwardD.KoomeyM. (2000). Components and dynamics of fiber formation define a ubiquitous biogenesis pathway for bacterial pili.Embo J.1964086418. 10.1093/emboj/19.23.6408

  • 52

    XiongA. S.YaoQ. H.PengR. H.DuanH.LiX.FanH. Q.et al (2006). PCR-based accurate synthesis of long DNA sequences.Nat. Protoc.1791797. 10.1038/nprot.2006.103

  • 53

    ZhangL.LiY.DaiK.WenX.WuR.HuangX.et al (2015). Establishment of a successive markerless mutation system in Haemophilus parasuis through natural transformation.PLoS One10:e0127393. 10.1371/journal.pone.0127393

  • 54

    ZhangX.JinT.DengL.WangC.ZhangY.ChenX. (2018). Stress-induced, highly efficient, donor cell-dependent cell-to-cell natural transformation in Bacillus subtilis.J. Bacteriol.200:e00267-18. 10.1128/JB.00267-18

  • 55

    ZhangX. S.BlaserM. J. (2012). Natural transformation of an engineered Helicobacter pylori strain deficient in type II restriction endonucleases.J. Bacteriol.19434073416. 10.1128/JB.00113-12

Summary

Keywords

Flavobacteriaceae, R. columbina, Flavobacterium johnsoniae, natural competence, horizontal gene transfer

Citation

Huang L, Liu M, Zhu D, Xie L, Huang M, Xiang C, Biville F, Jia R, Chen S, Zhao X, Yang Q, Wu Y, Zhang S, Huang J, Ou X, Mao S, Gao Q, Sun D, Tian B, Wang M and Cheng A (2021) Natural Transformation of Riemerella columbina and Its Determinants. Front. Microbiol. 12:634895. doi: 10.3389/fmicb.2021.634895

Received

29 November 2020

Accepted

12 February 2021

Published

03 March 2021

Volume

12 - 2021

Edited by

Friedrich Götz, University of Tübingen, Germany

Reviewed by

Rosemary Redfield, University of British Columbia, Canada; Yuichi Koga, Osaka University, Japan

Updates

Copyright

*Correspondence: Mingshu Wang, Anchun Cheng,

These authors have contributed equally to this work

This article was submitted to Microbial Physiology and Metabolism, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics