ORIGINAL RESEARCH article

Front. Microbiol., 24 September 2021

Sec. Antimicrobials, Resistance and Chemotherapy

Volume 12 - 2021 | https://doi.org/10.3389/fmicb.2021.737626

Inhibition of Quorum Sensing and Biofilm Formation of Esculetin on Aeromonas Hydrophila

  • BS

    Bing Sun 1,2

  • HL

    Huaizhi Luo 1

  • HJ

    Huan Jiang 1

  • ZW

    Zhennan Wang 1

  • AJ

    Aiqun Jia 2*

  • 1. School of Environmental and Biological Engineering, Nanjing University of Science and Technology, Nanjing, China

  • 2. State Key Laboratory of Marine Resource Utilization in South China Sea, School of Pharmaceutical Sciences, Hainan University, Haikou, China

Abstract

Quorum sensing (QS) and biofilm formation inhibition activity of esculetin on Aeromonas hydrophila SHAe 115 were evaluated. Exposure to esculetin at 25, 50, and 100μg/ml significantly inhibited the production of protease and hemolysin, the formation of biofilms and attenuated the swarming motility of A. hydrophila SHAe 115. Biofilm forming inhibition was also observed through confocal laser scanning microscopy and scanning electron microscope. Quantitative real-time PCR analysis indicated that genes positively related to QS and biofilm formation were downregulated to varying degrees, while gene (litR) negatively related to biofilm formation was significantly upregulated. The phenotypic results were in good agreement with gene expression levels. These results indicated that esculetin would be a potential QS inhibitor for A. hydrophila.

Introduction

In the past few decades, indiscriminate use of antibiotics has led to the emergence of multiple drug-resistant bacteria, which has become a major problem threatening the global medical health and public health system (). In most cases, due to the way antibiotics kill bacteria or inhibit bacterial growth, selective pressure leads to the emergence of resistant strains. Over the past decade, the development of new antibiotics has declined sharply, while drug-resistant strains have become tougher (). Therefore, there is an urgent need to develop alternative therapies. These therapies need to target these multi-drug resistant strains in a biofilm state and will not exert selective pressure on resistant strains. The discovery of the bacterial quorum sensing (QS) system provides us with such a promising strategy to prevent and control microbial infections. QS is a cell-to-cell signaling communication system, it involves the production, release, and subsequent detection of chemical signaling molecules, called autoinducers, by a population-density-dependent intercellular communication system allowing bacteria to control the expression of genes related to virulence and pathogenesis. In general, these autoinducers include N-acyl homoserine lactones (AHL) and oligopeptides in gram-negative and gram-positive bacteria, respectively. QS controls the virulence behavior of a broad spectrum of bacterial pathogens and participate in the biofilm formation, a key driver of antibiotic resistance in many infections (; ). Hence, QS systems have been proposed as an effective target for antimicrobial therapy, cause it can be blocked by ways of inhibiting the AHL molecule biosynthesis, degrading the synthesized AHL molecules and/or inactivating the AHL receptor protein ().

Aeromonas hydrophila is a conditional pathogen that is common to humans, livestock, and aquatic animals (). A. hydrophila can infect molluscs (), crustaceans (), fish (; ), amphibians (), reptiles (), and poultry (). Humans can suffer from diarrhea, food poisoning, and secondary infections due to pathogenic A. hydrophila infection (). A. hydrophila not only poses a threat to human health, but also cause huge economic losses to the aquaculture industry, which has attracted great attention over the world.

Many natural compounds have been reported as QS inhibitors (; ; ), and some of the most effective QS inhibition molecules derived from plants are coumarins, a large structurally diverse family of plant phenolic compounds characterized by their pharmacological properties (). Biological studies on coumarins demonstrated that these compounds have potential activities, such as antitumor (; ; ), anti-inflammatory (; ), anticoagulant (; ), and antibacterial (; ). Among coumarins, hydroxylated coumarins, such as umbelliferone, daphnetin, and esculetin, showed stronger bioactivities. demonstrated that esculetin has obvious antibacterial effect on KPC-producing Klebsiella pneumoniae. Esculetin also has superior antibacterial activity against the phytopathogen Ralstonia solanacearum and can inhibit its biofilm formation (). showed that esculetin has a good inhibitory effect on the QS-regulated transcription factor SdiA of Salmonella typhi through molecular docking. Recent reports on coumarins inhibiting biofilm formation and reducing virulence factors of Escherichia coli and Pseudomonas aeruginosa () have drawn the attention of researchers to the potential of coumarins as QS inhibitors and anti-biofilm agents. According to , esculetin and umbelliferone could inhibit the growth of E. coli O157:H7. reported that esculetin was able to prevent biofilm formation of Staphylococcus aureus without affecting its cell growth. conducted a comparison of seven structurally related coumarins (coumarin and different hydroxylated derivatives) on the QS inhibitory and anti-biofilm activities against P. aeruginosa and Chromobacterium violaceum. The results showed that molecules with hydroxyl groups on the aromatic ring have higher activity on virulence factors inhibition and biofilm formation. Besides, research of showed that hydroxylation in position C-4 dramatically diminishes the anti-biofilm activity on E. coli O157:H7 while hydroxylation in position C-7 enhances it.

According to the above introduction, esculetin has good inhibitory activity against many bacteria, and many plants contain this compound. Our previous phytochemical work also isolated this compound. However, no study on the inhibitory effect of esculetin against A. hydrophila has been reported. Hereby, we investigated the influence of esculetin on QS-related virulence factors and biofilm formation of A. hydrophila SHAe115. We hope that esculetin can mitigate human disease caused by A. hydrophila and/or reduce the loss of aquaculture caused by A. hydrophila.

Materials and Methods

Bacterial Strain and Culture Conditions

Aeromonas hydrophila SHAe 115 used in this study was obtained from China General Microbiological Culture Collection Center. All experiments were conducted at 37°C in Luria-Bertani (LB) medium.

Esculetin was isolated from Onosma bracteatum Wall. in our previous study (). It was dissolved in DMSO to prepare a stock solution of 50mg/ml.

The Minimum Inhibitory Concentration and Growth Measurement

Esculetin was tested against A. hydrophila SHAe 115 to determine the minimum inhibitory concentration (MIC) according to Clinical and Laboratory Standards Institute (2015) () and with an inoculum of 1–5×105CFUml−1. The OD620 value of bacterial cultures of A. hydrophila SHAe 115 at this concentration was approximately 0.1. Two-fold dilution method was used and a series of diluted esculetin solution (25, 50, 100, 200, 400, and 800μg/ml) was performed in LB broth. The experiment was carried out in 96-well polystyrene microtiter plate, with 10 wells for each concentration. MIC is defined as the minimum concentration of esculetin which inhibited the visible growth of A. hydrophila SHAe 115 and sub-MICs were selected for the assessment of anti-virulence and anti-biofilm activity.

For growth measurement, overnight cultures of A. hydrophila SHAe 115 were inoculated into fresh LB medium and the optical density (OD) value was adjusted to 0.1 at 620nm. The cultures were transferred to 96-well polystyrene microtiter plate and supplemented with esculetin of different final concentrations (25, 50, and 100μg/ml), and then incubated continuously at 37°C for 24h with shaking (180rpm). DMSO was set as the negative control, and each concentration was set for 10 wells. The bacterial growth was monitored at 1h intervals, and the OD620 was recorded by a microplate reader (Biotek, United States).

Hemolysin Assay

The hemolysin assay was performed with a few changes based on the method of . 1% overnight culture of A. hydrophila SHAe 115 was added to fresh LB medium (OD620 ≈0.1) and cultivated in 24-well polystyrene microtiter plate with or without esculetin at 37°C for 24h with shaking (180rpm). The final concentrations of esculetin were 25, 50, and 100μg/ml. DMSO was set as the negative control, and three parallel groups were set for each concentration. After the cultivation, the cultures were centrifuged at 10000rpm for 10min (4°C), and the cell free supernatants were collected. 100μl of cell free supernatants of esculetin treated and untreated cultures were mixed with 900μl of 2% washed sheep blood (in PBS, pH 7.2). The mixture was incubated for 1h at 37°C followed by 10min of centrifugation at 3000rpm. Absorbance of the supernatant was measured at 530nm.

Azocasein Assay

Azocasein assay was conducted to evaluated the total proteolytic activity of A. hydrophila SHAe 115, and the activity was determined by the method of . 75μl of the abovementioned cell free supernatant obtained from each group was added to 125μl of 0.3% azocasein solution (in 50mM Tris-HC1 and 0.5mM CaCl2) and incubated at 30°C for 15min. The reaction was ended by adding 600μl of 10% trichloroacetic acid. After centrifugation for 10min at 10000rpm, 700μl of NaOH (1M) was mixed with the supernatant and the OD440 was recorded by a microplate reader (Biotek, United States).

Swarming Motility Assay

The swarming agar was freshly prepared with 0.8% nutrient broth (NB) medium, 0.5% glucose, and 0.3% agar (pH 7.2). 2μl overnight culture of A. hydrophila SHAe 115 was inoculated at the center of the agar plate containing a series of esculetin (25, 50, and 100μg/ml). DMSO was set as the control, and three parallel groups were set for each concentration. The plates were cultured at 37°C for 24h, and the swarming migration diameters were recorded ().

Biofilm Inhibition Assay

The effect of esculetin at sub-MICs on biofilm formation was measured according to with some modifications. Briefly, 1% overnight culture of A. hydrophila SHAe 115 was added to fresh LB medium (OD620 ≈ 0.1) and transferred to a 96-well polystyrene microtiter plate then incubated in the presence and absence of esculetin for 24h at 37°C without shaking. DMSO served as the negative control with 10 wells for each concentration. After the incubation, planktonic cells and spent media were discarded and the biofilms were washed with PBS (pH 7.2) for three times. After being fixed with methanol for 15min, the biofilms were stained with 0.05% crystal violet (CV). Further, excess stain was removed and the biofilms were rinsed three times with PBS (pH 7.2) and bound CV was dissolved with 95% ethanol. Biofilm biomass was quantified by measuring the absorbance of crystal violet-ethanol solutions at 570nm (Biotek, United States).

Microscopy Analysis

One percent overnight culture of A. hydrophila SHAe 115 was added to fresh LB medium (OD620 ≈ 0.1), and cultivated in 24-well polystyrene microtiter plate containing glass slides (d=14mm) with and without esculetin. Culture was incubated without agitation at 37°C for 24h. DMSO was set as the negative control, and three parallel groups were set for each concentration. After the incubation, planktonic cells and spent media were removed and the glass slides were gently rinsed three times with PBS (pH 7.2).

For scanning electron microscopy (SEM) observation, samples were prepared with the method described by . Biofilms on the glass slides were fixed with 2.5% glutaraldehyde and dehydrated with graded ethanol (50, 70, 80, 90, and 100%). Subsequently the slides were freeze-dried, gold-coated, and then observed under SEM (Thermoscientific, Verios G4 UC).

Method used in confocal laser scanning microscopy (CLSM) observation was according to . Briefly, the dried samples were stained with acridine orange (0.1%) for 15min and excess dye was discarded. After being washed with PBS (pH 7.2), the slides were then fixed with paraformaldehyde (4%) for 15min in the dark and subsequently subjected to CLSM (Nikon, A1+ SIM-S). For each group, we randomly selected five areas for image analysis.

Quantitative Real-Time PCR Analysis

The quantitative real-time PCR (qRT-PCR) assay was carried out under the guidance of with slight modification. A. hydrophila SHAe 115 was grown in LB medium supplemented with or without esculetin (100μg/ml) at 37°C at 180rpm for 24h. After incubation, cells were washed with sterile PBS (pH 7.2) three times and collected after 10min centrifugation at 4°C. Total RNA was extracted from the bacterial cells using an RNA extraction kit (Biofit Biotechnologies, Chengdu, China) following the manufacturer’s instruction. Reverse transcript reaction was performed with a commercial reverse-transcription enzyme (Tsingke Biotechnology, Beijing, China) according to the manufacturer’s instruction. Quantitative real-time PCR was carried out with an ABI 7300 Plus real-time PCR system. The amplification was carried out in a 20μl reaction volume containing 2×T5 Fast qPCR Mix (SYBR Green I; 10μl, Tsingke Biotechnology, Beijing, China), primers (0.8μl of each), diluted cDNA (1μl), and ddH2O (7.4μl). The thermocycling conditions were as follows: incubation for 10min at 95°C, followed by denaturation for 15s at 95°C, annealing and extension at 60°C for 60s. PCR amplification consisting of 45cycles was conducted. All samples were run in triplicate. The primers used in this study were listed in Table 1 (). 16S rRNA served as an internal control (). The relative expression of target genes was calculated by the conventional 2−ΔΔCT method proposed by .

Table 1

GenePrimer directionSequence (5'−3')Amplicon size
litRForwardCATCGAGGTGTTCTCCCGTC
ReverseTCATCCACCAGCTCTTCACG123
csgABForwardTTGTTTCTGGTGGATCTGGATTA
ReverseGGCATTGAGCAGCACGGTA105
fleQForwardACTTCCCCAACAGCAACTTCA
ReverseCCTTGTCGTGGGTCTGTTGA126
fleNForwardCTATGACCGGCTTTTGCAGC
ReverseCCTACGACACCAATCTGCGA186
luxSForwardCAGACCCCGAACAAGGACAC
ReverseGCACCGATCAGGCTCATGTA206
ahyRForwardTCTTGACGTGATGGGGTTGG
ReverseGGCGGTGATGAACGACAGTA106
ahyIForwardCAGATGGGAGGTAGAAAACGAG
ReverseTGGGTATCAGGGGTATCGAAA123
16SForwardGCACAAGCGGTGGAGCATGTGG
ReverseCGTGTGTAGCCCTGGTCGTA299

PCR primers for quantitative real-time PCR.

Statistical Analysis

All of the experiments were performed in triplicate, and the data were presented as mean±standard deviation (SD). Statistical analysis was carried out with GraphPad Prism 8 software (San Diego, CA, United States). One-way ANOVA plus post-hoc Tukey test or two-tail paired t-test was used to evaluate the statistical significance between groups. The following terminology is used to denote the statistical significance: *p <0.05, **p <0.01, ***p <0.001.

Results and Discussion

Determination of MIC and Growth Inhibition Analysis

The MIC of esculetin evaluated by two-fold dilution was 200μg/ml. All the following experiments were conducted at sub-MICs (25, 50, and 100μg/ml). The bacterial cultures treated with esculetin at sub-MICs did not show any significant inhibitory effect on growth of A. hydrophila SHAe 115 compared with the control (Figure 1).

Figure 1

Inhibition of Hemolysin

As shown in Figure 2, esculetin has a significant inhibitory effect on the production of hemolysin of A. hydrophila SHAe 115 at sub-MICs. Compared to the DMSO control group, treatment with esculetin at 25, 50, and 100μg/ml caused reduction in hemolysin production of approximately 77, 86, and 87%, respectively.

Figure 2

Bleeding is a common phenomenon that A. hydrophila infects animals, and the hemolytic activity can be detected in vivo and in vitro. Hemolysin is considered to be the main virulence factor of A. hydrophila, so the role of hemolysin is highly valued (). The hemolysin is a single polypeptide molecule, it is one of the exotoxins (also known as aerolysin) produced by A. hydrophila. injected the exotoxin of A. hydrophila on rainbow trout and speckled trout, which caused disease in these fish. isolated β-hemolysin from a protease-deficient strain of A. hydrophila that can kill catfish. Most studies proved that aerolysin genes are highly conserved in Aeromonas spp. (; ; ), indicating that they play an important role in pathogenicity. Our results showed that esculetin significantly inhibited the hemolysin production of A. hydrophila SHAe 115, which proved that esculetin can effectively attenuate the pathogenicity of this bacteria.

Inhibition of Protease Activity

This assay was carried out to analyze the potential of esculetin in inhibiting the production of protease in A. hydrophila SHAe 115. Azocasein was used as the substrate. The obtained results indicated that the production of protease was significantly reduced. And the inhibitory ability of esculetin on protease increased with concentration. Protease production was inhibited in the level of 31, 41, and 46%, respectively, in groups supplied with esculetin at concentrations of 25, 50, and 100μg/ml.

Extracellular proteases () are one of the virulence factors of A. hydrophila. At present, metalloproteases and serine proteases are widely studied. They are widely present in A. hydrophila. Some extracellular proteases have direct pathogenicity, and some can activate other pathogenic factors. For example, the exotoxins secreted by A. hydrophila are in the form of an inactive precursor and require extracellular proteases to activate them (). In our study, as concentration increased, the inhibitory ability of esculetin on proteases gradually increased, as shown in Figure 3. On one hand, the reduction of protease activity can reduce the pathogenicity of A. hydrophila SHAe 115; on the other hand, the lack of protease activation of exotoxins (such as hemolysin) will also reduce the pathogenicity of the bacteria.

Figure 3

Inhibition of Swarming Motility

The swarming motility of A. hydrophila SHAe 115 was clearly visible in DMSO control (Figure 4A). However, on esculetin supplements at concentrations from 25 to 100μg/ml, the swarming motility of A. hydrophila SHAe 115 was repressed (Figures 4BD). And, the diameter of swarming zone decreased as the concentration increased. The bacteria exhibited a total swarming diameter of 24mm. When treated with esculetin at sub-MICs, the swarming diameter decreased to 16, 12, and 8mm, respectively, with an inhibition of 32, 48, and 66% (Figure 4E).

Figure 4

The swarming motility of bacteria has been characterized as flagellar-mediated motility which is regulated by QS system (; ). And the motility driven by flagellum played an import part in the pathogenicity of the bacteria. Previous studies have suggested that swarming motility can contribute to biofilm formation (). The swarming motility of A. hydrophila SHAe 115 was significantly inhibited by esculetin at sub-MICs (Figure 4). As shown in the figure, the diameters of swarming zone of the bacteria treated with esculetin were much smaller than that of the control, suggesting that esculetin had some inhibitory effects on the swarming motility of the bacteria. And the reason might be the interference of QS system in the pathogen caused by esculetin.

Inhibition of Biofilm Formation

As shown in Figure 5A, esculetin significantly inhibited the biofilm formation. As the concentration increased, the inhibitory activity of esculetin acted in a concentration-dependent manner. The biofilm inhibition rate was approximately 38, 60, and 79%, respectively, as the bacteria treated with esculetin at 25, 50, and 100μg/ml.

Figure 5

In addition to the quantitative analysis of the biofilm biomass with CV staining method, we also observed the development of biofilm structure through SEM and CLSM after incubation in the presence and absence of esculetin. SEM images showed that the biofilm was thick and dense in the DMSO control group (Figure 5Ba), while with esculetin at sub-MICs treatment, the biofilm was hindered and finally turned sparse as the concentration increased (Figure 5Bb–d). CLSM images also demonstrated similar results. After incubated in the presence of esculetin, the biofilm got sparser with the increased concentration and its thickness reduced from 16 to 11μm (Figures 5Ca–d).

Biofilms are microbial communities, in which bacterial cells are embedded in a self-generated matrix of lipids, exopolysaccharides (EPS), proteins, and nucleic acids that can block the entry of antimicrobial agents into cells (; ). Biofilms are closely related to the multi-drug resistance of many bacteria (). Therefore, destroying or inhibiting the formation of biofilm can be an effective way to attenuate the pathogenicity and drug resistance of bacteria. Our results suggested that esculetin significantly inhibited the biofilm formation of A. hydrophila SHAe 115, making it loose and sparse. The possible reason was that esculetin affected the synthesis of the matrix (such as EPS) composing the biofilm.

Effect of Esculetin on Gene Expression

The qRT-PCR assay was carried out to examine the effect of esculetin at 100μg/ml on changes in the gene expression of motility and biofilm formation. The results showed that ahyI, ahyR, luxS, csgAB, and fleQ were significantly downregulated and their expression levels were reduced by 32, 29, 39, 12, and 65%, respectively. While litR was upregulated, the expression level increased by 40%. Esculetin had no obvious effect on fleN (Figure 6).

Figure 6

According to the reports of and and , the ahyI/R genes in A. hydrophila are homologs of lasI/R that are responsible for regulating the AHL-mediated AI-1 QS system. They demonstrated that the ahyI/R system was mainly responsible for the QS-related virulence production and biofilm formation in A. hydrophila. After treatment with esculetin, the expression levels of ahyI and ahyR decreased, which interfered the AHL-mediated AI-1 QS system. As a result, the production of virulence factors related to this system and the biofilm formation were inhibited. litR gene in A. hydrophila is a homolog of hapR gene. This gene in Vibrio cholerae encodes HapR protein that can negatively regulate bacterial biofilm formation and EPS biosynthesis () by lowering the intracellular level of c-di-GMP (). Further, HapR can also negatively affect the transcription of vpsT, and the product of vpsT (VpsT) is a transcriptional activator required for the expression of EPS biosynthesis operon in V. cholerae (; ). While in A. hydrophila, the homologous gene of vpsT is csgAB (). The increase of litR and decrease of csgAB gene may affect the biosynthesis of EPS together, thereby affecting the formation of biofilm. FleQ, encoded by fleQ, is a master regulator of flagellar gene expression in P. aeruginosa (). FleN, encoded by fleN, is an anti-activator of FleQ which downregulates FleQ activity through direct interactions. reported that they found fleQ and fleN genes in A. hydrophila. Hence, the transcription of fleQ and fleN and interactions between FleQ and FleN play a crucial role in the motility of A. hydrophila. Another study of demonstrated that the luxS system also existed in the bacteria and it was mainly responsible for the motility. On one hand, the expression level of fleQ reduced, which affected the development of bacterial flagella. On the other hand, the expression level of luxS also reduced, and the inhibitory effect of esculetin on these two genes may jointly affect the motility of the bacteria.

Conclusion

The present study explored the inhibitory effect of esculetin on QS-related virulence factors and biofilm formation of A. hydrophila SHAe 115. The results showed that esculetin can significantly inhibit the production of hemolysin and protease, affect the swarming motility of A. hydrophila SHAe 115 at sub-MICs. They are all the main virulence factors of the bacteria. The formation of biofilm was also inhibited, the biofilm biomass decreased, and the biofilm structure turned thinner and sparser compared to the control group. qRT-PCR analysis indicated that genes positively related to motility and biofilm formation were downregulated to varying degrees, while gene (litR) negatively related to biofilm formation was significantly upregulated. The results of swarming motility and biofilm formation were in good agreement with gene expression analysis. Therefore, in combination with the activities against other pathogenic bacteria, esculetin has the potential to be a QS inhibitor.

Funding

This work was supported by grants from the National Natural Science Foundation of China (41766006).

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.

Author contributions

BS conceived and designed the experiments and also wrote the paper. BS and HL performed the experiments. BS, HL, HJ, and ZW analyzed the data. All authors contributed to the article and approved the submitted version.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2021.737626/full#supplementary-material

References

Summary

Keywords

quorum sensing, biofilm, esculetin, Aeromonas hydrophila SHAe 115, quantitative real-time PCR

Citation

Sun B, Luo H, Jiang H, Wang Z and Jia A (2021) Inhibition of Quorum Sensing and Biofilm Formation of Esculetin on Aeromonas Hydrophila. Front. Microbiol. 12:737626. doi: 10.3389/fmicb.2021.737626

Received

07 July 2021

Accepted

25 August 2021

Published

24 September 2021

Volume

12 - 2021

Edited by

Krassimira Hristova, Marquette University, United States

Reviewed by

Khristina Judan Cruz, Central Luzon State University, Philippines; Luchang Zhu, Houston Methodist Research Institute, United States

Updates

Copyright

*Correspondence: Aiqun Jia,

This article was submitted to Antimicrobials, Resistance, and Chemotherapy, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics