Abstract
A non-destructive approach based on magnetic in situ hybridization (MISH) and hybridization chain reaction (HCR) for the specific capture of eukaryotic cells has been developed. As a prerequisite, a HCR-MISH procedure initially used for tracking bacterial cells was here adapted for the first time to target eukaryotic cells using a universal eukaryotic probe, Euk-516R. Following labeling with superparamagnetic nanoparticles, cells from the model eukaryotic microorganism Saccharomyces cerevisiae were hybridized and isolated on a micro-magnet array. In addition, the eukaryotic cells were successfully targeted in an artificial mixture comprising bacterial cells, thus providing evidence that HCR-MISH is a promising technology to use for specific microeukaryote capture in complex microbial communities allowing their further morphological characterization. This new study opens great opportunities in ecological sciences, thus allowing the detection of specific cells in more complex cellular mixtures in the near future.
Introduction
In recent years, research in microbial ecology has truly taken off. This spectacular breakthrough is mainly due to rapid technological advances such as meta-omics, which have significantly increased our ability to study microbial communities from complex environments and their function in various ecosystems (; ; ; ). An ecosystem is a huge reservoir of yet uncharacterized biodiversity especially concerning microeucaryotes, which play a key role in ecology, for example in bacterial predation or recalcitrant organic matter degradation. Although detection of eukaryotic microorganisms in natural ecosystems using high-throughput sequencing is well documented (e.g., ; ; ), deciphering the microbial biodiversity in ecosystems and understanding the underlying complexity of a community’s structure and function remain important challenges.
As a long-standing technique, Fluorescent In Situ Hybridization (FISH) has been and still is widely used to visualize complete intact cells (for a clinical review see ; ). Several modifications have allowed the FISH procedure to be applied to different models and have inspired the development of many other techniques since the 1980s (; ; ; ). For instance, microsystems and fluorescence-based monitoring through powerful platforms can be used to separate and observe entire cell staining with simple diagnostic fluorescent dyes, especially when investigating the heterogeneity of cellular systems (). As a recently developed method, Fluorescent in situ DNA-hybridization chain reaction (HCR-FISH) may additionally offer the opportunity to overcome the main problem of FISH, i.e., low intensity of the signal, due to low rRNA content found in some environmental microorganisms (; ). However, cell isolation by FISH or HCR-FISH requires a coupling with flow cytometry, which can be used for some but not all environments. For example, unicellular microorganisms cannot be directly isolated from soils or sediments due to the presence of many mineral and calcareous impurities present in these environments.
Magnetophoresis-based separation is increasingly used as an alternative to fluorescent activated cell sorting (FACS) in various biomedical () and environmental applications (). Magnetic sorting devices are less sophisticated, more compact, and less expensive than FACS. Moreover, high gradient magnetic separation platforms or integrated micromagnets () have proven very effective in capturing cells with minimal labeling (i.e., cells labeled with nanoparticles carrying weak magnetic moments) ().
Recently, the magnetic procedure HCR-MISH (MISH = Magnetic in situ hybridization) has been proposed as a sensitive method for the isolation by direct magnetic capture of whole intact bacterial cells from complex environments, using a combination of in situ hybridization and HCR amplification (). The principle of HCR-MISH is to use a magnetic field to capture specific cells onto which superparamagnetic nanoparticles are attached by a nucleic acid probe (either DNA or RNA), the length of which is enlarged and amplified inside and outside the cell by HCR. In addition, micro-magnet arrays integrated in microfluidic channels are powerful tools to selectively extract magnetically labeled cells (). While the MISH technique has been till now successfully applied to the isolation of specific labeled bacterial cells (; ,; ), enlarging it to the isolation of eukaryotic cells will offer a real opportunity to describe the microeukaryotic diversity.
In MISH, long probes are used; obtained either from 23S RNA fragment synthesis (; ) or from a long artificial HCR-amplified DNA fragment. Due to the limited permeability of the cell wall, only part of the probe is linked to its intracellular target site (), while the remaining part is located outside the cell, which allows anchorage of magnetic nanoparticles on accessible biotinylated sites.
Here we describe a procedure that allows grafting of super-paramagnetic nanoparticles onto targeted micro-eukaryotic cells using yeast (Saccharomyces cerevisiae) as a model, exploiting magnetism for their subsequent isolation using a micro-magnet array. By applying HCR-MISH on an artificial mixture comprising prokaryotic and eukaryotic cells and by using a universal 18S eukaryotic probe, we selectively isolated the eukaryotic fraction, thus delivering a promising method usable to target eukaryotic microbial communities.
Materials and Methods
Strains and Culture
Saccharomyces cerevisiae BY4741 strain (MATa, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0) (Euroscarf) and Escherichia coli DH5α strain [F–endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG purB20 φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK–mK+), λ–] (Promega) were used as eukaryotic and bacterial cells, respectively, in the HCR-MISH experiments. Yeast cells were cultivated in YPG (yeast extract 10 gL–1, peptone 20 gL–1, and glucose 20 gL–1) at 30°C. Bacterial cells were grown in low salt Luria–Bertani Broth (Duchefa Biochemie) at 36°C. All microbial cells were cultivated with a 150 rpm-orbital shaker, thus providing active growing cells at the logarithmic growth phase.
Probe in silico Analysis
The universal eukaryotic probe used in this study was Euk516 antisense i.e., Euk516R 5′- ACCAGACTTGCCCTCC -3′ () targeting eukaryotic cells. This choice was based on previous work conducted on soils (). The specificity of the probe was tested in silico using the Silva SSU r138 database (4th December 2020, ).
Hybridization Chain Reaction-Magnetic in situ Hybridization Principle
The principle of the method involves the use of three DNA probes (Figure 1): an initiator probe and two DNA hairpin probes, referred to as H1 and H2 (). The initiator probe is composed of 5′–3′ of four sequences: (i) a 16 bp-long antisense sequence specific to the target 18S rRNA sequence, (ii) a short (5 bp-long) spacer sequence, and (iii) a sequence containing two (13 bp-long) A and B sequences which allow triggering the opening of the DNA hairpin of the H1 probe and subsequent self-assembly of the two amplifier probes H1 and H2 during HCR (Figure 1B) as shown in and modified for this study. The self-assembling of H1 and H2 sequences during HCR allows the creation of a long DNA fragment potentially crossing the cell, reaching a size of several thousand base pairs inside and outside the cell. As shown in Figure 1C, the H1 and H2 amplifier probes are biotinylated for subsequent attachment outside the cell of streptavidin-coated superparamagnetic nanoparticles. The different probe sequences are presented in Table 1. For this first proof of concept, we used as specific sequence the antisense of the universal eukaryotic primer Euk516R, targeting the 18S rRNA and rDNA of eukaryotes including yeasts (). The main steps of the protocol behind the use of HCR-MISH on whole eukaryotic cells consists in: (i) performing a cell fixation, to keep cell morphology, followed by an enzymatic treatment for partial yeast cell wall hydrolysis to allow probes to enter into the cell, (ii) hybridizing target genomic DNA and/or target RNA transcripts using the initiator probe, and (iii) carrying out a chain reaction of hybridization events introducing H1 and H2 probe amplifiers.
FIGURE 1
TABLE 1
| Names | Sequences (5′–>3′) |
| Euk516-MISH (with spacer) | CCGAATACAAAGCATCAACGACTAGAAAAAACCAGACTTGCCCTCC |
| H1 probe* | TCTAGTCGTTGATGCTTTGTATTCGGCGACAGATAACCGAATACAAAGCATC |
| H2 probe* | CCGAATACAAAGCATCAACGACTAGAGATGCTTTGTATTCGGTTATCTGTCG |
Sequences and probes used in the experiment.
∗: the H1 and H2 probes were 5′ labeled with biotin.
Hybridization Chain Reaction-Magnetic in situ Hybridization Hybridization
Active growing cells were harvested by centrifugation at 4000 g for 1 min and washed in sterile 1× PBS buffer (130 mM NaCl, 7 mM Na2HPO4, 3 mM NaH2PO4, pH 7.2). Then, either yeasts, bacterial cells or an appropriate ratio of eukaryotic/bacterial cells were fixed in 3% (w/v) extemporaneously prepared paraformaldehyde in 1× PBS solution for 1 h at 30°C, and then pelleted and washed at room temperature in 1× PBS buffer. Cell samples were then incubated in hybridization buffer (20 mM Tris–HCl, 0.9 M NaCl, 0.01% SDS, 50% (v/v) formamide) for 30 min at 30°C, washed and suspended in 1× PBS at room temperature. A partial yeast cell-wall hydrolysis was carried out by adding 10U zymolyase enzyme (Zymo Research), incubating for 15 min at 30°C and washing cells twice in 1× PBS buffer. Then cells were suspended in 100 μL hybridization buffer containing the initiator probe at 0.5 μM final concentration. Hybridization was performed at 37°C for at least 3 h. Cells were then washed twice in pre-warmed (55°C) 1× PBS buffer and suspended in 100 μL amplification buffer consisting of 50 mM Na2HPO4, 0.9 M NaCl and 0.01% (v/v) SDS. Prior to amplification, each H1 and H2 probe was denatured separately for 90 s at 95°C and then cooled for 30 min at room temperature. Next, the amplifying mix containing both the denatured biotinylated H1 and H2 probes was prepared as follows: H1 and H2 amplifier probes were mixed and added to the cell samples (for a final 2.5 μM concentration in the amplification buffer). HCR amplification lasted 2 h at 46°C. Afterward, samples were washed twice with ice-cold 1× PBS. Finally, 10 μL commercial streptavidin-coated superparamagnetic beads (Miltenyi Biotech, Streptavidin MicroBeads, diameter 50 nm, concentration not provided by the manufacturer) were added. After an overnight incubation at 4°C, cells were washed and suspended in 1× PBS. The HCR-MISH protocol is summarized in the Supplementary Table 1.
Staining and Microscopy
Cell suspension (100 μL) was stained by adding 0.2 μL of 0.1 mg.ml–1 ethidium bromide (EthBr) and incubating for 5 min at room temperature. Cells were washed in 1× PBS, harvested by centrifugation and re-suspended in 1× PBS. After 5 min, stained cells (10 μL) were deposited onto a micro-magnet array, integrated or not in a micro-fluidic device (see next section), and observed using a Zeiss Axio Imager equipped with a DsRed filter. Images were acquired using a Zeiss AxioCamMR3 camera and Axiovision software.
Micro-Magnet Array
A hard magnetic film of NdFeB was deposited on a Si wafer and patterned using thermo-magnetic patterning, as previously described (
Microchannel Bonding
The same PDMS mixture as described above was diluted with Heptane (Sigma-Aldrich) to obtain a 4% (w/w) PDMS solution. The dilute solution was spin-coated onto the magnet surface at 4500 rpm for 1 min (using a Spin 150, SPS-Europe) and baked at 80°C for a few hours to enable solvent evaporation and PDMS curing. The PDMS microchannel and the PDMS-coated substrate were then sealed together after exposing both surfaces to air plasma treatment (Expanded Plasma Cleaner, Harrick Plasma).
Flow Control Setup
A NE-4000 Multi-Phaser Double Syringe pump was used to control the flow rates. For this purpose, syringe needles were connected to PTFE tubing (1/32″ ID × 1/16″ OD) directly inserted into the PDMS port holes of 1.25 mm diameter.
Results
Probe in silico Analysis
The sequence Euk516R (
Hybridization Chain Reaction-Magnetic in situ Hybridization on Eukaryotic Cells
Limitation of in situ hybridization efficiency due to the structure of the cell wall is well known, as exemplified for bacteria (
FIGURE 2

Eukaryotic cell distribution patterns following HCR-MISH. Yeast cells from calibrated samples were subjected to complete treatment apart from incubation with superparamagnetic nanoparticles (10× magnification) (A). Yeast cells were in contact with just biotinylated probes (H1 and H2), in the absence of the initiator sequence (including the 18S probe) and then were placed on the micro-magnet array (10× magnification) (B). H1 probe was solely used, i.e., without H2, images show a few square patterns (20× magnification) (C). Complete treatment of HCR-MISH using both amplifiers and the specific probe 18S, the patterns obtained are far more distinct 10× (D). Same treatment as (D), but at higher magnification, yeast cells can be individually distinguished: 50× (E).
This last experiment revealed the feasibility of the HCR-MISH technique and that HCR amplification is essential for high efficiency of the technique, as it greatly improves the yeast cell capture yield. However, while above 82.8% of yeast cells were trapped on the magnetic chessboard, a small percentage remained un-trapped and randomly dispersed on the surface, probably because they were unlabeled or too weakly labeled. As shown in the video (Supplementary Video), cells can be trapped under continuous flow inside the microfluidic device, meaning that labeled cells can be separated from unlabeled ones: When the sample is injected in the device, only the target (magnetically functionalized) cells are trapped, while the rest of the mixture moves toward the device outlet. Then, as previously studied by our team (
Specificity of Eukaryotic Hybridization Chain Reaction-Magnetic in situ Hybridization Capture
The next step of our work aimed at testing the HCR-MISH specificity against other organisms, such as bacteria. This was investigated with an artificial cell mixture comprising the yeast S. cerevisiae, as the eukaryotic model cell, and the bacteria Escherichia coli, as the prokaryotic model organism, in different proportions (1:10, 1:30, and 1:100, respectively). All mixtures follow the same treatment. In a control experiment without the 18S rRNA gene specific initiator probe (Figure 3A), a random distribution of yeast and bacteria on the micro-magnet array was observed. On the other hand, after complete treatment, specific yeast cell attraction was visible on the micro-magnet array: the larger yeast cells followed the square patterns while the much smaller bacteria were randomly distributed. This was observed whatever the bacterial concentration used, 10 times higher than yeast or 30 times higher (as shown in Figure 3B). This demonstrated that in this experiment, cell attraction by HCR-MISH capture from a prokaryotic and eukaryotic cell mixture is yeast specific, even though bacteria were introduced in excess.
FIGURE 3

The eukaryotic HCR-MISH specificity as evaluated for target eukaryotic cells in an artificial mixture. E. coli cells were the control test without the specific 18S probe under 50× magnification (A) and with the 18S probe (B) using a concentration of bacteria 30 times higher than the yeast.
Discussion
The aim of this work was to provide a simple and cost-effective approach that can be used for trapping and fishing whole morphologically intact eukaryotic cells using magnetic nanoparticles with a specific universal eukaryotic probe. We demonstrated that this procedure can be used with microfluidic platforms. We focused on a combination of HCR-MISH with magnetic cell sorting using high performance micro-magnets integrated into microfluidic devices. In this study, we used S. cerevisiae eukaryotic cells as a model.
In eukaryotes, DNA probes coupled with magnetic nanoparticles have been largely employed to investigate different RNA with specific hybridization, with good results and great applications, but to our knowledge, this approach was dedicated only to lysed eukaryotic cells and not to complete cells, as in the present study (
Cells labeled by the method described here are morphologically intact but not viable due to the fixation step performed with paraformaldehyde, which aims at denaturing and achieving crosslinking of proteins. Nevertheless, the integrity of fixed cells is preserved and they remain genetically exploitable for subsequent morphological characterization and different genomic applications (
Cell or tissue isolation has been a first prerequisite to characterize cell function or genome specificity or to gain a deeper insight into cellular particularities or heterogeneities within populations, which are important requirements for an ecological understanding of microbial processes and for many other biological applications (
In our work we used the 18S rRNA probe, which is a generalist probe available to analyze the whole cells belonging to a specific clade in environments. Other probe functions or clade-specificity could be used to trap microeukaryotes belonging to a functional community. Future research should focus on the development and application of this technique on other eukaryotic cells and cell fishing from complex samples from different environments.
Conclusion
The present study reports a new method combining hybridization chain reaction and magnetic in situ hybridization for tracking and separating eukaryotic cells using commercial superparamagnetic nanoparticles. We show that yeast can be selectively trapped from an artificial mix of microorganisms. We have demonstrated static trapping and flow-based separation of eukaryotic-labeled cells. Since this approach was previously validated on bacteria by
This method will need further studies to adapt to each type and specificity of eukaryotic cells, but it provides a new tool to track cells without needing to lyse them, allowing the characterization of the whole cell by morphological analysis or whole genome single-cell sequencing. The combination of HCR and magnetic in situ hybridization shows great promise for environmental research, as it appears to be applicable to both bacteria (
Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Author contributions
FB acquired, analyzed, or interpreted the data for the work, and drafted the manuscript. ND provided the micro magnet arrays. MH analyzed or interpreted the data for the work and revised it critically for important intellectual content. DM and PS revised it critically for important intellectual content. MF-R and LF-T made substantial contributions to the conception or design of the work and revised it critically for important intellectual content. All authors contributed to the article and approved the submitted version.
Funding
This work was supported by Fédération de Recherche Biodiversité, Eau & Ville (FR BioEEnviS) from University of Lyon 1 and Centre National de Recherche Scientifique de France (CNRS).
Acknowledgments
We thank Laure Franqueville (Ecole Centrale from Lyon) for assistance during the work in Ecole Centrale de Lyon. We also thank Marc Lemaire and Claire Prigent-Combaret for their wise advice. This work has benefited from the expertise and facilities/funding of the platform DTAMB of FR3728 BioEEnViS (Villeurbanne, France).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2021.759478/full#supplementary-material
References
1
Ahmad KhanM. S.AlshehreiF.Al-GhamdiS. B.BamagaM. A.Al-ThubianiA. S.AlamM. Z. (2020). Virulence and biofilms as promising targets in developing antipathogenic drugs against candidiasis.Future Sci. OA6:FSO440. 10.2144/fsoa-2019-0027
2
AlamM. K.KoomsonE.ZouH.YiC.LiC. W.XuT.et al (2018). Recent advances in microfluidic technology for manipulation and analysis of biological cells (2007-2017).Anal. Chim. Acta104429–65. 10.1016/j.aca.2018.06.054
3
AlbadrA. A.CoulterS. M.PorterS. L.ThakurR. R. S.LavertyG. (2018). Ultrashort Self-Assembling Peptide Hydrogel for the Treatment of Fungal Infections.Gels4:48. 10.3390/gels4020048
4
AmannR. I.BinderB. J.OlsonR. J.ChisholmS. W.DevereuxR.StahlD. A. (1990). Combination of 16S rRNA-targeted oligonucleotide probes with flowcytometry for analyzing mixed microbial populations.Appl. Environ. Microbiol.561919–1925. 10.1128/aem.56.6.1919-1925.1990
5
BaillyJ.Fraissinet-TachetL.VernerM.-C.DebaudJ. C.LemaireM.Wésolowski-LouvelM.et al (2007). Soil eukaryotic functional diversity, a metatranscriptomic approach.ISME J.1632–642. 10.1038/ismej.2007.68
6
BarbiF.BragaliniC.VallonL.PrudentE.DubostA.Fraissinet-TachetL.et al (2014). PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high throughput sequencing.PLoS One9:e116264. 10.1371/journal.pone.0116264
7
BaumanJ. G.WiegantJ.BorstP.van DuijnP. (1980). A new method for fluorescence microscopical localization of specific DNA sequences by in situ hybridization of fluorochromelabelled RNA.Exp. Cell Res.128485–490. 10.1016/0014-4827(80)90087-7
8
BergG.RybakovaD.GrubeM.KöberlM. (2016). The plant microbiome explored: implications for experimental botany.J. Exp. Bot.67995–1002. 10.1093/jxb/erv466
9
Brehm-StecherB. F.JohnsonE. A. (2004). Single-cell microbiology: tools, technologies, and applications.Microbiol. Mol. Biol. Rev.68538–561. 10.1128/MMBR.68.3.538-559.2004
10
BussolatiG.AnnaratoneL.MedicoE.D’ArmentoG.SapinoA. (2011). Formalin Fixation at Low Temperature Better Preserves Nucleic Acid Integrity.PLoS One6:e21043. 10.1371/journal.pone.0021043
11
CalderonE. J.CushionM. T.XiaoL.Lorenzo-MoralesJ.MatosO.KaneshiroE. S.et al (2015). The 13th International Workshops on Opportunistic Protists (IWOP13).J. Eukaryot. Microbiol.62701–709. 10.1111/jeu.12221
12
CarpenterK.WeberP.DavissonM.Pett-RidgeJ.HavertyM.KeelingP. (2013). Correlated SEM, FIB-SEM, TEM, and NanoSIMS Imaging of Microbes from the Hindgut of a Lower Termite: methods for In Situ Functional and Ecological Studies of Uncultivable Microbes.Microsc. Microanal.191490–1501. 10.1017/S1431927613013482
13
DamonC.LehembreF.Oger-DesfeuxC.LuisP.RangerJ.Fraissinet-TachetL.et al (2012). Metatranscriptomics reveals the diversity of genes expressed by eukaryotes in forest soils.PLoS One7:e28967. 10.1371/journal.pone.0028967
14
DiezB.Pedros-AlioC.MassanaR. (2001). Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing.Appl. Environ. Microbiol.672932–2941. 10.1128/AEM.67.7.2932-2941.2001
15
DirksR. M.PierceN. A. (2004). Triggered amplification by hybridization chain reaction.Proc. Natl. Acad. Sci. U. S. A.10115275–15278. 10.1073/pnas.0407024101
16
Dumas-BouchiatF.ZaniniL. F.KustovM.DempseyN. M.GrechishkinR.HasselbachK.et al (2010). Thermomagnetically patterned micromagnets.Appl. Phys. Lett.96:102511. 10.1063/1.3341190
17
FrickmannH.ZautnerA. E.MoterA.KikhneyJ.HagenR. M.StenderH.et al (2017). Fluorescence in situ hybridization (FISH) in the microbiological diagnostic routine laboratory: a review.Crit. Rev. Microbiol.43263–293. 10.3109/1040841X.2016.1169990
18
GrumazC.HoffmannA.VainshteinY.KoppM.GrumazS.StevensP.et al (2020). Rapid Next-Generation Sequencing-Based Diagnostics of Bacteremia in Septic Patients.J. Mol. Diagn.22405–418. 10.1016/j.jmoldx.2019.12.006
19
HaridasV.ShahinR.VorobjevI. A.GoldfeldA. E.BartenevaN. S. (2017). Imaging flow cytometry analysis of intracellular pathogens.Methods11291–104. 10.1016/j.ymeth.2016.09.007
20
HiraokaS.YangC. C.IwasakiW. (2016). Metagenomics and bioinformatics in microbial ecology: current status and beyond.Microbes Environ.31204–212. 10.1264/jsme2.ME16024
21
HoltzM. D.HwangS. F.StrelkovS. E. (2018). Genotyping of Plasmodiophora brassicae reveals the presence of distinct populations.BMC Genomics19:254. 10.1186/s12864-018-4658-1
22
HongohY. (2011). Toward the functional analysis of uncultivable, symbiotic microorganisms in the termite gut.Cell. Mol. Life Sci.681311–1325. 10.1007/s00018-011-0648-z
23
JiaZ.DongY.XuH.WangF. (2021). Optimizing the hybridization chain reaction-fluorescence in situ hybridization (HCR-FISH) protocol for detection of microbes in sediments.Mar. Life Sci. Technol.3529–541. 10.1007/s42995-021-00098-8
24
KimI.ChoiG.-G.Won NamS.YangH.-M.ParkC. W.SeoB.-K.et al (2020). Enhanced removal of cesium by potassium-starved microalga, Desmodesmus armatus SCK, under photoheterotrophic condition with magnetic separation.Chemosphere252:126482. 10.1016/j.chemosphere.2020.126482
25
KooK. M.CarrascosaL. G.ShiddikyM. J. A.TrauM. (2016). Poly(A) Extensions of miRNAs for Amplification-Free Electrochemical Detection on Screen-Printed Gold Electrodes.Anal. Chem.882000–2005. 10.1021/acs.analchem.5b04795
26
LehembreF.DoillonD.DavidE.PerrottoP.BaudeJ.FoulonJ.et al (2013). Soil metatranscriptomics for mining eukaryotic heavy metal resistance genes.Environ. Microbiol.152829–2840. 10.1111/1462-2920.12143
27
LeonardL.BouarabChOuledB.DegraeveP.OulahalN. (2016). Recent Advances on Multi-Parameter Flow Cytometry to Characterize Antimicrobial Treatments.Front. Microbiol.7:1225. 10.3389/fmicb.2016.01225
28
LiR. D.WangQ.YinB. C.YeB. C. (2016). Enzyme-free detection of sequence-specific microRNAs based on nanoparticle-assisted signal amplification strategy.Biosens. Bioelectron.77995–1000. 10.1016/j.bios.2015.10.082
29
Loll-KrippleberR.FeriA.NguyenM.MaufraisC.YansouniJ.d’EnfertC.et al (2015). A FACS-optimized screen identifies regulators of genome stability in Candida albicans.Eukaryot. Cell14311–322. 10.1128/EC.00286-14
30
MorrisC. E.BardinM.BergeO.Frey-KlettP.FrominN.GirardinH.et al (2002). Microbial biodiversity: approaches to experimental design and hypothesis testing in primary scientific literature from 1975 to 1999.Microbiol. Mol. Biol. Rev.66592–616. 10.1128/MMBR.66.4.592-616.2002
31
MoterA.GöbelU. B. (2000). Fluorescence in situ hybridization (FISH) for direct visualization of microorganisms.J. Microbiol. Methods4185–112. 10.1016/S0167-7012(00)00152-4
32
MundraS.KjønaasO. J.MorgadoL. N.KrabberødA. K.RansedokkenY.KauserudH. (2021). Soil depth matters: shift in composition and inter-kingdom co-occurrence patterns of microorganisms in forest soils.FEMS Microbiol. Ecol.97:fiab022. 10.1093/femsec/fiab022
33
OsmanO.ToruS.Dumas-BouchiatF.DempseyN. M.HaddourN.ZaniniL. F.et al (2013). Microfluidic immunomagnetic cell separation using integrated permanent micromagnets.Biomicrofluidics7:54115. 10.1063/1.4825395
34
PangY.WangC.WangJ.SunZ.XiaoR.WangS. (2016). Fe3O4@Ag magnetic nanoparticles for microRNA capture and duplex-specific nuclease signal amplification based SERS detection in cancer cells.Biosens. Bioelectron.79574–580. 10.1016/j.bios.2015.12.052
35
PivetalJ.CiutaG.Frenea-RobinM.HaddourN.DempseyN. M.Dumas-BouchiatF.et al (2014a). Magnetic nanoparticle DNA labeling for individual bacterial cell detection and recovery.J. Microbiol. Methods10784–91. 10.1016/j.mimet.2014.09.006
36
PivetalJ.ToruS.Frenea-RobinM.HaddourN.CecillonS.DempseyN. M.et al (2014b). Selective isolation of bacterial cells within a microfluidic device using magnetic probe-based cell fishing.Sens. Actuators B Chem.195581–589. 10.1016/j.snb.2014.01.004
37
PlouffeB. D.MurthyS. K.LewisL. H. (2015). Fundamentals and application of magnetic particles in cell isolation and enrichment: a review.Rep. Prog. Phys.78:016601. 10.1088/0034-4885/78/1/016601
38
PruesseE.QuastC.KnittelK.FuchsB. M.LudwigW.PepliesJ.et al (2007). SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB.Nucleic Acids Res.357188–7196. 10.1093/nar/gkm864
39
RoyetD.DempseyN. M.SimonetP.Frenea-RobinM. (2018). A new magnetic cell fishing approach based on hybridization chain reaction: HCR-MISH.Sens. Actuators B. Chem.273126–132. 10.1016/j.snb.2018.05.150
40
SandaiD.TabanaY. M.El OuweiniA.AyodejiI. O. (2016). Resistance of Candida albicans Biofilms to Drugs and the Host Immune System.Jundishapur J. Microbiol.9:e37385. 10.5812/jjm.37385
41
SehnalL.Brammer-RobbinsE.WormingtonA. M.BlahaL.BisesiJ.LarkinI.et al (2021). Microbiome Composition and Function in Aquatic Vertebrates: small Organisms Making Big Impacts on Aquatic Animal Health.Front. Microbiol.12:567408. 10.3389/fmicb.2021.567408
42
StoffelsM.LudwigW.SchleiferK. (1999). rRNA probe-based cell fishing of bacteria.Environ. Microbiol.3259–271. 10.1046/j.1462-2920.1999.00032.x
43
SutcliffeB.HoseG. C.HarfordA. J.MidgleyD. J.GreenfieldP.PaulsenI. T.et al (2019). Microbial communities are sensitive indicators for freshwater sediment copper contamination.Environ. Pollut.2471028–1038. 10.1016/j.envpol.2019.01.104
44
WallnerG.AmannR.BeiskerW. (1993). Optimizing fluorescent in situ hybridization with rRNA-targeted oligonucleotide probes for flow cytometric identification of microorganisms.Cytometry14136–143. 10.1002/cyto.990140205
45
WangH.YuZ.LiG.YangZ. (2019). Diversified Chromosome Rearrangements Detected in a Wheat–Dasypyrum breviaristatum Substitution Line Induced by Gamma-Ray Irradiation.Plants8:175. 10.3390/plants8060175
46
WatamotoT.SamaranayakeL. P.EgusaH.YataniH.SeneviratneC. J. (2011). Transcriptional regulation of drug-resistance genes in Candida albicans biofilms in response to antifungals.J. Med. Microbiol.601241–1247. 10.1099/jmm.0.030692-0
47
YamaguchiT.KawakamiS.HatamotoM.ImachiH.TakahashiM.ArakiN.et al (2015). In situ DNA-hybridization chain reaction (HCR): a facilitated in situ HCR system for the detection of environmental microorganisms.Environ. Microbiol.172532–2541. 10.1111/1462-2920.12745
48
YuQ.ZhangY. M.LiuY. H.XuX.LiuY. (2018). Magnetism and photo dual-controlled supramolecular assembly for suppression of tumor invasion and metastasis.Sci. Adv.4:eaat2297. 10.1126/sciadv.aat2297
49
YuanY. H.WuaY. D.ChiaB. Z.WenaS. H.LiangaR. P.QiuaJ. D. (2017). Simultaneously electrochemical detection of microRNAs based on multifunctional magnetic nanoparticles probe coupling with hybridization chain reaction.Biosens. Bioelectron.97325–331. 10.1016/j.bios.2017.06.022
50
ZhangS.LiuR.XingZ.ZhangS.ZhangX. (2016). Multiplex miRNA assay using lanthanide-tagged probes and the duplex-specific nuclease amplification strategy.Chem. Commun.5214310–14313. 10.1039/C6CC08334J
51
ZhuN.ZhangB.YuQ. (2020). Genetic Engineering-Facilitated Coassembly of Synthetic Bacterial Cells and Magnetic Nanoparticles for Efficient Heavy Metal Removal.ACS Appl. Mater. Interfaces1222948–22957. 10.1021/acsami.0c04512
52
ZillerA.YadavR. K.CapdevilaM.ReddyM. S.VallonL.MarmeisseR.et al (2016). Metagenomics analysis reveals a new metallothionein family: sequence and metal-binding features of new environmental cysteine-rich proteins.J. Inorg. Biochem.1671–11. 10.1016/j.jinorgbio.2016.11.017
53
ZwirglmaierK.LudwigW.SchleiferK.-H. (2003). Improved Fluorescence in situ Hybridization of Individual Microbial Cells Using Polynucleotide Probes: the Network Hypothesis.Syst. Appl. Microbiol.26327–337. 10.1078/072320203322497356
Summary
Keywords
eukaryotic cells, magnetic nanoparticles, Saccharomyces cerevisiae, magnetic in situ hybridization, HCR, cell fishing
Citation
Bastian F, Melayah D, Hugoni M, Dempsey NM, Simonet P, Frenea-Robin M and Fraissinet-Tachet L (2021) Eukaryotic Cell Capture by Amplified Magnetic in situ Hybridization Using Yeast as a Model. Front. Microbiol. 12:759478. doi: 10.3389/fmicb.2021.759478
Received
16 August 2021
Accepted
11 October 2021
Published
01 November 2021
Volume
12 - 2021
Edited by
Shiying He, Jiangsu Academy of Agricultural Sciences (JAAS), China
Reviewed by
Qilin Yu, Nankai University, China; Nuno F. Azevedo, University of Porto, Portugal
Updates

Check for updates
Copyright
© 2021 Bastian, Melayah, Hugoni, Dempsey, Simonet, Frenea-Robin and Fraissinet-Tachet.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Fabiola Bastian, fabiola.bastian@univ-lyon1.fr
‡These authors have contributed equally to this work
†ORCID: Fabiola Bastian, orcid.org/0000-0002-1685-7530; Mylène Hugoni, orcid.org/0000-0002-2430-1057; Laurence Fraissinet-Tachet, orcid.org/0000-0003-0073-8761
This article was submitted to Microbiotechnology, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.