ORIGINAL RESEARCH article

Front. Microbiol., 08 April 2022

Sec. Virology

Volume 13 - 2022 | https://doi.org/10.3389/fmicb.2022.797463

A Comprehensive Analysis of Citrus Tristeza Variants of Bhutan and Across the World

  • 1. Plant Virology Laboratory, ICAR-Central Citrus Research Institute, Nagpur, India

  • 2. Whitney Laboratory for Marine Biosciences, University of Florida, St. Augustine, FL, United States

  • 3. National Citrus Program, Department of Agriculture, Royal Government of Bhutan, Thimpu, Bhutan

  • 4. Department of Plant Pathology, Indian Agricultural Research Institute, New Delhi, India

Abstract

Mandarin orange is economically one of the most important fruit crops in Bhutan. However, in recent years, orange productivity has dropped due to severe infection of citrus tristeza virus (CTV) associated with the gradual decline of citrus orchards. Although the disease incidence has been reported, very limited information is available on genetic variability among the Bhutanese CTV variants. This study used reverse transcription PCR (RT-PCR) to detect CTV in collected field samples and recorded disease incidence up to 71.11% in Bhutan’s prominent citrus-growing regions. To elucidate the extent of genetic variabilities among the Bhutanese CTV variants, we targeted four independent genomic regions (5′ORF1a, p25, p23, and p18) and analyzed a total of 64 collected isolates. These genomic regions were amplified and sequenced for further comparative bioinformatics analysis. Comprehensive phylogenetic reconstructions of the GenBank deposited sequences, including the corresponding genomic locations from 53 whole-genome sequences, revealed unexpected and rich diversity among Bhutanese CTV variants. A resistant-breaking (RB) variant was also identified for the first time from the Asian subcontinent. Our analyses unambiguously identified five (T36, T3, T68, VT, and HA16-5) major, well-recognized CTV strains. Bhutanese CTV variants form two additional newly identified distinct clades with higher confidence, B1 and B2, named after Bhutan. The origin of each of these nine clades can be traced back to their root in the north-eastern region of India and Bhutan. Together, our study established a definitive framework for categorizing global CTV variants into their distinctive clades and provided novel insights into multiple genomic region-based genetic diversity assessments, including their pathogenicity status.

Introduction

Tristeza, caused by the citrus tristeza virus (CTV), is a destructive disease affecting citrus plants. Over the past few decades, tristeza has damaged millions of productive citrus trees worldwide (; ; ). Bhutan is a small landlocked Himalayan country located between India and China, and is the likely place of origin of citrus (). Diverse agro-climatic conditions are prevalent in the country, favoring the production of a wide range of horticultural crops, among which the citrus is the most important fruit crop (). Mandarin (Citrus reticulata Blanco) is a widely grown citrus cultivar in 17 out of the 20 districts, constituting more than 95% of the total citrus grown in Bhutan (; ). The prominent mandarin-growing geographical regions are Tsirang, Dagana, Zhemgang, and Sarpang (; ). However, the citrus productivity in these regions is very low because of several factors, including infection of virus and virus-like pathogens. Among these pathogens, CTV is considered a major pathogen responsible for reducing the citrus yield and quality and decline of fruit-bearing citrus groves in Bhutan ().

Local transmission of the virus within a citrus groove is by aphid species, such as Aphis gossypii Glover, Aphis (Toxoptera) citricidus Kirkaldy, and Aphis spiraecola Patch, in a semi-persistent manner, whereas transmission into a new geographical area or country occurs through the movement of infected budwood during nursery propagation (; ; ). CTV is a phloem-limited virus having long flexuous filamentous particles of 2,000 × 11 nm in size and belongs to the genus Closterovirus under the family Closteroviridae. The single-stranded positive-sense RNA genome of ∼19.3 kb organized into 12 open reading frames (ORFs), which potentially encode 19 different proteins, and two untranslated regions (UTRs) located at the 5′ and the 3′ terminal (; ; ; ). The 5′ proximal ORF1a encodes a 349-kDa polyprotein that includes two cysteine papain proteins-like (PRO) domains, a methyltransferase-like (MT) and helicase-like (HEL) domains, and ORF1b encodes an RNA-dependent RNA polymerase (RdRp)-like domain. The 3′ genomic region of CTV consists of 10 ORFs (ORFs 2–11) that encode different proteins with diverse functions, namely, major (CP) and minor (CPm) coat proteins, p65 (a homolog of cellular HSP 70 proteins), and p61 that is required for virion assembly and movement along with the hydro-phobic p6 protein (; ; ; ). Additionally, the p20 and p23 proteins function as suppressors of the host RNA silencing along with CP (), and three genes (p33, p18, and p13) are needed for systemic infection and play a role in extending the virus–host range (, ). There are numerous biological strains of CTV (; ) that infect almost all commercial citrus species and induce a wide variety of symptoms including stem pitting, vein clearing, stunting, veins corking, chlorosis, leaf cupping, and slow or quick decline (, ; ,; ). The expression of symptoms in field-infected plants depends on the type of host, virus strain, rootstock–scion combination, age of the citrus tree, and environmental conditions (; ). Biological indexing has been used as a classical method of detecting CTV for years, but it has certain limitations. Other techniques that have been used for CTV detection are enzyme-linked immunosorbent assay (ELISA) (; ), dot immunobinding assay (DIBA), and immunoelectron microscopy (IEM) with polyclonal or monoclonal antibodies (). However, the serological methods are not used extensively because they require a supply of good quality antisera.

Electron microscopy is another powerful technique, but it is very expensive, requires highly skilled personnel, and cannot distinguish viruses of similar size. However, the most sensitive virus detection methods that are being routinely used at present in different laboratories include reverse transcription polymerase chain reaction (RT-PCR) (), quantitative PCR (qPCR) (; ), multiplex RT-PCR (), and RT-LAMP (; ). Recently, a rapid, sensitive, robust, reliable, and highly specific reverse transcription recombinase polymerase amplification technique coupled with a lateral flow immunochromatographic assay (CTV-RT-RPA-LFICA) has been developed for early detection of CTV (). Apart from complete genome sequencing (), the genetic diversity of CTV has also been determined based on different genomic regions by several researchers (; ). The phylogenetic analysis of CTV isolates using 5′ORF1a genomic region (; ), coat protein region (p25) (), RNA binding protein gene (p23) (; ), and p18 gene has also been reported (). The major focus of our study was molecular detection, characterization, and determination of the genetic diversity of 64 CTV isolates based on sequence variations of four (5′ORF1a, p25, p23, and p18 gene) different genomic regions. The targeted regions span most of the CTV genome, and each region plays a specific role; for example, the highly variable region ORF1a encodes a polyprotein of MT, and HEL domains, p25 covers 95% coat protein, p23 plays a role as a major suppressor, and p18 is involved in systemic infection for extending the virus–host range.

Thus, we selected these four regions for a comprehensive analysis of CTV variants by comparing them with whole-genome sequences across the globe. By comparing the 64 CTV isolates along with the published and unpublished sequences deposited in the GenBank, we have shown that the Bhutanese isolates could be unambiguously classified under six (except for T30) of seven (RB, T36, T30, T3, T68, VT-B, and HA16-5) internationally recognized and two additional clades (B1 and B2) identified in this analysis. Our analysis provides a comprehensive framework and a thorough picture of the global categorization of the CTV isolates and their origin.

Materials and Methods

Plant Acquisition and Virus Maintenance

Leaves and twigs from 90 citrus plants suspected of being infected by CTV were collected from different geographical regions of eight (Tsirang, Wangdue Phodrang, Punakha, Trashiyangste, Zhemgang, Dagana, Sarpang, and Chukha) districts of Bhutan (Figures 1, 2A and Table 1). These samples were assayed for CTV using conventional RT-PCR, as reported earlier by . We also used the biological indexing technique to test representative samples of each district. This was done by side and wedge grafting in 10–12 months old seedlings of acid lime (Citrus aurantifolia) that were maintained in an insect-proof screen house at the Indian Council of Agricultural Research-Central Citrus Research Institute (ICAR-CCRI) Nagpur, India.

FIGURE 1

FIGURE 2

TABLE 1

Sr. noSample codeCitrus cultivarBotanical nameLocationSymptomsTarget genomic region of CTV
5′ORF 1ap25p23p18
1Bhu-Ts-1Local mandarinCitrus reticulataTsirangYL++++
2Bhu-Ts-2Local mandarinCitrus reticulataTsirangYL, Chl++++
3Bhu-Ts-3Local mandarinCitrus reticulataTsirangD, YL, PG++++
4Bhu-Ts-4Local mandarinCitrus reticulataTsirangD++++
5Bhu-Ts-5Local mandarinCitrus reticulataTsirangYL++++
6Bhu-Ts-6Local mandarinCitrus reticulataTsirangVC, Chl, St++++
7Bhu-Ts-7Local mandarinCitrus reticulataTsirangAH++++
8Bhu-Ts-8Local mandarinCitrus reticulataTsirangD++++
9Bhu-Ts-9Local mandarinCitrus reticulataTsirangD++++
10Bhu-Ts-10Local mandarinCitrus reticulataTsirangD++++
11Bhu-Ts-11Shemjong limeCitrus aurantifoliaTsirangPG, Chl++++
12Bhu-Ts-12TeishuponkanCitrus poonensisTsirangVCc, Chl++++
13Bhu-Ts-13TarkuCitrus reticulataTsirangVC, VF, Chl++++
14Bhu-Ts-14FortunellaCitrus japonicaTsirangD, St++++
15Bhu-Ts-15DorokhamandarianCitrus reticulataTsirangD, VC. VF++++
16Bhu-Ts-1627/28Citrus reticulataTsirangChl, St++++
17Bhu-Ts-17OkitsuwaseCitrus sinensisTsirangChl, D++++
18Bhu-Ts-18OthaponkanCitrus poonensisTsirangVC, VF, Chl, St++++
19Bhu-Ts-19YushidaponkanCitrus poonensisTsirangD, Chl++++
20Bhu-Ts-20ClementineCitrus clementinaTsirangD, VC++++
21Bhu-Ts-21Local mandarinCitrus reticulataTsirangAH
22Bhu-Ts-22Local mandarinCitrus reticulataTsirangChl, D, PG++++
23Bhu-Ts-23CaracaraCitrus sinensisTsirangChl, VC++++
24Bhu-Ts-24CitronCitrus medicaTsirangPG, D, VC++++
25Bhu-Ts-25Local mandarinCitrus reticulataTsirangAH
26Bhu-Ts-26Local mandarinCitrus reticulataTsirangChl, D, VC++++
27Bhu-Ts-27Local mandarinCitrus reticulataTsirangPG, Chl++++
28Bhu-Ts-28Local mandarinCitrus reticulataTsirangChl, PG, VC++++
29Bhu-Ts-29Local mandarinCitrus reticulataTsirangPG, Chl++++
30Bhu-Ts-30Local mandarinCitrus reticulataTsirangVC, VF, Chl, St++++
31Bhu-Ts-31PomeloCitrus grandisTsirangYL
32Bhu-Da-32Local mandarinCitrus reticulataDaganaD, YL++++
33Bhu-Da-33Rangpur limeCitrus limoniaDaganaAH
34Bhu-Da-34Local mandarinCitrus reticulataDaganaD, YL++++
35Bhu-Da-35Rangpur limeCitrus limoniaDaganaAH
36Bhu-Da-36Local mandarinCitrus reticulataDaganaYL++++
37Bhu-Da-37Rangpur limeCitrus limoniaDaganaChl, YL++++
38Bhu-Da-38Local mandarinCitrus reticulataDaganaYL, Chl++++
39Bhu-Ts-39Local mandarinCitrus reticulataTsirangAH
40Bhu-Ts-40Hayaka,Citrus reticulataTsirangAH, Chl++++
41Bhu-Ts-41Berti pomeloCitrus grandisTsirangAH
42Bhu-Ts-42HayakaCitrus reticulataTsirangD++++
43Bhu-Ts-43Local T-13Citrus reticulataTsirangAH
44Bhu-Ts-44ClementineCitrus reticulataTsirangYL, D++++
45Bhu-Ts-45SalustianaCitrus sinensisTsirangVL, St++++
46Bhu-Ts-46Local mandarinCitrus reticulataTsirangYL
47Bhu-Ts-47Otsu-4Citrus reticulataTsirangYL, VC++++
48Bhu-Ts-48Ichang papedaCitrus ichangensisTsirangYL, VC, Chl++++
49Bhu-Ts-49RyanCitrus sinensisTsirangAH
50Bhu-Ts-50Narng mandarinCitrus reticulataTsirangAH
51Bhu-Ts-51Dagana mandarinCitrus reticulataTsirangVC, Chl++++
52Bhu-Ts-52Samtse mandarinCitrus reticulataTsirangAH
53Bhu-Ts-53Khengkhar mandarinCitrus reticulataTsirangYL, St, VF++++
54Bhu-Ts-54Tsirang mandarinCitrus reticulataTsirangVC, VF,++++
55Bhu-Ts-55Jongkhar mandarinCitrus reticulataTsirangVF, Chl,++++
56Bhu-Ts-56Shumar mandarinCitrus reticulataTsirangChl, St++++
57Bhu-Ts-57Chukha mandarinCitrus reticulataTsirangAH
58Bhu-Wa-58Local mandarinCitrus reticulataWangdue PhodrangAH
59Bhu-Wa-59PomeloCitrus grandisWangdue PhodrangYL
60Bhu-Wa-60EurakaCitrus limonWangdue PhodrangVC, VF, Chl++++
61Bhu-Wa-61GrapefruitCitrus paradisiWangdue PhodrangAH
62Bhu-Wa-62MandarinCitrus reticulataWangdue PhodrangVC, VF,++++
63Bhu-Wa-63MandarinCitrus reticulataWangdue PhodrangChl, PG++++
64Bhu-Pu-64Local mandarinCitrus reticulataPunakhaAH
65Bhu-Tr-65Local mandarinCitrus reticulataTrashiyangtseAH
66Bhu-Tr-66Local mandarinCitrus reticulataTrashiyangtseVC, VF++++
67Bhu-Tr-67Local mandarinCitrus reticulataTrashiyangtseAH
68Bhu-Zh-68Local mandarinCitrus reticulataZhemgangVC, VF, Chl, PG++++
69Bhu-Zh-69Local mandarinCitrus reticulataZhemgangYL, VC++++
70Bhu-Zh-70Local mandarinCitrus reticulataZhemgangD, PG++++
71Bhu-Zh-71Local mandarinCitrus reticulataZhemgangD, St++++
72Bhu-Zh-72Local mandarinCitrus reticulateZhemgangVC, VF++++
73Bhu-Zh-73Local mandarinCitrus reticulataZhemgangAH
74Bhu-Da-74Local mandarinCitrus reticulataDaganaAH
75Bhu-Da-75Local mandarinCitrus reticulataDaganaD, PG++++
76Bhu-Da-76Local mandarinCitrus reticulataDaganaPG, Chl, VC++++
77Bhu-Sa-77Local mandarinCitrus reticulataSarpangAH
78Bhu-Sa-39Local mandarinCitrus reticulataSarpangD, Chl++++
79Bhu-Sa-79Local mandarinCitrus reticulataSarpangD, PG++++
80Bhu-Sa-80Local mandarinCitrus reticulataSarpangVC, VF++++
81Bhu-Sa-81Local mandarinCitrus reticulataSarpangPG, YL++++
82Bhu-Sa-82Local mandarinCitrus reticulataSarpangYL, VC++++
83Bhu-Sa-83Local mandarinCitrus reticulataSarpangAH
84Bhu-Sa-84Local mandarinCitrus reticulataSarpangAH
85Bhu-Ch-85Dorokha mandarinCitrus reticulataChukhaChl, YL++++
86Bhu-Ch-86Wangkhartshalv-ICitrus reticulataChukhaAH
87Bhu-Ch-87WangkhartshalvngamCitrus reticulataChukhaVC, VF, Chl, St++++
88Bhu-Ch-88WangkhartshalvngamCitrus reticulataChukhaAH
89Bhu-Ch-89Satsuma manadarinCitrus reticulataChukhaPG, Chl, D++++
90Bhu-Ch-90Lemon eurakaCitrus limonChukhaVC, Chl++++
Total no of positive samples (disease incidence)64 (71.11%)

Details of samples collected from different geographical regions of Bhutan and presence or absence of citrus tristeza virus (CTV) tested by RT-PCR.

Chl, Chlorosis; AH, Apparently healthy; D, Declined; YL, Yellow leaves; PG, Poor growth; VC, Vein clearing; VF, Vein flecking; St, Stunting; +, CTV positive sample; –, CTV negative sample.

Sample Processing and RNA Extraction

Symptomatic leaves from all collected samples were thoroughly washed with double-distilled water, wiped with 70% ethanol to avoid surface contamination, and blot dried. Midrib portions of the leaves were excised and ground in liquid nitrogen. Approximately 100 mg of ground sample was used for total RNA extraction using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) as per the manufacturer’s protocol. The extracted RNA was dissolved into the Tris-EDTA (TE) buffer and stored at −80°C for further analysis. The concentration of total genomic RNA was assessed by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Delaware, United States), and quality was determined by 2% agarose gel, stained with 0.5 μg/ml of ethidium bromide, and visualized in a Gel documentation system (G: Box, Syngene, Frederick, United States).

Primer Designing

Primers were designed against the CTV-targeted genomic locations of 5′ORF1a, p25, p23, and p18 using primer 3v.0.4.0 tool.1 Primer specificity was then checked using primer BLAST software at National Center for Biotechnology Information (NCBI)2 to avoid cross-reaction with other pathogens or targets. The primers were finally custom synthesized from IDT (Integrated DNA Technologies, Coralville, IA, United States) (Table 2).

TABLE 2

Sr. noPrimer codeSequenceAnnealing temp.Amplicons sizeTarget genomic regionsReferences
1488F
491R
5′ TGTTCCGTCCTGSGCGGAAYAATT 3′
5′ GTGTARGTCCCRCGCATMGGAACC 3′
58°C404 bp5′ ORF 1a
2CN150
CN151
5′ATATATTTACTCTAGATCTACCATGGACGACGAAACAAA 3′
5′ GAATCGGAACGCGAATTCTCAACGTGTTAAATTTCC 3′
61°C672 bpp25
3RBP-23F
RBP-23R
5′ ATGAACGATACTAGCGGAC 3′
5′ GATGAAGTGGTGTTCACGG 3′
52°C627 bpp23
4AR18F
AR18R
5′ ATGTCAGGCAGCTTGGGAAATT 3′
5′ TTCGTGTCTAAGTCRCGCTAAACA 3′
62°C511 bpP18

Details of the primers used in the present study.

Establishing Citrus Tristeza Virus Culture Confirmation by RT-qPCR and Electron Microscopy

Total RNA extracted from graft-inoculated samples were used for RT-qPCR assay using CTV-specific primer–probe combination (P25-F/p25-R) and corresponding CTV-FAM probe [labeled with 6-carboxy-fluorescein (FAM) reporter dye at the 5′ terminus and the Black Hole Quencher (BHQ)-1 dye at the 3′ terminus]. The TaqMan-qPCR assay for CTV was performed using a StepOne Real-Time PCR System (Applied Biosystems) in two steps as described by with the following conditions: 95°C for 2 min (initial denaturation), followed by 40 cycles at 95°C for 15 s, annealing, and primer extension simultaneously for 1 min at 60°C. All experimental reactions were conducted in triplicate along with non-template controls (NTC), and the data were analyzed using StepOne Software v2.1. Furthermore, the graft-inoculated samples were also tested by electron microscopy in leaf dip preparation as reported by .

Detection of Citrus Tristeza Virus in Field Samples Using Conventional RT-PCR

The total genomic RNA extracted from the leaves of CTV-suspected samples were used to perform RT-PCR in two steps with CTV 5′ORF1a gene-specific primer set, 488F/491R (; ). In the first step, cDNA was synthesized in a 15 μl reaction volume. The reaction contained 1× first-strand buffer, 0.5 mM deoxyribonucleotide triphosphates (dNTPs) (Promega, Madison, United States), 15.6 U of RNAsin (Promega, Madison, United States), 0.4 μM reverse primer (491R), 6 μl of total RNA, and 120 units of M-MLV reverse transcriptase (Promega, Madison, United States). The reaction was carried out in a thermal cycler (Bio-Rad 100 Thermal Cycler, California, United States) with extension at 42°C for 50 min and denaturation at 72°C for 10 min. In the second step, a 1.75 μl aliquot of cDNA was used as a template in a 25 μl reaction mixture containing 1× PCR buffer, 0.2 μM of each primer (488F/491R), 0.2 mM of the dNTPs mix, 1.5 mM MgCl2, and 1.25 U of GoTaq DNA polymerase (Promega, Madison, United States). The amplification was with one cycle of 3 min at 94°C followed by 35 cycles of 0.30 min at 94°C, 0.45 min at 58°C, 1 min at 72°C, and final extension for 10 min at 72°C. The amplified RT-PCR products of the 5′ORF 1a fragment were analyzed on 1.2% agarose gel. Three more genomic regions of CTV, viz., p25, p23, and p18 genes were also used for detection and molecular characterization of CTV isolates. The primer pairs specific for p25 (CN150/CN151) (), p23 (RBP-23F/RBP-23R) (), and p18 (AR18F/AR18R) () were used to perform the RT-PCR (Table 2). The amplification program for the p25, p23, and p18 genes were the same as described above with modifications in annealing time and temperature, i.e., 0.45 min at 61°C for p25, 0.40 min at 52°C for p23, and 0.35 min at 62°C for p18 gene. The amplified RT-PCR products were analyzed on 1.2% agarose gel.

Nucleotide Sequence Analysis of the 5′ and 3′-Terminal Regions of Citrus Tristeza Virus Genome

The amplified products of four genomic regions were excised and eluted from the agarose gel using the GenElute Gel Extraction Kit (Sigma-Aldrich, Bengaluru, India) and sequenced from both ends DNA sequencing facility (Eurofins Genomics, Bengaluru, India). The forward and reverse sequences were assembled into one complete contig of the target gene and eliminated the repeated sequences. To assess the sequence similarity, the prepared contigs were analyzed by the basic local alignment search tool (BLAST) of the NCBI. The confirmed nucleotide sequences were translated using the online software EXPASY translate tool.3 Sequence similarities of proteins were identified using the BLASTp. Assembled sequences of each gene were then deposited into GenBank using BankIt-NCBI-NIH software.4 Assembled nucleotide sequences of the four genomic regions were further used to analyze genetic variations biostatistically and pair-wise identity using GeneDoc software among the CTV isolates ().

Sequence Retrieval, Extraction of Genomic Location, Sequence Alignment, and Phylogeny Reconstruction

Depending on the amino acids or nucleotide sequences, Blastp, TBlastn, or Blastn searches were performed with the default parameters using 5′ORF1a, p25, p23, and p18 as a query against all GenBank deposited sequences, including the whole-genome tristeza sequences available at the NCBI. Along with the GenBank deposited CTV variants, a total of 53 whole-genome CTV nucleotide sequences were retrieved and downloaded, and local standalone BLAST () searches were performed against the retrieved genomic sequences. In local BLAST searches, the amino acid sequences of 5′ORF1a, p23, p18, and p25 were again used as a query against the whole-genomes CTV sequences in Tblastn searches to identify the corresponding amino acid sequences. The whole-genome nucleotide sequence was then translated in three frames at https://www.bioinformatics.org/sms2/trans_map.html, and the nucleotide sequence of the corresponding genomic region encoded by these proteins was extracted manually. Individual DNA and the protein sequences against these four genomic regions extracted for a particular isolate from the whole-genome sequences along with all other retrieved sequences from NCBI are presented in Supplementary Excel File 1 and freely available for download. A novel phylogenetic reconstruction approach was then used in this analysis using the concatenated nucleotides and protein sequences of the four genomic regions of the Bhutanese variants and the GenBank deposited sequences. Due to high sequence similarities at the protein level, the phylogeny was performed using the corresponding DNA sequences to determine the greater sequence variations due to the presence of both synonymous (mutations in the codon that do not change the amino acids) and non-synonymous (mutations that alter the amino acids) changes. Both the amino acid and nucleotide sequences were aligned in MUSCLE (), and maximum likelihood (ML) trees were inferred using PhyML v3.0 (; ), with the best-fit evolutionary model identified using the Akaike information criterion (AIC) criterion estimated by ProtTest (). The JTT substitution matrix was used for the amino acid sequences and the GTR substitution model for the nucleotide sequences while estimating the tree topology, branch lengths, amino acid equilibrium frequencies, fraction of invariable sites, and discrete-gamma distributed substitution rates. Clade support was calculated using the SH-like approximate likelihood ratio test (). The resulting phylogenetic trees were viewed online and edited with iTol version 2.0 (). The vector graphics file was then imported onto Adobe Illustrator version CS6 for editing and final exporting of the high-resolution picture for publication.

Results

Symptomatology, Bioassay, RT-qPCR, and Electron Microscopy

During field surveys in the different districts of Bhutan (Figure 2A), citrus trees showed the typical characteristic of tristeza symptoms, specifically chlorosis, yellow leaves, leaf cupping, vein clearing, vein flecking, declined condition, poor growth, and vigor. Stunting in diverse species was also observed, for instance, in mandarin (Citrus reticulata), pomelo (Citrus grandis), lime (Citrus aurantifolia), citron (Citrus medica), and other citrus cultivars or hybrids. However, few citrus trees found seemed to be healthy (Table 1). We performed Koch’s postulate successfully for CTV in acid lime indicator plants. The virus-inoculated plants developed vein clearing, leaf cupping, temporary yellowing, and stunting of young seedlings (Supplementary Figures 1A,B). The titers of CTV in graft-inoculated plants were confirmed by RT-qPCR. However, the virus titer was varied from plant to plant, and Ct (cycle threshold) values were found ranging from 19.25 to 29.12 per 500 ng/μl of RNA extracted (Supplementary Figure 1E). Furthermore, under electron microscopy, CTV particles having the size of 2,000 × 11 nm were also observed (Supplementary Figure 1D).

RT-PCR Detection and Disease Incidence

RT-PCR detected the CTV variants in all the collected samples by separate targeted gene-specific primer sets (Figure 2B and Table 2). For example, the 5′ORF1a-specific primers pair 488F/491R targeting the genomic region between 1,082 and 1,484 nucleotides on the CTV genome resulted in an intense band of ∼404 bp. Of the 90 samples collected, 64 were found positive for CTV. These samples also tested positive against p25, p23, and p18 gene-specific primers and showed the expected amplicons of ∼672, ∼627, and ∼511 bp, respectively. Amplicons of 10 representative isolates for each gene were separated on a 1.2% agarose gel (Figures 3A–D). No amplification was observed with either the healthy citrus plant or the non-template control (NTC). The extent of the disease incidence was at a higher level; surprisingly, very few citrus trees were observed to be healthy (Table 1). The average CTV disease incidence was nearly 71.11% (Table 1). The percent of tree infection varied based on citrus cultivars and locations of the orchards. The highest CTV incidence was recorded in the Zhemgang district (83.33%), followed by Tsirang (78%), Dagana (70%), Chukha (66.66%), Sarpang (62.5%), Wangdue Phodrang (50%), and Trashiyangtse (33.33%).

FIGURE 3

Sequence Variations and Pair-Wise Identity Among the Citrus Tristeza Virus Isolates

The assembled sequences of four genomic regions of CTV were deposited into GenBank databases under the accession numbers listed in Table 3. Furthermore, these sequences were used to analyze genetic variations and pair-wise identity among all Bhutanese CTV variants. The nucleotide variation in the 5′ORF1a region ranged from 0.0 to 0.18 with an average of 0.06, and the pair-wise nucleotide identities were found to be 84–100% across all CTV variants. Genetic variations in the p25 gene varied from 0.02 to 0.10 with an average of 0.059 and 89–100% sequence identity within isolates. The p23 gene showed 88–100% nucleotide identity, and sequence variations ranged from 0.0 to 0.13 with an average of 0.48, whereas the p18 gene showed 91–100% identity, and nucleotide variation ranged from 0.0 to 0.11 with an average of 0.05.

TABLE 3

Sr. noSample codeConcatenated study based CTV groupsCTV accession
5′ ORF 1ap25p23p18
1Bhu-Ts-1VT-BSNDSNDMN104226SND
2Bhu-Ts-2VT-BSNDSNDMN104227SND
3Bhu-Ts-3VT-BSNDSNDMN104228MN117985
4Bhu-Ts-4VT-BSNDMN104221*MN104229MN117986
5Bhu-Ts-5VT-BSNDSNDMN104230MN117987
6Bhu-Ts-6VT-BSNDMN104222*MN117969SND
7Bhu-Sa-7VT-BMN384882SNDSNDSND
8Bhu-Ts-8VT-BSNDMN104223*MN117970MN117988
9Bhu-Ts-9VT-BSNDMN104224*MN117971MN117989
10Bhu-Ts-10VT-BSNDMN104225*MN117972MN117990
11Bhu-Ts-11B2MN384885SNDMN549939MN580428
12Bhu-Ts-12T3SNDMN366299MN549947SND
13Bhu-Ts-13T3MN384883MN366307MN549941MN580427
14Bhu-Ts-14T36SNDMN366297SNDMN580434
15Bhu-Ts-15HA16-5MN384884MN366302MN549942MN580429
16Bhu-Ts-16B2SNDSNDMN549940MN580430
17Bhu-Ts-17B1MN651084SNDMN549944MN580432
18Bhu-Ts-18T3MN651083MN366301*MN549948MN580435
19Bhu-Ts-19VT-BMN651088MN366303*MN549945MN580436
20Bhu-Ts-20T3MN651089MN366300*MN549951MN580422
21Bhu-Ts-22B1MN651087MN366306MN549954MN580426
22Bhu-Ts-23B1SNDSNDMN549949MN580433
23Bhu-Ts-24B2MN651085SNDMN549953MN580424
24Bhu-Ts-26B1SNDSNDMN549952MN580423
25Bhu-Ts-27T68MN651086MN366298MN549950MN580437
26Bhu-Ts-28VT-BSNDSNDSNDMN580425
27Bhu-Ts-29B2SNDMN366305MN549943MN580431
28Bhu-Ts-30VT-BMN384880MN366304MN549946MN580438
29Bhu-Da-36T68SNDMN101752*MN137882MN137877
30Bhu-Da-38VT-BSNDSNDMN137883MN137878
31Bhu-Wa-60VT-BMN651093MN366309MN398270SND
32BhuWa-62HA16-5MN651091MN366310SNDSND
33Bhu-Zh-68VT-BMN651096MN366311*MN398271SND
34Bhu-Zh-71VT-BSNDMN101753*MN137884MN137879
35Bhu-Zh-72VT-BMN651094MN366316MN398272SND
36Bhu-Da-76VT-BMN651097MN366312*MN398273MN580439
37Bhu-Sa-39VT-BSNDSNDMN137885SND
38Bhu-Sa-79VT-BSNDSNDMN137887MN137881
39Bhu-Sa-80VT-BMN651092MN366313MN398274MN580440
40Bhu-Sa-81VT-BMN651095SNDSNDMN580441
41Bhu-Sa-82VT-BSNDSNDMN137886SND
42Bhu-Ch-87HA16-5MN651090MN366314MN398277MN580442
43Bhu-Ch-89B1MN651098MN366315MN398278SND
44Bhu-Ch-90RBSNDMN366317MN398279SND
Major CTV strains
45T36T 36U16304U16304U16304U16304
46T30T 30AF260651AF260651AF260651AF260651
47VTVTEU937519EU937519EU937519EU937519
48T3T 3KC525952KC525952KC525952KC525952
49T68T 68JQ965169JQ965169JQ965169JQ965169
50RBRBFJ525434FJ525434FJ525434FJ525434
51HA16-5HA16-5GQ454870GQ454870GQ454870GQ454870

Citrus tristeza virus (CTV) isolates collected from different geographic regions of Bhutan. Four different specific genomic regions are sequenced and their accession numbers are presented.

CTV, Citrus tristeza virus; *, Our earlier studied samples; SND, Sequencing not done.

Molecular Characterization of Citrus Tristeza Virus Variants

Both the concatenated nucleotide and amino-acid-based maximum likelihood (ML) trees are presented in Figures 4, 5. Worldwide CTV isolates have been classified under seven internationally recognized strains (). However, the ML tree based on both the nucleotides and protein sequences in our analysis identified two (B1 and B2) additional isolates or variants (Figures 4, 5). These trees show remarkable unity in their branching pattern and relationship with neighboring clades. Based on our analysis, Bhutanese and the worldwide CTV isolates could be robustly classified under the following variants described below:

FIGURE 4

) with default parameters, except for the model parameter that was set to GTR, and both NNI (nearest-neighbor interchange) and SPR (sub-tree pruning and re-grafting) moves were adopted for their accuracy of branch placement along the tree (). SH-like () support, which is known to outperform bootstrap support (), was used for branch stability. SH-like support of 99% or higher is shown with a cyan color circle. CTV strains were earlier classified under seven (T30, T36, VT, T3, T68, RB, and HA16-5) subtypes or variants (). In contrast, our concatenated nucleotides-based ML tree showing an additional two (B1 and B2) clades could be confidently allotted with a high SH-like support value. Clades B1 and B2 are named after the Bhutanese variants. Labeling the ML tree was made clearer by using the first letter of the genus and two letters of the citrus species, followed by the isolate or genotype name, place, and the country where it was reported. For clarity, Bhutanese isolates are shown in bold font. For a complete list of the GenBank accessions, species name, isolate or variants name, country name, protein-coding region, and their respective DNA used to build this tree refer to Supplementary Excel File 1, and for the complete list of Bhutanese isolates, refer to Tables 1, 3.

FIGURE 5

) with default parameters except for the model parameter that was set to JTT (), and both NNI (nearest-neighbor interchange) and SPR (sub-tree pruning and re-grafting) moves were adopted for better accuracy (). SH-like () support, which is known to outperform bootstrap support (), was used for branch stability. SH-like support of 95% or higher is shown with a mustard color circle. CTV strains were earlier classified under seven (T30, T36, VT, T3, T68, RB and HA16-5) subtypes or variants (). In contrast, our concatenated protein-based ML tree shows an additional three (B1, B2, and NZ-M16) clades. Clades B1 and B2 are named after the Bhutanese variants. Labeling in the ML tree was made clearer by using the first letter of the genus and two letters of the citrus species, followed by the isolate or genotype name, place, and the country where it was reported. For clarity, Bhutanese isolates are shown in bold font. For a complete list of the GenBank accessions, species name, isolate or variants name, country name, and protein-coding amino acids used to build this tree, refer to Supplementary Excel File 1, and for the complete list of Bhutanese isolates, refer to Tables 1, 3.

Resistance-Breaking Isolate

RB isolate was named after discovering the founding member, Poncirus trifoliate resistance-breaking (RB) strain from New Zealand and shown to have 90% nucleotide sequence identity against the neighboring clade T36 (). The presence of an RB strain among the Puerto Rican isolates was also reported (). The RB isolate has not been reported elsewhere from the world, including the Asian subcontinent. Besides establishing for the first time the RB strain from South Africa (B389-4) and Australia (PB61), based on our comparative bioinformatic analysis, here, we report for the first time the presence of RB strain among Bhutanese isolates (Figure 4). Validation in the glasshouse using the host assay system is subject to future further analysis. Our analysis also suggests that a small invariable pentapeptide signature motif “RVENV” is present at the amino terminus of the p23 protein sequence, which separates RB strains from the rest of the CTV isolates worldwide. The Bhutanese variant Bhu-Ch-90 carry these invariable amino acids in its p23 gene and confirms its classification under the RB clade. An Indian isolate (GFA-MH) with only the coat-protein (p25) gene sequence from Maharashtra falls under the RB clade in the nucleotide-based tree (Figure 4) and is segregated under the T3 clade in the amino acid-based tree (Figure 5). Together, these results would suggest the widespread presence of the RB variant than earlier realized poignantly located at the center of origin of citrus.

T36 Isolate

T36 isolate was named after the founding member of the Florida decline isolate for which the whole-genome sequence was published as early as 1995 (), and the whole-genome sequence of T36 from Turkey was revealed recently (). After analyzing the GenBank deposited sequences, we observed that the T36 strain is widespread in Taiwan, Mexico, Tunisia, and Italy (Figures 4, 5). However, the presence of the T36 isolate has not been reported elsewhere, particularly from the Asian subcontinent, including north-eastern India, which has been considered the likely place of origin of citrus (). For the first time in this analysis, we report and establish the presence of a T36 strain (Bhu-Ts-14) among Bhutanese CTV isolates, which form a strong clade along with other T36 strains (Figures 4, 5).

T30 Isolate

This strain was named after Florida isolate T30 (). The whole-genome sequence, including the two other isolates from Florida and China, is available in the GenBank (). These T30 isolates form a distinct clade in nucleotide and protein-based ML trees (Figures 4, 5). We were unable to identify any Bhutanese isolates that belonged to this clade. However, Bhutanese isolates (Bhu-Ts-12, 13, 18, and 20) form a distinct clade with solid statistical support within the T30 and T3 clade (Figure 4), and it could be the transitional state from which T30 or the T3 sequences might have evolved. However, these Bhutanese isolates come under the T3 clade when the amino-acids-based ML tree was generated (Figure 5). However, our finding of a Chinese isolate that belonged to the T30 group would, for the first time, establish its Asian origin (Figures 4, 5). Besides, the robust sister clade relationship among RB, T30, and T36 with solid statistical support indicated that these isolates might have originated from their ancestral sequences that subsequently gave rise to these three clade members.

T3 Isolate

The T3 isolate was named after the founding member recovered from a lime tree in Florida, for which the whole-genome sequence is available in the GenBank. A strain from New Zealand (NZ-M16) has been classified as T3-like, for which the whole-genome sequence is available (). This strain, in our analysis, forms its clade next to the T68 clade with robust statistical support together with other sequences from India that suggested its Asian origin (Figures 4, 5). We retain the name of this clade as NZ-M16 to distinguish it from other CTV isolates (Figures 4, 5). In addition, the GenBank deposited sequences analysis identified several T3 isolates from South Africa: Maxi, T3-KB, N10-64 (Figures 4, 5 and Supplementary Excel File 1). We also identified a T3 isolate from Brazil (GenBank Acc. DQ363400), for which only 5′ORF1a sequence data are available in the GenBank. Several Indian sequences (An-9, Kat1, Kat3, and K38) also fall within this clade with strong statistical support value. Bhutanese sequences, specifically Bhu-Ts-12, 13, 18, and 20, form a strong cluster within the T3 clade based on their amino acid sequences. These results suggest that the T3 isolate is being distributed worldwide, and its origin could be traced to the center of origin of citrus.

T68 Isolate

T68 belongs to the Florida isolates for which the whole-genome sequence is available in the GenBank. In addition, the full-genome sequences of two T68 strains that differ in their stem-pitting severity reported from South Africa are also published and available in the GenBank (, ). The complete genome sequence of an orange stem-pitting isolate (B165) from India () was classified under VT, but our analysis suggested reconsidering it to be classified under T68 isolate (Figures 4, 5). Several isolates, specifically TG2, 3, and 5 from the north-eastern region of India from Assam, form a strong cluster within the T68 clade along with K10, K14, and Kpg6 isolates from Darjeeling, West Bengal, India. The Bhutanese isolate Bhu-Ts-27 based on sequences of all four independent genomic locations formed a strong association within the T68 clade in both nucleotide and protein trees (Figures 4, 5). However, Bhu-Ts-28 based only on the p18 genomic region was found to switch clades between T68 and VT-B. Therefore, we conclude that the Bhu-Ts-28 strain remained unclassified, and the additional genomic sequence would be required for confident classification. Together, our analysis suggests that T68 is distributed worldwide, possibly originating in the north-eastern region of India and Bhutan. We also observed that NZ-M16 formed a sister clade with T68 clade with strong statistical support, which indicated its Indian origin.

VT Isolate

The VT strain was named after discovering its founding member from Israel, for which the full-genome sequence is available. In addition to this VT isolate, two other VT strains have been reported from Florida, and all these three VT isolates form an independent clade in the nucleotide tree adjacent to the T68, NZ-M16 clade (Figure 4). Bhutan’s unidentified VT-like sequences get segregated within the same clade (Figure 4). We have to refer to these Bhutanese VT-like sequences as an independent VT-B clade where the B is derived from Bhutan. In the protein tree, some of the sequences from India fall in the same clade as the Florida VT strains without significant statistical support (Figure 5). These Indian sequences, however, form a strong clade together with HA16-5 (Hawaii isolates of CTV), indicating that Florida VT strains are related and originated from any of these four ancestral clades, namely, T68, NZ-M16, VT-B, and HA16-5. In addition, our analyses also have suggested that the ancestry of these four clade members can be traced back to their roots in the north-eastern region of India and Bhutan ().

HA16-5 Isolate

This isolate was named after the founding member from Hawaii and was classified as a new genotype for which the whole-genome sequence has been published (). The CTV isolate LMS6-6 from South Africa was recently classified under HA16-5 clade (). Both LMS6-6 and HA16-5 in our analysis fall in the HA16-5 clade in both nucleotide and protein trees with firm statistical support (Figures 4, 5). Four sequences are supposedly Poncirus-resistant breaking strains, namely, CA-RB-AT3 from California, United States (), L13 from China (), DSST17 from Uruguay (), and B390-5 from South Africa () and have been classified under RB clade, which, in our analysis with both nucleotide and protein tree, form a strong clade together with HA16-5 and LMS6-6 (Figures 4, 5). The clade HA16-5 also accommodates several isolates from the southern part of India and the north-eastern region, including Assam and Darjeeling, together with at least three isolates from Bhutan (Bhu-Ts-15, Bhu-Wa-62, and Bhu-Ch-87) (Figures 4, 5). This result suggests that the HA16-5 strains have been distributed worldwide, with the root traced back to Bhutan and Northeast India.

B1 Isolate

A severe stem-pitting (SP) isolate from California (SY568) reported to have sequence similarities with Florida and Israel VT strain has been published (). In addition, the whole-genome sequences of two Italian isolates Mac39 and SG29 sequences are also available in the GenBank, of which SG29 was shown to have clustered within the VT-Asian subtypes (). Similarly, the whole-genome sequences of severe stem-pitting (SP) isolates from Spain () and Brazilian isolate CSL02 have been classified under the VT group (). The full-length genome of NUagA isolate from Japan, which causes seedling yellows, and sequences of four unclassified isolates, namely, HU-PSTS, FN08, CT11A, and AT-1, from China are available in the GenBank. Together with the isolates from India and Bhutanese variants, all these isolates are mentioned here. Specifically, Bhu-Ts-17, Bhu-Ts-22, Bhu-Ts-23, Bhu-Ts-26, Bhu-Ch-89 form an unrelated cluster distinctly different from VT isolates in both nucleotide and protein trees (Figures 4, 5). This result suggests that these isolates should be classified under distinct clade, which we prefer to name B1 clade after Bhutan. Thus, the B1 clade harboring the severe stem-pitting isolates has a worldwide distribution, and its root could be traced back to the north-eastern region of India and Bhutan ().

B2 Isolate

B2 isolates form a distinctly different clade in the ML tree with solid statistical support next to the HA16-5 clade in nucleotide and amino acid tree (Figures 4, 5). Isolates of this clade have so far been found only among Bhutanese variants (Bhu-Ts-11, Bhu-Ts-16, Bhu-Ts-24, Bhu-Ts-29) and variants from the north-eastern region of Southeast Asia, including Assam and Darjeeling.

Distribution of Citrus Tristeza Virus Variants in Bhutan

Phylogenetic analysis using the four genomic locations has allowed us to classify the CTV isolates into nine major groups (RB, T36, T30, T3, T68, VT or VT-B, HA16-5, B1, and B2). Except for the T30 group, Bhutanese isolates have representations in all eight groups indicating greater diversity. Except for the resistant-breaking strain RB, all other seven variants were observed mainly in the Tsirang district. The devastating VT-B strain occurs throughout Bhutan’s major citrus growing districts (Figure 2A). The second most widely distributed variant was HA16-5, which, besides Tsirang, was found in two other regions, Wangdue Phodrang and Chukha districts, and the resistant-breaking RB strain was reported exclusively from the Chukha region (Figure 2A).

Discussion

CTV, the largest and most complex member of the family Closteroviridae, is a phloem-limited virus that infects citrus and closely related species and produces a wide range of characteristic symptoms. Viruses having RNA as their genome have the potential for genetic variations due to their error-prone replication mechanism (). Similarly, CTV can evolve and exhibit variable pathogenesis on the citrus hosts. Several genomic regions have been targeted and characterized to determine the genetic diversity among the CTV isolates (, ; ; ). It was reported that the 3′ half of the CTV genome, among various isolates, is more conserved (90% identity), while most genetic diversity (44–88% identity) is found at the 5′ terminal half (). The genetic diversity based on the 5′ terminal region and based on the two combined regions (5′ORF1a and p25 genes) has been reported to discriminate CTV isolates from the northeastern and southern parts of India (; ). In the present study, efforts have been carried out to determine the genetic diversity of CTV isolates from Bhutan using 5′ end ORF1a and three other potential genes of 3′ end, viz., p25, p23, and p18.

In the present investigation, a novel approach of concatenating-independent genomic locations utilizing both the nucleotide and their corresponding amino acid sequences for differentiation of tristeza variants from Bhutan and across the World has been used. This work provides a new framework for revisiting and re-classifying the existing tristeza variants in future studies. The four genomic locations used in this study were in the viral homologous recombination-free regions in the tristeza genome () and, thus, allowed us to build a robust phylogenetic relationship among global CTV isolates. Although consensus trees generated are robust, common sources of phylogenetic error such as long-branch attraction might skulk; we remain cautious of our interpretation while classifying the new clade such as B2, which is based solely on the 5′ORF1a sequence available at this moment for phylogenetic reconstruction. Despite limited sequence information available in some instances (used for phylogenetic reconstruction), an astounding congruence was noticed in the placement of the isolates within the clade and their sister–clade relationship in the concatenated nucleotide and the protein tree, which further validate the robustness of our classification.

The most striking feature of the results is the sequence diversity assessment among all the Bhutanese CTV variants and establishing their one-to-one relationship with existing worldwide-recognized isolates. Sequences were extracted from the whole-genome sequences and partially sequenced CTV isolates that were previously reported (; ; ; ). An exhaustive search was done both for the whole-genome sequence information and the partial sequences available in the GenBank. It was beyond the scope to incorporate all sequences from the GenBank. However, we incorporated all worldwide-recognized CTV isolates that belonged to the seven well-known clades, namely, RB, T36, T30, T3, T68, VT, and HA16-5, and other full-genome and partial CTV isolate sequences supporting the clades. Concatenated nucleotide and protein-based trees are novel approaches that never have been used for plant virus isolates differentiation. We see some strains, such as Bhu-Ts-7, Bhu-Ts-28, and GFA-MH-Ind, switching the places between the clades, mainly because of very limited sequence information available for them. For example, out of four genomic locations targeted in this analysis, sequence information for only one genomic location was available for these isolates for phylogenetic reconstruction. More genomic information for these strains would be required to establish a stable phylogenetic relationship among these Bhutanese isolates. Another most striking result that appeared from our result is placing the roots of these nine clades identified in this analysis to the center of origin of citrus to the north-eastern region of India and Bhutan, which was not defined so far in earlier studies.

Recently, the association of CTV and Candidatus Liberibacter asiaticus with citrus decline has been recorded in Bhutan with higher incidence up to 70.58 and 27.45%, respectively (). The present investigation also suggests an average incidence of 71.11% (64 out of 90 samples tested positive) of CTV occurring in Bhutan based on targeted genes (5′ORF1a, p25, p23, and p18) by RT-PCR test from eight different districts of Bhutan. The highest CTV incidence was recorded in Zhemgang and Tsirang followed by other districts. We also observed that most of the citrus orchards were neglected, and infestation of aphids was common in most of the surveyed orchards. The tristeza disease is a major threat to the citrus in the northeast region of India, including Bhutan (; ), and aphids may be the major source of virus spread. The evidence generated in the present study will be helpful in quarantine applications in Bhutan. Furthermore, sanitation and the use of virus-free propagation material will be the most powerful method to put the citrus industry of Bhutan on sound scientific footings for increased citrus productivity.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.

Author contributions

DG, AK, and SK designed the study and developed the methods. DG, KM, SK, and AK prepared the data. All authors analyzed the results and wrote the manuscript.

Funding

This research was funded by the ICAR-Consortia Research Platform (CRP) on Vaccines and Diagnostics, Government of India, F.No. 16-11/pp/ICAR-CRP/17-18/06.

Acknowledgments

We would like to thank Siddarame Gowda, University of Florida, Citrus Research and Education Centre, Lake Alfred, FL, United States, for reviewing the manuscript and providing valuable suggestions for improving the manuscript.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2022.797463/full#supplementary-material

References

Summary

Keywords

citrus tristeza virus, genomic diversity, sequencing and phylogenetic analysis, RT-PCR, genomic regions

Citation

Ghosh DK, Kokane A, Kokane S, Mukherjee K, Tenzin J, Surwase D, Deshmukh D, Gubyad M and Biswas KK (2022) A Comprehensive Analysis of Citrus Tristeza Variants of Bhutan and Across the World. Front. Microbiol. 13:797463. doi: 10.3389/fmicb.2022.797463

Received

18 October 2021

Accepted

19 January 2022

Published

08 April 2022

Volume

13 - 2022

Edited by

Tao Jin, Guangdong Magigene Biotechnology Co., Ltd., China

Reviewed by

Islam Hamim, Bangladesh Agricultural University, Bangladesh; Susheel Kumar, National Botanical Research Institute (CSIR), India

Updates

Copyright

*Correspondence: Dilip Kumar Ghosh,

This article was submitted to Virology, a section of the journal Frontiers in Microbiology

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics