Abstract
Mandarin orange is economically one of the most important fruit crops in Bhutan. However, in recent years, orange productivity has dropped due to severe infection of citrus tristeza virus (CTV) associated with the gradual decline of citrus orchards. Although the disease incidence has been reported, very limited information is available on genetic variability among the Bhutanese CTV variants. This study used reverse transcription PCR (RT-PCR) to detect CTV in collected field samples and recorded disease incidence up to 71.11% in Bhutan’s prominent citrus-growing regions. To elucidate the extent of genetic variabilities among the Bhutanese CTV variants, we targeted four independent genomic regions (5′ORF1a, p25, p23, and p18) and analyzed a total of 64 collected isolates. These genomic regions were amplified and sequenced for further comparative bioinformatics analysis. Comprehensive phylogenetic reconstructions of the GenBank deposited sequences, including the corresponding genomic locations from 53 whole-genome sequences, revealed unexpected and rich diversity among Bhutanese CTV variants. A resistant-breaking (RB) variant was also identified for the first time from the Asian subcontinent. Our analyses unambiguously identified five (T36, T3, T68, VT, and HA16-5) major, well-recognized CTV strains. Bhutanese CTV variants form two additional newly identified distinct clades with higher confidence, B1 and B2, named after Bhutan. The origin of each of these nine clades can be traced back to their root in the north-eastern region of India and Bhutan. Together, our study established a definitive framework for categorizing global CTV variants into their distinctive clades and provided novel insights into multiple genomic region-based genetic diversity assessments, including their pathogenicity status.
Introduction
Tristeza, caused by the citrus tristeza virus (CTV), is a destructive disease affecting citrus plants. Over the past few decades, tristeza has damaged millions of productive citrus trees worldwide (; ; ). Bhutan is a small landlocked Himalayan country located between India and China, and is the likely place of origin of citrus (). Diverse agro-climatic conditions are prevalent in the country, favoring the production of a wide range of horticultural crops, among which the citrus is the most important fruit crop (). Mandarin (Citrus reticulata Blanco) is a widely grown citrus cultivar in 17 out of the 20 districts, constituting more than 95% of the total citrus grown in Bhutan (; ). The prominent mandarin-growing geographical regions are Tsirang, Dagana, Zhemgang, and Sarpang (; ). However, the citrus productivity in these regions is very low because of several factors, including infection of virus and virus-like pathogens. Among these pathogens, CTV is considered a major pathogen responsible for reducing the citrus yield and quality and decline of fruit-bearing citrus groves in Bhutan ().
Local transmission of the virus within a citrus groove is by aphid species, such as Aphis gossypii Glover, Aphis (Toxoptera) citricidus Kirkaldy, and Aphis spiraecola Patch, in a semi-persistent manner, whereas transmission into a new geographical area or country occurs through the movement of infected budwood during nursery propagation (; ; ). CTV is a phloem-limited virus having long flexuous filamentous particles of 2,000 × 11 nm in size and belongs to the genus Closterovirus under the family Closteroviridae. The single-stranded positive-sense RNA genome of ∼19.3 kb organized into 12 open reading frames (ORFs), which potentially encode 19 different proteins, and two untranslated regions (UTRs) located at the 5′ and the 3′ terminal (; ; ; ). The 5′ proximal ORF1a encodes a 349-kDa polyprotein that includes two cysteine papain proteins-like (PRO) domains, a methyltransferase-like (MT) and helicase-like (HEL) domains, and ORF1b encodes an RNA-dependent RNA polymerase (RdRp)-like domain. The 3′ genomic region of CTV consists of 10 ORFs (ORFs 2–11) that encode different proteins with diverse functions, namely, major (CP) and minor (CPm) coat proteins, p65 (a homolog of cellular HSP 70 proteins), and p61 that is required for virion assembly and movement along with the hydro-phobic p6 protein (; ; ; ). Additionally, the p20 and p23 proteins function as suppressors of the host RNA silencing along with CP (), and three genes (p33, p18, and p13) are needed for systemic infection and play a role in extending the virus–host range (, ). There are numerous biological strains of CTV (; ) that infect almost all commercial citrus species and induce a wide variety of symptoms including stem pitting, vein clearing, stunting, veins corking, chlorosis, leaf cupping, and slow or quick decline (, ; ,; ). The expression of symptoms in field-infected plants depends on the type of host, virus strain, rootstock–scion combination, age of the citrus tree, and environmental conditions (; ). Biological indexing has been used as a classical method of detecting CTV for years, but it has certain limitations. Other techniques that have been used for CTV detection are enzyme-linked immunosorbent assay (ELISA) (; ), dot immunobinding assay (DIBA), and immunoelectron microscopy (IEM) with polyclonal or monoclonal antibodies (). However, the serological methods are not used extensively because they require a supply of good quality antisera.
Electron microscopy is another powerful technique, but it is very expensive, requires highly skilled personnel, and cannot distinguish viruses of similar size. However, the most sensitive virus detection methods that are being routinely used at present in different laboratories include reverse transcription polymerase chain reaction (RT-PCR) (), quantitative PCR (qPCR) (; ), multiplex RT-PCR (), and RT-LAMP (; ). Recently, a rapid, sensitive, robust, reliable, and highly specific reverse transcription recombinase polymerase amplification technique coupled with a lateral flow immunochromatographic assay (CTV-RT-RPA-LFICA) has been developed for early detection of CTV (). Apart from complete genome sequencing (), the genetic diversity of CTV has also been determined based on different genomic regions by several researchers (; ). The phylogenetic analysis of CTV isolates using 5′ORF1a genomic region (; ), coat protein region (p25) (), RNA binding protein gene (p23) (; ), and p18 gene has also been reported (). The major focus of our study was molecular detection, characterization, and determination of the genetic diversity of 64 CTV isolates based on sequence variations of four (5′ORF1a, p25, p23, and p18 gene) different genomic regions. The targeted regions span most of the CTV genome, and each region plays a specific role; for example, the highly variable region ORF1a encodes a polyprotein of MT, and HEL domains, p25 covers 95% coat protein, p23 plays a role as a major suppressor, and p18 is involved in systemic infection for extending the virus–host range.
Thus, we selected these four regions for a comprehensive analysis of CTV variants by comparing them with whole-genome sequences across the globe. By comparing the 64 CTV isolates along with the published and unpublished sequences deposited in the GenBank, we have shown that the Bhutanese isolates could be unambiguously classified under six (except for T30) of seven (RB, T36, T30, T3, T68, VT-B, and HA16-5) internationally recognized and two additional clades (B1 and B2) identified in this analysis. Our analysis provides a comprehensive framework and a thorough picture of the global categorization of the CTV isolates and their origin.
Materials and Methods
Plant Acquisition and Virus Maintenance
Leaves and twigs from 90 citrus plants suspected of being infected by CTV were collected from different geographical regions of eight (Tsirang, Wangdue Phodrang, Punakha, Trashiyangste, Zhemgang, Dagana, Sarpang, and Chukha) districts of Bhutan (Figures 1, 2A and Table 1). These samples were assayed for CTV using conventional RT-PCR, as reported earlier by . We also used the biological indexing technique to test representative samples of each district. This was done by side and wedge grafting in 10–12 months old seedlings of acid lime (Citrus aurantifolia) that were maintained in an insect-proof screen house at the Indian Council of Agricultural Research-Central Citrus Research Institute (ICAR-CCRI) Nagpur, India.
FIGURE 1
FIGURE 2
TABLE 1
| Sr. no | Sample code | Citrus cultivar | Botanical name | Location | Symptoms | Target genomic region of CTV | |||
| 5′ORF 1a | p25 | p23 | p18 | ||||||
| 1 | Bhu-Ts-1 | Local mandarin | Citrus reticulata | Tsirang | YL | + | + | + | + |
| 2 | Bhu-Ts-2 | Local mandarin | Citrus reticulata | Tsirang | YL, Chl | + | + | + | + |
| 3 | Bhu-Ts-3 | Local mandarin | Citrus reticulata | Tsirang | D, YL, PG | + | + | + | + |
| 4 | Bhu-Ts-4 | Local mandarin | Citrus reticulata | Tsirang | D | + | + | + | + |
| 5 | Bhu-Ts-5 | Local mandarin | Citrus reticulata | Tsirang | YL | + | + | + | + |
| 6 | Bhu-Ts-6 | Local mandarin | Citrus reticulata | Tsirang | VC, Chl, St | + | + | + | + |
| 7 | Bhu-Ts-7 | Local mandarin | Citrus reticulata | Tsirang | AH | + | + | + | + |
| 8 | Bhu-Ts-8 | Local mandarin | Citrus reticulata | Tsirang | D | + | + | + | + |
| 9 | Bhu-Ts-9 | Local mandarin | Citrus reticulata | Tsirang | D | + | + | + | + |
| 10 | Bhu-Ts-10 | Local mandarin | Citrus reticulata | Tsirang | D | + | + | + | + |
| 11 | Bhu-Ts-11 | Shemjong lime | Citrus aurantifolia | Tsirang | PG, Chl | + | + | + | + |
| 12 | Bhu-Ts-12 | Teishuponkan | Citrus poonensis | Tsirang | VCc, Chl | + | + | + | + |
| 13 | Bhu-Ts-13 | Tarku | Citrus reticulata | Tsirang | VC, VF, Chl | + | + | + | + |
| 14 | Bhu-Ts-14 | Fortunella | Citrus japonica | Tsirang | D, St | + | + | + | + |
| 15 | Bhu-Ts-15 | Dorokhamandarian | Citrus reticulata | Tsirang | D, VC. VF | + | + | + | + |
| 16 | Bhu-Ts-16 | 27/28 | Citrus reticulata | Tsirang | Chl, St | + | + | + | + |
| 17 | Bhu-Ts-17 | Okitsuwase | Citrus sinensis | Tsirang | Chl, D | + | + | + | + |
| 18 | Bhu-Ts-18 | Othaponkan | Citrus poonensis | Tsirang | VC, VF, Chl, St | + | + | + | + |
| 19 | Bhu-Ts-19 | Yushidaponkan | Citrus poonensis | Tsirang | D, Chl | + | + | + | + |
| 20 | Bhu-Ts-20 | Clementine | Citrus clementina | Tsirang | D, VC | + | + | + | + |
| 21 | Bhu-Ts-21 | Local mandarin | Citrus reticulata | Tsirang | AH | − | − | − | − |
| 22 | Bhu-Ts-22 | Local mandarin | Citrus reticulata | Tsirang | Chl, D, PG | + | + | + | + |
| 23 | Bhu-Ts-23 | Caracara | Citrus sinensis | Tsirang | Chl, VC | + | + | + | + |
| 24 | Bhu-Ts-24 | Citron | Citrus medica | Tsirang | PG, D, VC | + | + | + | + |
| 25 | Bhu-Ts-25 | Local mandarin | Citrus reticulata | Tsirang | AH | − | − | − | − |
| 26 | Bhu-Ts-26 | Local mandarin | Citrus reticulata | Tsirang | Chl, D, VC | + | + | + | + |
| 27 | Bhu-Ts-27 | Local mandarin | Citrus reticulata | Tsirang | PG, Chl | + | + | + | + |
| 28 | Bhu-Ts-28 | Local mandarin | Citrus reticulata | Tsirang | Chl, PG, VC | + | + | + | + |
| 29 | Bhu-Ts-29 | Local mandarin | Citrus reticulata | Tsirang | PG, Chl | + | + | + | + |
| 30 | Bhu-Ts-30 | Local mandarin | Citrus reticulata | Tsirang | VC, VF, Chl, St | + | + | + | + |
| 31 | Bhu-Ts-31 | Pomelo | Citrus grandis | Tsirang | YL | − | − | − | − |
| 32 | Bhu-Da-32 | Local mandarin | Citrus reticulata | Dagana | D, YL | + | + | + | + |
| 33 | Bhu-Da-33 | Rangpur lime | Citrus limonia | Dagana | AH | − | − | − | − |
| 34 | Bhu-Da-34 | Local mandarin | Citrus reticulata | Dagana | D, YL | + | + | + | + |
| 35 | Bhu-Da-35 | Rangpur lime | Citrus limonia | Dagana | AH | − | − | − | − |
| 36 | Bhu-Da-36 | Local mandarin | Citrus reticulata | Dagana | YL | + | + | + | + |
| 37 | Bhu-Da-37 | Rangpur lime | Citrus limonia | Dagana | Chl, YL | + | + | + | + |
| 38 | Bhu-Da-38 | Local mandarin | Citrus reticulata | Dagana | YL, Chl | + | + | + | + |
| 39 | Bhu-Ts-39 | Local mandarin | Citrus reticulata | Tsirang | AH | − | − | − | − |
| 40 | Bhu-Ts-40 | Hayaka, | Citrus reticulata | Tsirang | AH, Chl | + | + | + | + |
| 41 | Bhu-Ts-41 | Berti pomelo | Citrus grandis | Tsirang | AH | − | − | − | − |
| 42 | Bhu-Ts-42 | Hayaka | Citrus reticulata | Tsirang | D | + | + | + | + |
| 43 | Bhu-Ts-43 | Local T-13 | Citrus reticulata | Tsirang | AH | − | − | − | − |
| 44 | Bhu-Ts-44 | Clementine | Citrus reticulata | Tsirang | YL, D | + | + | + | + |
| 45 | Bhu-Ts-45 | Salustiana | Citrus sinensis | Tsirang | VL, St | + | + | + | + |
| 46 | Bhu-Ts-46 | Local mandarin | Citrus reticulata | Tsirang | YL | − | − | − | − |
| 47 | Bhu-Ts-47 | Otsu-4 | Citrus reticulata | Tsirang | YL, VC | + | + | + | + |
| 48 | Bhu-Ts-48 | Ichang papeda | Citrus ichangensis | Tsirang | YL, VC, Chl | + | + | + | + |
| 49 | Bhu-Ts-49 | Ryan | Citrus sinensis | Tsirang | AH | − | − | − | − |
| 50 | Bhu-Ts-50 | Narng mandarin | Citrus reticulata | Tsirang | AH | − | − | − | − |
| 51 | Bhu-Ts-51 | Dagana mandarin | Citrus reticulata | Tsirang | VC, Chl | + | + | + | + |
| 52 | Bhu-Ts-52 | Samtse mandarin | Citrus reticulata | Tsirang | AH | − | − | − | − |
| 53 | Bhu-Ts-53 | Khengkhar mandarin | Citrus reticulata | Tsirang | YL, St, VF | + | + | + | + |
| 54 | Bhu-Ts-54 | Tsirang mandarin | Citrus reticulata | Tsirang | VC, VF, | + | + | + | + |
| 55 | Bhu-Ts-55 | Jongkhar mandarin | Citrus reticulata | Tsirang | VF, Chl, | + | + | + | + |
| 56 | Bhu-Ts-56 | Shumar mandarin | Citrus reticulata | Tsirang | Chl, St | + | + | + | + |
| 57 | Bhu-Ts-57 | Chukha mandarin | Citrus reticulata | Tsirang | AH | − | − | − | − |
| 58 | Bhu-Wa-58 | Local mandarin | Citrus reticulata | Wangdue Phodrang | AH | − | − | − | − |
| 59 | Bhu-Wa-59 | Pomelo | Citrus grandis | Wangdue Phodrang | YL | − | − | − | − |
| 60 | Bhu-Wa-60 | Euraka | Citrus limon | Wangdue Phodrang | VC, VF, Chl | + | + | + | + |
| 61 | Bhu-Wa-61 | Grapefruit | Citrus paradisi | Wangdue Phodrang | AH | − | − | − | − |
| 62 | Bhu-Wa-62 | Mandarin | Citrus reticulata | Wangdue Phodrang | VC, VF, | + | + | + | + |
| 63 | Bhu-Wa-63 | Mandarin | Citrus reticulata | Wangdue Phodrang | Chl, PG | + | + | + | + |
| 64 | Bhu-Pu-64 | Local mandarin | Citrus reticulata | Punakha | AH | − | − | − | − |
| 65 | Bhu-Tr-65 | Local mandarin | Citrus reticulata | Trashiyangtse | AH | − | − | − | − |
| 66 | Bhu-Tr-66 | Local mandarin | Citrus reticulata | Trashiyangtse | VC, VF | + | + | + | + |
| 67 | Bhu-Tr-67 | Local mandarin | Citrus reticulata | Trashiyangtse | AH | − | − | − | − |
| 68 | Bhu-Zh-68 | Local mandarin | Citrus reticulata | Zhemgang | VC, VF, Chl, PG | + | + | + | + |
| 69 | Bhu-Zh-69 | Local mandarin | Citrus reticulata | Zhemgang | YL, VC | + | + | + | + |
| 70 | Bhu-Zh-70 | Local mandarin | Citrus reticulata | Zhemgang | D, PG | + | + | + | + |
| 71 | Bhu-Zh-71 | Local mandarin | Citrus reticulata | Zhemgang | D, St | + | + | + | + |
| 72 | Bhu-Zh-72 | Local mandarin | Citrus reticulate | Zhemgang | VC, VF | + | + | + | + |
| 73 | Bhu-Zh-73 | Local mandarin | Citrus reticulata | Zhemgang | AH | − | − | − | − |
| 74 | Bhu-Da-74 | Local mandarin | Citrus reticulata | Dagana | AH | − | − | − | − |
| 75 | Bhu-Da-75 | Local mandarin | Citrus reticulata | Dagana | D, PG | + | + | + | + |
| 76 | Bhu-Da-76 | Local mandarin | Citrus reticulata | Dagana | PG, Chl, VC | + | + | + | + |
| 77 | Bhu-Sa-77 | Local mandarin | Citrus reticulata | Sarpang | AH | − | − | − | − |
| 78 | Bhu-Sa-39 | Local mandarin | Citrus reticulata | Sarpang | D, Chl | + | + | + | + |
| 79 | Bhu-Sa-79 | Local mandarin | Citrus reticulata | Sarpang | D, PG | + | + | + | + |
| 80 | Bhu-Sa-80 | Local mandarin | Citrus reticulata | Sarpang | VC, VF | + | + | + | + |
| 81 | Bhu-Sa-81 | Local mandarin | Citrus reticulata | Sarpang | PG, YL | + | + | + | + |
| 82 | Bhu-Sa-82 | Local mandarin | Citrus reticulata | Sarpang | YL, VC | + | + | + | + |
| 83 | Bhu-Sa-83 | Local mandarin | Citrus reticulata | Sarpang | AH | − | − | − | − |
| 84 | Bhu-Sa-84 | Local mandarin | Citrus reticulata | Sarpang | AH | − | − | − | − |
| 85 | Bhu-Ch-85 | Dorokha mandarin | Citrus reticulata | Chukha | Chl, YL | + | + | + | + |
| 86 | Bhu-Ch-86 | Wangkhartshalv-I | Citrus reticulata | Chukha | AH | − | − | − | − |
| 87 | Bhu-Ch-87 | Wangkhartshalvngam | Citrus reticulata | Chukha | VC, VF, Chl, St | + | + | + | + |
| 88 | Bhu-Ch-88 | Wangkhartshalvngam | Citrus reticulata | Chukha | AH | − | − | − | − |
| 89 | Bhu-Ch-89 | Satsuma manadarin | Citrus reticulata | Chukha | PG, Chl, D | + | + | + | + |
| 90 | Bhu-Ch-90 | Lemon euraka | Citrus limon | Chukha | VC, Chl | + | + | + | + |
| Total no of positive samples (disease incidence) | 64 (71.11%) | ||||||||
Details of samples collected from different geographical regions of Bhutan and presence or absence of citrus tristeza virus (CTV) tested by RT-PCR.
Chl, Chlorosis; AH, Apparently healthy; D, Declined; YL, Yellow leaves; PG, Poor growth; VC, Vein clearing; VF, Vein flecking; St, Stunting; +, CTV positive sample; –, CTV negative sample.
Sample Processing and RNA Extraction
Symptomatic leaves from all collected samples were thoroughly washed with double-distilled water, wiped with 70% ethanol to avoid surface contamination, and blot dried. Midrib portions of the leaves were excised and ground in liquid nitrogen. Approximately 100 mg of ground sample was used for total RNA extraction using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) as per the manufacturer’s protocol. The extracted RNA was dissolved into the Tris-EDTA (TE) buffer and stored at −80°C for further analysis. The concentration of total genomic RNA was assessed by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Delaware, United States), and quality was determined by 2% agarose gel, stained with 0.5 μg/ml of ethidium bromide, and visualized in a Gel documentation system (G: Box, Syngene, Frederick, United States).
Primer Designing
Primers were designed against the CTV-targeted genomic locations of 5′ORF1a, p25, p23, and p18 using primer 3v.0.4.0 tool.1 Primer specificity was then checked using primer BLAST software at National Center for Biotechnology Information (NCBI)2 to avoid cross-reaction with other pathogens or targets. The primers were finally custom synthesized from IDT (Integrated DNA Technologies, Coralville, IA, United States) (Table 2).
TABLE 2
| Sr. no | Primer code | Sequence | Annealing temp. | Amplicons size | Target genomic regions | References |
| 1 | 488F 491R | 5′ TGTTCCGTCCTGSGCGGAAYAATT 3′ 5′ GTGTARGTCCCRCGCATMGGAACC 3′ | 58°C | 404 bp | 5′ ORF 1a | |
| 2 | CN150 CN151 | 5′ATATATTTACTCTAGATCTACCATGGACGACGAAACAAA 3′ 5′ GAATCGGAACGCGAATTCTCAACGTGTTAAATTTCC 3′ | 61°C | 672 bp | p25 | |
| 3 | RBP-23F RBP-23R | 5′ ATGAACGATACTAGCGGAC 3′ 5′ GATGAAGTGGTGTTCACGG 3′ | 52°C | 627 bp | p23 | |
| 4 | AR18F AR18R | 5′ ATGTCAGGCAGCTTGGGAAATT 3′ 5′ TTCGTGTCTAAGTCRCGCTAAACA 3′ | 62°C | 511 bp | P18 |
Details of the primers used in the present study.
Establishing Citrus Tristeza Virus Culture Confirmation by RT-qPCR and Electron Microscopy
Total RNA extracted from graft-inoculated samples were used for RT-qPCR assay using CTV-specific primer–probe combination (P25-F/p25-R) and corresponding CTV-FAM probe [labeled with 6-carboxy-fluorescein (FAM) reporter dye at the 5′ terminus and the Black Hole Quencher (BHQ)-1 dye at the 3′ terminus]. The TaqMan-qPCR assay for CTV was performed using a StepOne Real-Time PCR System (Applied Biosystems) in two steps as described by with the following conditions: 95°C for 2 min (initial denaturation), followed by 40 cycles at 95°C for 15 s, annealing, and primer extension simultaneously for 1 min at 60°C. All experimental reactions were conducted in triplicate along with non-template controls (NTC), and the data were analyzed using StepOne Software v2.1. Furthermore, the graft-inoculated samples were also tested by electron microscopy in leaf dip preparation as reported by .
Detection of Citrus Tristeza Virus in Field Samples Using Conventional RT-PCR
The total genomic RNA extracted from the leaves of CTV-suspected samples were used to perform RT-PCR in two steps with CTV 5′ORF1a gene-specific primer set, 488F/491R (; ). In the first step, cDNA was synthesized in a 15 μl reaction volume. The reaction contained 1× first-strand buffer, 0.5 mM deoxyribonucleotide triphosphates (dNTPs) (Promega, Madison, United States), 15.6 U of RNAsin (Promega, Madison, United States), 0.4 μM reverse primer (491R), 6 μl of total RNA, and 120 units of M-MLV reverse transcriptase (Promega, Madison, United States). The reaction was carried out in a thermal cycler (Bio-Rad 100 Thermal Cycler, California, United States) with extension at 42°C for 50 min and denaturation at 72°C for 10 min. In the second step, a 1.75 μl aliquot of cDNA was used as a template in a 25 μl reaction mixture containing 1× PCR buffer, 0.2 μM of each primer (488F/491R), 0.2 mM of the dNTPs mix, 1.5 mM MgCl2, and 1.25 U of GoTaq DNA polymerase (Promega, Madison, United States). The amplification was with one cycle of 3 min at 94°C followed by 35 cycles of 0.30 min at 94°C, 0.45 min at 58°C, 1 min at 72°C, and final extension for 10 min at 72°C. The amplified RT-PCR products of the 5′ORF 1a fragment were analyzed on 1.2% agarose gel. Three more genomic regions of CTV, viz., p25, p23, and p18 genes were also used for detection and molecular characterization of CTV isolates. The primer pairs specific for p25 (CN150/CN151) (), p23 (RBP-23F/RBP-23R) (), and p18 (AR18F/AR18R) () were used to perform the RT-PCR (Table 2). The amplification program for the p25, p23, and p18 genes were the same as described above with modifications in annealing time and temperature, i.e., 0.45 min at 61°C for p25, 0.40 min at 52°C for p23, and 0.35 min at 62°C for p18 gene. The amplified RT-PCR products were analyzed on 1.2% agarose gel.
Nucleotide Sequence Analysis of the 5′ and 3′-Terminal Regions of Citrus Tristeza Virus Genome
The amplified products of four genomic regions were excised and eluted from the agarose gel using the GenElute Gel Extraction Kit (Sigma-Aldrich, Bengaluru, India) and sequenced from both ends DNA sequencing facility (Eurofins Genomics, Bengaluru, India). The forward and reverse sequences were assembled into one complete contig of the target gene and eliminated the repeated sequences. To assess the sequence similarity, the prepared contigs were analyzed by the basic local alignment search tool (BLAST) of the NCBI. The confirmed nucleotide sequences were translated using the online software EXPASY translate tool.3 Sequence similarities of proteins were identified using the BLASTp. Assembled sequences of each gene were then deposited into GenBank using BankIt-NCBI-NIH software.4 Assembled nucleotide sequences of the four genomic regions were further used to analyze genetic variations biostatistically and pair-wise identity using GeneDoc software among the CTV isolates ().
Sequence Retrieval, Extraction of Genomic Location, Sequence Alignment, and Phylogeny Reconstruction
Depending on the amino acids or nucleotide sequences, Blastp, TBlastn, or Blastn searches were performed with the default parameters using 5′ORF1a, p25, p23, and p18 as a query against all GenBank deposited sequences, including the whole-genome tristeza sequences available at the NCBI. Along with the GenBank deposited CTV variants, a total of 53 whole-genome CTV nucleotide sequences were retrieved and downloaded, and local standalone BLAST () searches were performed against the retrieved genomic sequences. In local BLAST searches, the amino acid sequences of 5′ORF1a, p23, p18, and p25 were again used as a query against the whole-genomes CTV sequences in Tblastn searches to identify the corresponding amino acid sequences. The whole-genome nucleotide sequence was then translated in three frames at https://www.bioinformatics.org/sms2/trans_map.html, and the nucleotide sequence of the corresponding genomic region encoded by these proteins was extracted manually. Individual DNA and the protein sequences against these four genomic regions extracted for a particular isolate from the whole-genome sequences along with all other retrieved sequences from NCBI are presented in Supplementary Excel File 1 and freely available for download. A novel phylogenetic reconstruction approach was then used in this analysis using the concatenated nucleotides and protein sequences of the four genomic regions of the Bhutanese variants and the GenBank deposited sequences. Due to high sequence similarities at the protein level, the phylogeny was performed using the corresponding DNA sequences to determine the greater sequence variations due to the presence of both synonymous (mutations in the codon that do not change the amino acids) and non-synonymous (mutations that alter the amino acids) changes. Both the amino acid and nucleotide sequences were aligned in MUSCLE (), and maximum likelihood (ML) trees were inferred using PhyML v3.0 (; ), with the best-fit evolutionary model identified using the Akaike information criterion (AIC) criterion estimated by ProtTest (). The JTT substitution matrix was used for the amino acid sequences and the GTR substitution model for the nucleotide sequences while estimating the tree topology, branch lengths, amino acid equilibrium frequencies, fraction of invariable sites, and discrete-gamma distributed substitution rates. Clade support was calculated using the SH-like approximate likelihood ratio test (). The resulting phylogenetic trees were viewed online and edited with iTol version 2.0 (). The vector graphics file was then imported onto Adobe Illustrator version CS6 for editing and final exporting of the high-resolution picture for publication.
Results
Symptomatology, Bioassay, RT-qPCR, and Electron Microscopy
During field surveys in the different districts of Bhutan (Figure 2A), citrus trees showed the typical characteristic of tristeza symptoms, specifically chlorosis, yellow leaves, leaf cupping, vein clearing, vein flecking, declined condition, poor growth, and vigor. Stunting in diverse species was also observed, for instance, in mandarin (Citrus reticulata), pomelo (Citrus grandis), lime (Citrus aurantifolia), citron (Citrus medica), and other citrus cultivars or hybrids. However, few citrus trees found seemed to be healthy (Table 1). We performed Koch’s postulate successfully for CTV in acid lime indicator plants. The virus-inoculated plants developed vein clearing, leaf cupping, temporary yellowing, and stunting of young seedlings (Supplementary Figures 1A,B). The titers of CTV in graft-inoculated plants were confirmed by RT-qPCR. However, the virus titer was varied from plant to plant, and Ct (cycle threshold) values were found ranging from 19.25 to 29.12 per 500 ng/μl of RNA extracted (Supplementary Figure 1E). Furthermore, under electron microscopy, CTV particles having the size of 2,000 × 11 nm were also observed (Supplementary Figure 1D).
RT-PCR Detection and Disease Incidence
RT-PCR detected the CTV variants in all the collected samples by separate targeted gene-specific primer sets (Figure 2B and Table 2). For example, the 5′ORF1a-specific primers pair 488F/491R targeting the genomic region between 1,082 and 1,484 nucleotides on the CTV genome resulted in an intense band of ∼404 bp. Of the 90 samples collected, 64 were found positive for CTV. These samples also tested positive against p25, p23, and p18 gene-specific primers and showed the expected amplicons of ∼672, ∼627, and ∼511 bp, respectively. Amplicons of 10 representative isolates for each gene were separated on a 1.2% agarose gel (Figures 3A–D). No amplification was observed with either the healthy citrus plant or the non-template control (NTC). The extent of the disease incidence was at a higher level; surprisingly, very few citrus trees were observed to be healthy (Table 1). The average CTV disease incidence was nearly 71.11% (Table 1). The percent of tree infection varied based on citrus cultivars and locations of the orchards. The highest CTV incidence was recorded in the Zhemgang district (83.33%), followed by Tsirang (78%), Dagana (70%), Chukha (66.66%), Sarpang (62.5%), Wangdue Phodrang (50%), and Trashiyangtse (33.33%).
FIGURE 3
Sequence Variations and Pair-Wise Identity Among the Citrus Tristeza Virus Isolates
The assembled sequences of four genomic regions of CTV were deposited into GenBank databases under the accession numbers listed in Table 3. Furthermore, these sequences were used to analyze genetic variations and pair-wise identity among all Bhutanese CTV variants. The nucleotide variation in the 5′ORF1a region ranged from 0.0 to 0.18 with an average of 0.06, and the pair-wise nucleotide identities were found to be 84–100% across all CTV variants. Genetic variations in the p25 gene varied from 0.02 to 0.10 with an average of 0.059 and 89–100% sequence identity within isolates. The p23 gene showed 88–100% nucleotide identity, and sequence variations ranged from 0.0 to 0.13 with an average of 0.48, whereas the p18 gene showed 91–100% identity, and nucleotide variation ranged from 0.0 to 0.11 with an average of 0.05.
TABLE 3
| Sr. no | Sample code | Concatenated study based CTV groups | CTV accession | |||
| 5′ ORF 1a | p25 | p23 | p18 | |||
| 1 | Bhu-Ts-1 | VT-B | SND | SND | MN104226 | SND |
| 2 | Bhu-Ts-2 | VT-B | SND | SND | MN104227 | SND |
| 3 | Bhu-Ts-3 | VT-B | SND | SND | MN104228 | MN117985 |
| 4 | Bhu-Ts-4 | VT-B | SND | MN104221* | MN104229 | MN117986 |
| 5 | Bhu-Ts-5 | VT-B | SND | SND | MN104230 | MN117987 |
| 6 | Bhu-Ts-6 | VT-B | SND | MN104222* | MN117969 | SND |
| 7 | Bhu-Sa-7 | VT-B | MN384882 | SND | SND | SND |
| 8 | Bhu-Ts-8 | VT-B | SND | MN104223* | MN117970 | MN117988 |
| 9 | Bhu-Ts-9 | VT-B | SND | MN104224* | MN117971 | MN117989 |
| 10 | Bhu-Ts-10 | VT-B | SND | MN104225* | MN117972 | MN117990 |
| 11 | Bhu-Ts-11 | B2 | MN384885 | SND | MN549939 | MN580428 |
| 12 | Bhu-Ts-12 | T3 | SND | MN366299 | MN549947 | SND |
| 13 | Bhu-Ts-13 | T3 | MN384883 | MN366307 | MN549941 | MN580427 |
| 14 | Bhu-Ts-14 | T36 | SND | MN366297 | SND | MN580434 |
| 15 | Bhu-Ts-15 | HA16-5 | MN384884 | MN366302 | MN549942 | MN580429 |
| 16 | Bhu-Ts-16 | B2 | SND | SND | MN549940 | MN580430 |
| 17 | Bhu-Ts-17 | B1 | MN651084 | SND | MN549944 | MN580432 |
| 18 | Bhu-Ts-18 | T3 | MN651083 | MN366301* | MN549948 | MN580435 |
| 19 | Bhu-Ts-19 | VT-B | MN651088 | MN366303* | MN549945 | MN580436 |
| 20 | Bhu-Ts-20 | T3 | MN651089 | MN366300* | MN549951 | MN580422 |
| 21 | Bhu-Ts-22 | B1 | MN651087 | MN366306 | MN549954 | MN580426 |
| 22 | Bhu-Ts-23 | B1 | SND | SND | MN549949 | MN580433 |
| 23 | Bhu-Ts-24 | B2 | MN651085 | SND | MN549953 | MN580424 |
| 24 | Bhu-Ts-26 | B1 | SND | SND | MN549952 | MN580423 |
| 25 | Bhu-Ts-27 | T68 | MN651086 | MN366298 | MN549950 | MN580437 |
| 26 | Bhu-Ts-28 | VT-B | SND | SND | SND | MN580425 |
| 27 | Bhu-Ts-29 | B2 | SND | MN366305 | MN549943 | MN580431 |
| 28 | Bhu-Ts-30 | VT-B | MN384880 | MN366304 | MN549946 | MN580438 |
| 29 | Bhu-Da-36 | T68 | SND | MN101752* | MN137882 | MN137877 |
| 30 | Bhu-Da-38 | VT-B | SND | SND | MN137883 | MN137878 |
| 31 | Bhu-Wa-60 | VT-B | MN651093 | MN366309 | MN398270 | SND |
| 32 | BhuWa-62 | HA16-5 | MN651091 | MN366310 | SND | SND |
| 33 | Bhu-Zh-68 | VT-B | MN651096 | MN366311* | MN398271 | SND |
| 34 | Bhu-Zh-71 | VT-B | SND | MN101753* | MN137884 | MN137879 |
| 35 | Bhu-Zh-72 | VT-B | MN651094 | MN366316 | MN398272 | SND |
| 36 | Bhu-Da-76 | VT-B | MN651097 | MN366312* | MN398273 | MN580439 |
| 37 | Bhu-Sa-39 | VT-B | SND | SND | MN137885 | SND |
| 38 | Bhu-Sa-79 | VT-B | SND | SND | MN137887 | MN137881 |
| 39 | Bhu-Sa-80 | VT-B | MN651092 | MN366313 | MN398274 | MN580440 |
| 40 | Bhu-Sa-81 | VT-B | MN651095 | SND | SND | MN580441 |
| 41 | Bhu-Sa-82 | VT-B | SND | SND | MN137886 | SND |
| 42 | Bhu-Ch-87 | HA16-5 | MN651090 | MN366314 | MN398277 | MN580442 |
| 43 | Bhu-Ch-89 | B1 | MN651098 | MN366315 | MN398278 | SND |
| 44 | Bhu-Ch-90 | RB | SND | MN366317 | MN398279 | SND |
| Major CTV strains | ||||||
| 45 | T36 | T 36 | U16304 | U16304 | U16304 | U16304 |
| 46 | T30 | T 30 | AF260651 | AF260651 | AF260651 | AF260651 |
| 47 | VT | VT | EU937519 | EU937519 | EU937519 | EU937519 |
| 48 | T3 | T 3 | KC525952 | KC525952 | KC525952 | KC525952 |
| 49 | T68 | T 68 | JQ965169 | JQ965169 | JQ965169 | JQ965169 |
| 50 | RB | RB | FJ525434 | FJ525434 | FJ525434 | FJ525434 |
| 51 | HA16-5 | HA16-5 | GQ454870 | GQ454870 | GQ454870 | GQ454870 |
Citrus tristeza virus (CTV) isolates collected from different geographic regions of Bhutan. Four different specific genomic regions are sequenced and their accession numbers are presented.
CTV, Citrus tristeza virus; *, Our earlier studied samples; SND, Sequencing not done.
Molecular Characterization of Citrus Tristeza Virus Variants
Both the concatenated nucleotide and amino-acid-based maximum likelihood (ML) trees are presented in Figures 4, 5. Worldwide CTV isolates have been classified under seven internationally recognized strains (). However, the ML tree based on both the nucleotides and protein sequences in our analysis identified two (B1 and B2) additional isolates or variants (Figures 4, 5). These trees show remarkable unity in their branching pattern and relationship with neighboring clades. Based on our analysis, Bhutanese and the worldwide CTV isolates could be robustly classified under the following variants described below:
FIGURE 4
FIGURE 5

Phylogenetic tree reconstructed using concatenated protein sequences congruent with the nucleotide tree (Figure 4). The maximum likelihood (ML) tree was reconstructed using PHYML3.2.2 (
Resistance-Breaking Isolate
RB isolate was named after discovering the founding member, Poncirus trifoliate resistance-breaking (RB) strain from New Zealand and shown to have 90% nucleotide sequence identity against the neighboring clade T36 (
T36 Isolate
T36 isolate was named after the founding member of the Florida decline isolate for which the whole-genome sequence was published as early as 1995 (
T30 Isolate
This strain was named after Florida isolate T30 (
T3 Isolate
The T3 isolate was named after the founding member recovered from a lime tree in Florida, for which the whole-genome sequence is available in the GenBank. A strain from New Zealand (NZ-M16) has been classified as T3-like, for which the whole-genome sequence is available (
T68 Isolate
T68 belongs to the Florida isolates for which the whole-genome sequence is available in the GenBank. In addition, the full-genome sequences of two T68 strains that differ in their stem-pitting severity reported from South Africa are also published and available in the GenBank (
VT Isolate
The VT strain was named after discovering its founding member from Israel, for which the full-genome sequence is available. In addition to this VT isolate, two other VT strains have been reported from Florida, and all these three VT isolates form an independent clade in the nucleotide tree adjacent to the T68, NZ-M16 clade (Figure 4). Bhutan’s unidentified VT-like sequences get segregated within the same clade (Figure 4). We have to refer to these Bhutanese VT-like sequences as an independent VT-B clade where the B is derived from Bhutan. In the protein tree, some of the sequences from India fall in the same clade as the Florida VT strains without significant statistical support (Figure 5). These Indian sequences, however, form a strong clade together with HA16-5 (Hawaii isolates of CTV), indicating that Florida VT strains are related and originated from any of these four ancestral clades, namely, T68, NZ-M16, VT-B, and HA16-5. In addition, our analyses also have suggested that the ancestry of these four clade members can be traced back to their roots in the north-eastern region of India and Bhutan (
HA16-5 Isolate
This isolate was named after the founding member from Hawaii and was classified as a new genotype for which the whole-genome sequence has been published (
B1 Isolate
A severe stem-pitting (SP) isolate from California (SY568) reported to have sequence similarities with Florida and Israel VT strain has been published (
B2 Isolate
B2 isolates form a distinctly different clade in the ML tree with solid statistical support next to the HA16-5 clade in nucleotide and amino acid tree (Figures 4, 5). Isolates of this clade have so far been found only among Bhutanese variants (Bhu-Ts-11, Bhu-Ts-16, Bhu-Ts-24, Bhu-Ts-29) and variants from the north-eastern region of Southeast Asia, including Assam and Darjeeling.
Distribution of Citrus Tristeza Virus Variants in Bhutan
Phylogenetic analysis using the four genomic locations has allowed us to classify the CTV isolates into nine major groups (RB, T36, T30, T3, T68, VT or VT-B, HA16-5, B1, and B2). Except for the T30 group, Bhutanese isolates have representations in all eight groups indicating greater diversity. Except for the resistant-breaking strain RB, all other seven variants were observed mainly in the Tsirang district. The devastating VT-B strain occurs throughout Bhutan’s major citrus growing districts (Figure 2A). The second most widely distributed variant was HA16-5, which, besides Tsirang, was found in two other regions, Wangdue Phodrang and Chukha districts, and the resistant-breaking RB strain was reported exclusively from the Chukha region (Figure 2A).
Discussion
CTV, the largest and most complex member of the family Closteroviridae, is a phloem-limited virus that infects citrus and closely related species and produces a wide range of characteristic symptoms. Viruses having RNA as their genome have the potential for genetic variations due to their error-prone replication mechanism (
In the present investigation, a novel approach of concatenating-independent genomic locations utilizing both the nucleotide and their corresponding amino acid sequences for differentiation of tristeza variants from Bhutan and across the World has been used. This work provides a new framework for revisiting and re-classifying the existing tristeza variants in future studies. The four genomic locations used in this study were in the viral homologous recombination-free regions in the tristeza genome (
The most striking feature of the results is the sequence diversity assessment among all the Bhutanese CTV variants and establishing their one-to-one relationship with existing worldwide-recognized isolates. Sequences were extracted from the whole-genome sequences and partially sequenced CTV isolates that were previously reported (
Recently, the association of CTV and Candidatus Liberibacter asiaticus with citrus decline has been recorded in Bhutan with higher incidence up to 70.58 and 27.45%, respectively (
Publisher’s Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Author contributions
DG, AK, and SK designed the study and developed the methods. DG, KM, SK, and AK prepared the data. All authors analyzed the results and wrote the manuscript.
Funding
This research was funded by the ICAR-Consortia Research Platform (CRP) on Vaccines and Diagnostics, Government of India, F.No. 16-11/pp/ICAR-CRP/17-18/06.
Acknowledgments
We would like to thank Siddarame Gowda, University of Florida, Citrus Research and Education Centre, Lake Alfred, FL, United States, for reviewing the manuscript and providing valuable suggestions for improving the manuscript.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2022.797463/full#supplementary-material
Footnotes
1.^http://bioinfo.ut.ee/primer3-0.4.0/
2.^https://www.ncbi.nlm.nih.gov/tools/primer-blast/
References
1
AbascalF.ZardoyaR.PosadaD. (2005). ProtTest: selection of best-fit models of protein evolution.Bioinformatics212104–2105. 10.1093/bioinformatics/bti263
2
AhlawatY. S. (2012). Virus Diseases of Citrus & Management.New Delhi: Studium Press (India).
3
Albiach-MartíM.MawassiM.GowdaS.SatyanarayanaT.HilfM. E.ShankerS.et al (2000). Sequences of Citrus tristeza virus separated in time and space are essentially identical.J. Virol.746856–6865. 10.1128/jvi.74.15.6856-6865.2000
4
AnisimovaM.GilM.DufayardJ. F.DessimozC.GascuelO. (2011). Survey of branch support methods demonstrates accuracy, power, and robustness of fast likelihood-based approximation schemes.Syst. Biol.60685–699. 10.1093/sysbio/syr041
5
AtallahO. O.KangS. H.El-MohtarC. A.ShiltsT.BerguaM.FolimonovaS. Y. (2016). A 5′-proximal region of the Citrus Tristeza virus genome encoding two leader proteases is involved in virus super infection exclusion.Virology489108–115. 10.1016/j.virol.2015.12.008
6
Bar-JosephM.MarcusR.LeeR. F. (1989). The continuous challenge of citrus tristeza virus control.Annu. Rev. Phytopathol.27291–316.
7
Benitez-GaleanoM. J.ValletT.CarrauL.Hernandez-RodriguezL.BertalmioA.RivasF.et al (2018). Complete genome sequence of a novel recombinant Citrus tristeza virus, a resistance-breaking isolate from Uruguay.Genome Announc.6:e00442-18. 10.1128/genomeA.00442-18
8
BiswasK. K.PalchoudhuryS.SharmaS. K.SahaB.GodaraS.GhoshD. K.et al (2018). Analyses of the 3′ half genome of citrus tristeza virus reveal the existence of distinct virus genotypes in citrus growing regions of India.Virus Dis.29308–315. 10.1007/s13337-018-0456-2
9
BorahM.NathP. D.SaikiaA. K. (2014). Biological and serological technique for detection of citrus tristeza virus affecting citrus species of Assam.India Afr. J. Agric. Res.93804–3810.
10
BrlanskyR. H.DamsteegtV. D.HowdD. S.RoyA. (2003). Molecular analyses of Citrus tristeza virus sub isolates separated by aphid transmission.Plant Dis.87397–401. 10.1094/PDIS.2003.87.4.397
11
CamachoC.CoulourisG.AvagyanV.MaN.PapadopoulosJ.BealerK.et al (2009). BLAST+: architecture and applications.BMC Bioinformatics10:421. 10.1186/1471-2105-10-421
12
CevikB.PappuS. S.PappuH. R.TightD.BenscherD.FutchS. H.et al (1996). Molecular cloning and sequencing of coat protein genes of citrus tristeza virus isolated from meyer lemon and homely tangor trees in Florida.Int. Organ. Citrus Virol. Conf. Proc.131957–2010.
13
CevikB.YardimciN.KorkmazS. (2013). The first identified Citrus tristeza virus Isolate of Turkey contains a mixture of mild and severe strains.Plant Pathol. J.2931–41. 10.5423/PPJ.OA.09.2012.0141
14
CookG.BreytenbachJ. H.SteynC.de BruynR.van VuurenS. P.BurgerJ. T.et al (2021). Grapefruit field trial evaluation of citrus tristeza virus T68-strain sources.Plant Dis.105361–367. 10.1094/PDIS-06-20-1259-RE
15
CookG.CoetzeeB.BesterR.BreytenbachJ. H.SteynC.de BruynR.et al (2020). Citrus tristeza virus isolates of the same genotype differ in stem pitting severity in grapefruit.Plant Dis.1042362–2368. 10.1094/PDIS-12-19-2586-RE
16
CookG.van VuurenS. P.BreytenbachJ. H.SteynC.BurgerJ. T.MareeH. J. (2016). Characterization of citrus tristeza virus single-variant sources in grapefruit in greenhouse and field trials.Plant Dis.1002251–2256. 10.1094/PDIS-03-16-0391-RE
17
DawsonW. O.GarnseyS. M.TatineniS.FolimonovaS. Y.HarperS. J.GowdaS. (2013). Citrus tristeza virus-host interactions.Front. Microbiol.4:88. 10.3389/fmicb.2013.00088
18
DoljaV. V.KreuzeJ. F.ValkonenJ. P. (2006). Comparative and functional genomics of closteroviruses.Virus Res.11738–51. 10.1016/j.virusres.2006.02.002
19
DorjiK.LakeyL.ChophelS.DorjiS. D.TamangB. (2016). Adoption of improved citrus orchard management practices: a micro study from Drujegang growers. Dagana, Bhutan.Agric. Food Secur.51–8.
20
EdgarR. C. (2004). MUSCLE: a multiple sequence alignment method with reduced time and space complexity.BMC Bioinformatics5:113. 10.1186/1471-2105-5-113
21
FloresR.Ruiz-RuizS.SolerN. (2013). Citrus tristeza virus p23: a unique protein mediating key virus–host interactions.Front. Microbiol4:98. 10.3389/fmicb.2013.00098
22
GhoshD. K.AglaveB.BaranwalV. K. (2008). Simultaneous detection of one RNA and one DNA virus from naturally infected citrus plants using duplex PCR technique.Curr. Sci.251314–1318.
23
GhoshD. K.AglaveB.RoyA.AhlawatY. S. (2009). Molecular cloning, sequencing and phylogenetic analysis of coat protein gene of a biologically distinct Citrus tristeza virus isolate occurring in central India.J. Plant Biochem. Biotechnol.18105–108.
24
GhoshD. K.KokaneA. D.KokaneS. B.TenzinJ.GubyadM. G.WangdiP.et al (2021). Detection and molecular characterization of ‘Candidatus Liberibacter asiaticus’ and Citrus tristeza virus associated with citrus decline in Bhutan.Phytopathology111870–881. 10.1094/PHYTO-07-20-0266-R
25
GhoshD. K.KokaneS. B.GowdaS. (2020). Development of a reverse transcription recombinase polymerase based isothermal amplification coupled with lateral flow immunochromatographic assay (CTV-RT-RPA-LFICA) for rapid detection of Citrus tristeza virus.Sci Rep.10:20593. 10.1038/s41598-020-77692-w
26
GhoshD. K.KokaneS. B.KokaneA. D.WarghaneA. J.MotghareM. R.BhoseS.et al (2018). Development of a recombinase polymerase based isothermal amplification combined with lateral flow assay (HLB-RPA-LFA) for rapid detection of ‘Candidatus Liberibacter asiaticus’.PLoS One13:e0208530. 10.1371/journal.pone.0208530
27
GuindonS.GascuelO. (2003). A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.Syst. Biol.52696–704. 10.1080/10635150390235520
28
GuindonS.DufayardJ. F.LefortV.AnisimovaM.HordijkW.GascuelO. (2010). New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0.Syst. Biol.59307–321. 10.1093/sysbio/syq010
29
HarperS. J. (2013). Citrus tristeza virus: evolution of complex and varied genotypic groups.Front. Microbiol.4:93. 10.3389/fmicb.2013.00093
30
HarperS. J.DawsonT. E.PearsonM. N. (2009). Complete genome sequences of two distinct and diverse Citrus tristeza virus isolates from New Zealand.Arch. Virol1541505–1510.
31
HarperS. J.DawsonT. E.PearsonM. N. (2010). Isolates of Citrus tristeza virus that overcome Poncirus trifoliata resistance comprise a novel strain.Arch. Virol.155471–480. 10.1007/s00705-010-0604-5
32
HerronC. M.MirkovT. E.da GraçaJ. V.LeeR. F. (2006). Citrus tristeza virus transmission by the Toxoptera citricida vector: in vitro acquisition and transmission and infectivity immuno neutralization experiments.J. Virol. Methods134205–211.
33
HilfM. E.KarasevA. V.PappuH. R.GumpfD. J.NiblettC. L.GarnseyS. M. (1995). Characterization of citrus tristeza virus subgenomic RNAs in infected tissue.Virology208576–582. 10.1006/viro.1995.1188
34
HilfM. E.MavrodievaV. A.GarnseyS. M. (2005). Genetic marker analysis of a global collection of isolates of citrus tristeza virus: Characterization and distribution of CTV genotypes and association with symptoms.Phytopathology95909–917. 10.1094/PHYTO-95-0909
35
HordijkW.GascuelO. (2005). Improving the efficiency of SPR moves in phylogenetic tree search methods based on maximum likelihood.Bioinformatics214338–4347. 10.1093/bioinformatics/bti713
36
JonesD. T.TaylorW. R.ThorntonJ. M. (1992). The rapid generation of mutation data matrices from protein sequences.Comput. Appl. Biosci.8275–282. 10.1093/bioinformatics/8.3.275
37
JoshiS. R.GurungB. R. (2009). Citrus in Bhutan: Value Chain Analysis. Department of Agricultural Marketing and Cooperatives.Thimphu: Ministry of Agriculture and Forests, Royal Government of Bhutan.
38
KarasevA. V.BoykoV. P.GowdaS.NikolaevaO. V.HilfM. E.KooninE. V.et al (1995). Complete sequence of the citrus tristeza virus RNA genome.Virology208511–520.
39
KokaneA. D.KokaneS. B.WarghaneA. J.GubyadM. G.SharmaA. K.ReddyM. K.et al (2021a). A rapid and sensitive reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of Indian citrus ringspot virus.Plant Dis.1051346–1355. 10.1094/PDIS-06-20-1349-RE
40
KokaneA. D.LawrenceK.KokaneS. B.GubyadM. G.MisraP.ReddyM. K.et al (2021b). Development of a SYBR Green-based RT-qPCR assay for the detection of Indian citrus ringspot virus.3 Biotech11:359. 10.1007/s13205-021-02903-8
41
KokaneS. B.MisraP.KokaneA. D.GubyadM.WarghaneA. J.SurwaseD.et al (2021c). Development of a real-time RT-PCR method for the detection of Citrus tristeza virus (CTV) and its implication in studying virus distribution in plant.3 Biotech11:431. 10.1007/s13205-021-02976-5
42
KokaneA.LawrenceK.SurwaseD.MisraP.WarghaneA.GhoshD. K. (2020). Development of reverse transcription duplex PCR (RT-d-PCR) for simultaneous detection of the citrus tristeza virus and Indian citrus ringspot virus.Int. J. Innov. Hortic.9124–131.
43
KokaneS. B.KokaneA. D.MisraP.WarghaneA. J.KumarP.GubyadM. G.et al (2020). In-silico characterization and RNA-binding protein based polyclonal antibodies production for detection of citrus tristeza virus.Mol. Cell Probes54:101654. 10.1016/j.mcp.2020.101654
44
LetunicI.BorkP. (2007). Interactive Tree Of Life (iTOL): an online tool for phylogenetic tree display and annotation.Bioinformatics23127–128.
45
LicciardelloG.ScuderiG.FerraroR.GiampetruzziA.RussoM.LombardoA.et al (2015). Deep sequencing and analysis of small RNAs in sweet orange grafted on sour orange infected with two citrus tristeza virus isolates prevalent in Sicily.Arch. Virol.1602583–2589. 10.1007/s00705-015-2516-x
46
LiuZ.ChenZ.HongJ.WangX.ZhouC.ZhouX.et al (2016). Monoclonal antibody-based serological methods for detecting Citrus tristeza virus in citrus groves.Virol. Sin.31324–330. 10.1007/s12250-016-3718-4
47
LuR.FolimonovA.ShintakuM.LiW. X.FalkB. W.DawsonW. O.et al (2004). Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome.Proc. Natl. Acad. Sci. U.S.A,10115742–15747. 10.1073/pnas.0404940101
48
ManjunathK. L.PappuH. R.LeeR. F.NiblettC. L.CiveroloE. L. (1993). Studies on the coat protein genes of four isolates of citrus tristeza closterovirus from India: cloning, sequencing and expression.Int. Organ. Citrus Virol. Conf. Proc.121957–2010.
49
MarroquínC.OlmosA.GorrisM. T.BertoliniE.MartınezM. C.CarbonellE. A.et al (2004). Estimation of the number of aphids carrying citrus tristeza virus that visit adult citrus trees.Virus Res.100101–108. 10.1016/j.virusres.2003.12.018
50
MartínS.SambadeA.RubioL.VivesM. C.MoyaP.GuerriJ.et al (2009). Contribution of recombination and selection to molecular evolution of citrus tristeza virus.J. Gen. Virol.901527–1538. 10.1099/vir.0.008193-0
51
MatsumuraE. E.Coletta-FilhoH. D.NouriS.FalkB. W.NervaL.OliveiraT. S.et al (2017). Deep sequencing analysis of RNA from citrus plants grown in a citrus sudden death-affected area reveals diverse known and putative novel viruses.Viruses9:92. 10.3390/v9040092
52
MeenaR. P.BaranwalV. K. (2016). Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna-and mandari-viruses along with huanglongbing bacterium in citrus trees.J. Virol. Methods23558–64. 10.1016/j.jviromet.2016.05.012
53
MehtaP.BrlanskyR. H.GowdaS.YokomiR. K. (1997). Reverse-transcription polymerase chain reaction detection of Citrus tristeza virus in aphids.Plant Dis.811066–1069. 10.1094/PDIS.1997.81.9.1066
54
MelzerM. J.BorthW. B.SetherD. M.FerreiraS.GonsalvesD.HuJ. S. (2010). Genetic diversity and evidence for recent modular recombination in Hawaii an Citrus tristeza virus.Virus Genes40111–118. 10.1007/s11262-009-0409-3
55
MorenoP.AmbrosS.Albiach-MartiM. R.GuerriJ.PenaL. (2008). Citrus tristeza virus: a pathogen that changed the course of the citrus industry.Mol. Plant Pathol.9251–268. 10.1111/j.1364-3703.2007.00455.x
56
NicholasK. B.NicholasJr, H. BDeerfieldD. W. (1997). Embnet News GeneDoc: Analysis and Visualization of Genetic Variation, Vol. 4. Nijmegen: EMBnet Administration, 14.
57
PappuH.PappuS.NiblettC.LeeR.CiveroloE. (1993). Comparative sequence analysis of coat protein of biologically distinct citrus tristeza clostero virus isolate.Virus Genes7255–264. 10.1007/BF01702586
58
RoyA.BrlanskyR. H. (2010). Genome analysis of an orange stem pitting citrus tristeza virus isolate reveals a novel recombinant genotype.Virus Res.151118–130. 10.1016/j.virusres.2010.03.017
59
RoyA.ChoudharyN.HartungJ. S.BrlanskyR. H. (2013). The prevalence of the citrus tristeza virus trifoliate resistance breaking genotype among puerto rican isolates.Plant Dis.971227–1234. 10.1094/PDIS-01-12-0012-RE
60
RoyA.ManjunathK. L.BrlanskyR. H. (2005a). Assessment of sequence diversity in the 5′-terminal region of Citrus tristeza virus from India.Virus Res.11132–142. 10.1016/j.virusres.2005.04.023
61
RoyA.FayadA.BartheG.BrlanskyR. H. (2005b). A multiplex polymerase chain reaction method for reliable, sensitive and simultaneous detection of multiple viruses in citrus trees.J. Virol. Methods12947–55. 10.1016/j.jviromet.2005.05.008
62
RubioL.AyllónM. A.KongP.FernándezA.PolekM.GuerriJ.et al (2001). Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination.J. Virol.758054–8062. 10.1128/jvi.75.17.8054-8062.2001
63
Ruiz-RuizS.MorenoP.GuerriJ.AmbrosS. (2006). The complete nucleotide sequence of a severe stem pitting isolate of Citrus tristeza virus from Spain: comparison with isolates from different origins.Arch. Virol.151387–398. 10.1007/s00705-005-0618-6
64
Ruiz-RuizS.MorenoP.GuerriJ.AmbrósS. (2007). A real-time RT-PCR assay for detection and absolute quantitation of Citrus tristeza virus in different plant tissues.J. Virol. Methods14596–105. 10.1016/j.jviromet.2007.05.011
65
SatyanarayanaT.GowdaS.MawassiM.Albiach-MartíM. R.AyllónM. A.RobertsonC.et al (2000). Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly.Virology278253–265. 10.1006/viro.2000.0638
66
SimmonsM. P.NortonA. P. (2014). Divergent maximum-likelihood-branch-support values for polytomies.Mol. Phylogenet Evol.7387–96. 10.1016/j.ympev.2014.01.018
67
TarafdarA.GodraS.DwivediS.JayakumarB. K.BiswasK. K. (2013). Characterization of Citrus tristeza virus and determination of genetic variability in North-east and South India.Indian Phytopathol.66, 302–307.
68
TatineniS.RobertsonC. J.GarnseyS. M.Bar-JosephM.GowdaS.DawsonW. O. (2008). Three genes of Citrus tristeza virus are dispensable for infection and movement throughout some varieties of citrus trees.Virology376297–307. 10.1016/j.virol.2007.12.038
69
TatineniS.RobertsonC. J.GarnseyS. M.DawsonW. O. (2011). A plant virus evolved by acquiring multiple nonconserved genes to extend its host range. Proc. Natl. Acad. Sci.108, 17366–17371.
70
TipuS. A.FantazyK. A. (2014). Supply chain strategy, flexibility, and performance: a comparative study of SMEs in Pakistan and Canada.Int J Logist Manag.25399–416.
71
VivesM. C.RubioL.SambadeA.MirkovT. E.MorenoP.GuerriJ. (2005). Evidence of multiple recombination events between two RNA sequence variants within a Citrus tristeza virus isolate.Virology331232–237. 10.1016/j.virol.2004.10.037
72
WangJ.ZhouT.CaoM.ZhouY.LiZ. (2019). First report of citrus tristeza virus trifoliate resistance-breaking (RB) genotype in Citrus grandis in China.J. Plant Pathol.101:451.
73
WarghaneA.KokaneA.KokaneS.MotghareM.SurwaseD.PalchoudhuryS.et al (2020). Molecular detection and coat protein gene based characterization of citrus tristeza virus prevalent in Sikkim state of India.Indian Phytopathol.73135–143.
74
WarghaneA.MisraP.BhoseS.BiswasK. K.SharmaA. K.ReddyM. K.et al (2017a). Development of reverse transcription-loop mediated isothermal amplification (RT-LAMP) assay for rapid detection of Citrus tristeza virus.J. Virol. Methods2506–10.
75
WarghaneA.MisraP.GhoshD. K.ShuklaP. K.GhoshD. K. (2017b). Diversity and characterization of citrus tristeza virus and ‘Candidatus Liberibacter asiaticus’ associated with citrus decline in India.Indian Phytopathol70359–367.
76
WuG. A.TerolJ.IbanezV.López-GarcíaA.Pérez-RománE.BorredáC.et al (2018). Genomics of the origin and evolution of Citrus.Nature554311–316. 10.1038/nature25447
77
YangZ. N.MathewsD. M.DoddsJ. A.MirkovT. E. (1999). Molecular characterization of an isolate of citrus tristeza virus that causes severe symptoms in sweet orange.Virus Genes19131–142. 10.1023/a:1008127224147
78
YokomiR. K.SelvarajV.MaheshwariY.SaponariM.GiampetruzziA.ChiumentiM.et al (2017). Identification and characterization of citrus tristeza virus isolates breaking resistance in trifoliate orange in California.Phytopathol107901–908. 10.1094/PHYTO-01-17-0007-R
Summary
Keywords
citrus tristeza virus, genomic diversity, sequencing and phylogenetic analysis, RT-PCR, genomic regions
Citation
Ghosh DK, Kokane A, Kokane S, Mukherjee K, Tenzin J, Surwase D, Deshmukh D, Gubyad M and Biswas KK (2022) A Comprehensive Analysis of Citrus Tristeza Variants of Bhutan and Across the World. Front. Microbiol. 13:797463. doi: 10.3389/fmicb.2022.797463
Received
18 October 2021
Accepted
19 January 2022
Published
08 April 2022
Volume
13 - 2022
Edited by
Tao Jin, Guangdong Magigene Biotechnology Co., Ltd., China
Reviewed by
Islam Hamim, Bangladesh Agricultural University, Bangladesh; Susheel Kumar, National Botanical Research Institute (CSIR), India
Updates

Check for updates
Copyright
© 2022 Ghosh, Kokane, Kokane, Mukherjee, Tenzin, Surwase, Deshmukh, Gubyad and Biswas.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Dilip Kumar Ghosh, ghoshdk@hotmail.com
This article was submitted to Virology, a section of the journal Frontiers in Microbiology
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.