ORIGINAL RESEARCH article

Front. Microbiol., 09 October 2024

Sec. Virology

Volume 15 - 2024 | https://doi.org/10.3389/fmicb.2024.1474552

Genetic diversity and evolution of porcine hemagglutinating encephalomyelitis virus in Guangxi province of China during 2021–2024

  • 1. School of Basic Medical Sciences, Youjiang Medical University for Nationalities, Baise, China

  • 2. College of Animal Science and Technology, Guangxi University, Nanning, China

  • 3. Guangxi Center for Animal Disease Control and Prevention, Nanning, China

Abstract

Porcine hemagglutinating encephalomyelitis virus (PHEV) is the only known porcine neurotropic coronavirus, which is prevalent worldwide at present. It is of great significance to understand the genetic and evolutionary characteristics of PHEV in order to perform effective measures for prevention and control of this disease. In this study, a total of 6,986 tissue samples and nasopharyngeal swabs were collected from different regions of Guangxi province in southern China during 2021-2024, and were tested for PHEV using a quadruplex RT-qPCR. The positivity rate of PHEV was 2.81% (196/6,986), of which tissue samples and nasopharyngeal swabs had 2.05% (87/4,246) and 3.98% (109/2,740) positivity rates, respectively. Fifty PHEV positive samples were selected for PCR amplification and gene sequencing. Sequence analysis revealed that the nucleotide homology and amino acid similarities of S, M, and N genes were 94.3%-99.3% and 92.3%-99.2%, 95.0%-99.7% and 94.7%-100.0%, 94.0%-99.5% and 93.5%-99.3%, respectively, indicating M and N genes were more conservative than S gene. Phylogenetic trees based on these three genes revealed that PHEV strains from different countries could be divided into two groups G1 and G2, and the PHEV strains from Guangxi province obtained in this study distributed in subgroups G1c and G2b. Bayesian analysis revealed that the population size of PHEV has been in a relatively stable state since its discovery until it expanded sharply around 2015, and still on the slow rise thereafter. S gene sequences analysis indicated that PHEV strains existed variation of mutation, and recombination. The results indicated that the prevalent PHEV strains in Guangxi province had complex evolutionary trajectories and high genetic diversity. To the best of our knowledge, this is the first report on the genetic and evolutionary characteristics of PHEV in southern China.

1 Introduction

Porcine hemagglutinating encephalomyelitis (PHE) is a viral disease of pigs caused by PHE virus (PHEV). PHEV, which belongs to coronaviridae family, Betacoronavirus genus, Embecovirus subgenus, is the only known porcine neurotropic coronavirus (; ). PHEV is a large enveloped, single-stranded positive-sense RNA virus, with approximately 30 kb genome containing at least 11 open reading frames (ORFs) (). The first two ORFs encode 16 non-structural proteins (NSP1-NSP16), and the rest of ORFs encode structural proteins including surface spike glycoprotein (S), transmembrane glycoprotein (M), nucleocapsid protein (N), and membrane protein (E), and auxiliary proteins including NS2, NS4.9, NS12.7, and N2 proteins (). In addition, PHEV also has a glycoprotein encoded by ORF3 related to envelope, which is called hemagglutinin-esterase (HE). Due to this protein, PHEV has hemagglutination properties that other porcine coronaviruses do not have (). S, M, and N proteins play important roles in coronaviruses. S protein belongs to class I fusion protein (), a trimer structure, that can be fixed on the viral envelope and decorates the surface of the virus particles with its outer domain, which is the reason why coronavirus has a unique coronal spinous process structure (). In the key process of coronavirus infecting host, S protein, which contains main antigens and antiviral neutralization determinants (), can modify the surface of virions, induce neutralizing antibody response, and promote virus invasion into host cells and transmission in the host through interaction with HE protein (). These functions make S protein play an important role in the development, diagnosis, and treatment of coronavirus vaccine (). In addition, some regions of S protein can interact with nerve cell adhesion molecule (NCAM) expressed on the surface of neurons, which makes S protein play an important role in the process of PHEV infecting neurons (; ). M protein is the most abundant protein in coronavirus particles (). The various functions of M protein in the viral infection cycle and interferon antagonism make it the most conservative and constrained structural protein of the virus (). M protein can adopt two different conformations, an elongated one and a compact one (), which are related to different properties. The appropriate proportion of these two conformations also determines the final viral particle structure. In addition to its affinity to itself, M protein can bind to S protein, N protein, E protein, and genomic RNA. This is because it has both homotypic and heterotypic associative properties (), so M protein also plays an important role as an adhesive in virus assembly (; ). N protein is the most abundant coronavirus antigen produced during infection (), and it is also the only nucleocapsid protein that interacts with viral RNA to form a spiral ribonucleoprotein complex (). It plays a role in the synthesis and transcription of viral RNA and the replication and regulation of metabolism in infected cells (; ). The most important role of N protein is that, as a capsid protein, it protects genomic RNA through packaging and maintains the stability of RNA in the virus (). The binding of N protein to leader RNA is essential for maintaining the organized RNA conformation of viral genome replication and transcription (; ). Some studies have also shown that the comparative study of N proteins of different coronaviruses can provide valuable information for host specificity and the interaction between N proteins and host cell proteins (; ). These provide new insights into the development of new antiviral therapies for the interaction between host cell proteins and N proteins (). Therefore, S, M, and N genes are usually taken as the target genes for epidemiological study due to their important roles in coronaviruses.

PHE was first discovered in Ontario, Canada in 1957 (). Piglets infected with PHEV showed vomiting, anorexia, constipation, and severe progressive weight loss. Then, it was systematically reported that infected newborn piglets developed anorexia, trembling, curling, and vomiting, followed by ataxia, hyperactivity, slapping, and other neurological symptoms, and died 2–3 days after the appearance of clinical symptoms (; ). Pigs are the only naturally infected host of PHEV, and PHEV is the only known neurotropic coronavirus in pigs. Besides, mice and Wistar rats artificially infected with PHEV also show neurological symptoms (; ). PHEV can infect pigs of all ages, but the clinical symptoms after infection are not only related to the virulence of the virus, but also related to the age of infected pigs. The morbidity and mortality of infected pigs are closely related to their ages (). For growing and adult pigs, PHEV infection is subclinical because it induces strong humoral immune response (; ), while for newborn piglets, PHEV infection is fatal. According to clinical symptoms, PHE can be divided into two types: encephalomyelitis type and vomiting exhaustion type. When newborn piglets are infected with PHEV, it invades the nervous system, resulting in sneezing, coughing, vomiting, and other nervous system symptoms, including ataxia, muscle tremor, hyperesthesia, and finally dyspnea, side lying, coma, and then death. The mortality rate of newborn piglets infected with PHEV is almost up to 100% (). The main symptoms of vomiting exhaustion are digestive tract symptoms, including vomiting, diarrhea, weight loss, and so on (; ; ). It is also worth noting that the elderly pigs infected with PHEV developed respiratory symptoms reported at an exhibition in 2015 (). There were reports that the main route of PHEV infection was through the respiratory epithelium, and sneezing and coughing were the first symptoms that might be observed in the infected pigs, indicating the effects of PHEV on the upper respiratory tract and lungs of pigs (; ; ). However, the specific role of PHEV as a respiratory pathogen needs further study.

Even though PHEV is one of the first porcine coronaviruses to be discovered and isolated (), its harm to the pig industry has usually been ignored. Because there are no specific therapeutic drugs and commercial vaccines, PHEV has been prevalent around the world and under constant mutation. In recent years, new variants of PHEV have also been found in China, which can cause respiratory diseases in growing pigs and adult pigs (). In 2015, there were cases of respiratory diseases caused by PHEV infection in adult pigs at an exhibition in Michigan, USA (). Recently, a strain of PHEV-causing diarrhea in pigs was also isolated in South Korea (). All these events indicated that PHEV has been constantly mutating in the process of evolution. PHEV has been found in Guangxi province, southern China (). In this study, the clinical tissue samples (including brain, lung, liver, and spleen of each pig) and nasopharyngeal swabs were collected from pig farms, harmless treatment plants, and slaughterhouses in Guangxi province during 2021–2024, and tested for PHEV using a quadruplex real-time quantitative RT-PCR (RT-qPCR) (). The PHEV-positive samples were selected to amplify S, M, and N genes, and then sequence and analyze in order to understand the genetic characteristics and evolution of PHEV in Guangxi province. To our best knowledges, this is the first report on the genetic and evolutionary analysis of PHEV in southern China.

2 Materials and methods

2.1 Detection of clinical samples

From January 2021 to January 2024, 4,246 tissue samples (including brain, lymph nodes, lung, and spleen of each pig, and the tissue homogenate from each pig was considered as one sample when tested), and 2,740 nasopharyngeal swabs were collected from pig farms, slaughterhouses, and harmless treatment plants in 14 regions in Guangxi province, southern China. After collection, the samples were transported to our laboratory under ≤4°C within 8 h, and then stored at −80°C until use.

The clinical tissue samples (0.05 g of brain, lymph node, lung, and spleen each) were put into 2.0 mL EP tube, added 1.0 mL phosphate buffer solution (PBS, pH7.2, W/V = 1:5) and a sterilized steel ball, ground 5 min in an oscillatory grinder, frozen and thawed 3 times, and then centrifuged at 4°C (12 000 rpm for 5 min) to obtain the supernatant. The nasopharyngeal swabs contained in 2.0 mL EP tube were put into 1.0 mL PBS (pH7.2), vibrated 30 s, frozen and thawed 3 times, and then centrifuged at 4°C (12 000 rpm for 5 min) to obtain the supernatant. Two hundred microlitter supernatants of tissue samples and nasopharyngeal swabs were used to extract total nucleic acids using MiniBEST Viral DNA/RNA Nucleic Acid Extraction Kit Ver.5.0 (TaKaRa, Dalian, China). The extracted nucleic acids were stored at −80°C until use.

The total DNA/RNA of clinical samples were tested for PHEV using a quadruplex RT-qPCR developed in our laboratory (). Then, 50 PHEV-positive samples were selected for sequence analysis. The total DNA/RNAs were extracted from the PHEV-positive samples, reverse transcribed into cDNA using PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China), and used to amplify and sequence S, M, and N genes of PHEV.

2.2 Amplification of S, M, and N genes

Based on PHEV genome sequence downloaded from the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/) (GenBank accession number: KY419112.1), specific primers were designed to amplify S, M, and N genes of PHEV (Table 1). The cDNAs of PHEV-positive samples were used as templates to amplify S, M, and N gene fragments using the designed primers (Table 1). The PCR amplification system was as follows: Premix Taq (Ex Taq Version 2.0 plus dye) (TaKaRa, Dalian, China) 25 μL, forward/reverse primer (20 μM) 1 μL each, cDNA 5 μL, nuclease-free distilled water up to total volume of 50 μL. The amplification procedures were as follows: S1 gene fragment: 35 cycles of 95°C 15 s, 61°C 30 s, and 72°C 30 s, then 72°C 10 min; S2, S3, S4, S5, N1, and N2 gene fragments: 35 cycles of 95°C 15 s, 57°C 30 s, and 72°C 30 s, then 72°C 10 min; M gene fragment: 35 cycles of 95°C 15 s, 54°C 30 s, and 72°C 30 s, then 72°C 10 min.

Table 1

GenePrimerSequence (5′ → 3′)Product size/bp
SPHEV-S1-FGCCCTACTGCTGCTAGTATTATT868
PHEV-S1-RGGTCACAAAACCAGTATCTGT
PHEV-S2-FCAGATACTGGTTTTGTGACCAAG948
PHEV-S2-RCTTTRGATTGCGGACAAGTCC
PHEV-S3-FAGAGGCCTTCATGATGCTGT905
PHEV-S3-RGTAAAGCGATAACCTGTAGT
PHEV-S4-FCAGCTAGTGCTGTAAGTACT1,099
PHEV-S4-RTCACTAAGCTGCTGAGAAAC
PHEV-S5-FGGCTGTTGTTAATGCAAATGC971
PHEV-S5-RGACGAAATTAATCGTCATGTG
MPHEV-M-FTGTGTATTCAACTTTGCGGTATG902
PHEV-M-RGATTTCCAGAGGACGCTCTAC
NPHEV-N1-FGGACACCGCATTGTTGAGAAATA767
PHEV-N1-RTTGCCAGAACGAGACTAGCAA
PHEV-N2-FCGGTACTCCCTCAAGGTTACTA876
PHEV-N2-RGAGTGCCTTATCCCGACTTTC

Primers for amplification of PHEV S, M, and N genes.

R = A/G.

2.3 Sequencing of S, M, and N genes

The PCR products were purified using MiniBEST DNA Fragment Purification Kit Ver.4.0 (TaKaRa, Dalian, China), ligated into pMD18-T vector (TaKaRa, Dalian, China), and then transformed into E. coli. DH5α competent cells (TaKaRa, Dalian, China). The positive clones were inoculated in LB medium containing ampicillin, cultured at 37°C for 20–24 h, and sequenced by IGE Biotechnology LTD (Guangzhou, China). The sequences obtained by sequencing was spliced using the EditSeq tool in Lasergene DNAstar 7.0 software1 to obtain the complete gene sequences of S, M, and N genes. The obtained complete gene sequences were aligned using the BLAST tool at NCBI.2

2.4 Sequence analysis of S, M, and N genes

The obtained S, M, and N gene sequences in this study were compared with 51 S gene sequences, 48 M gene sequences, and 54 N gene sequences of PHEV downloaded from NCBI (Supplementary Tables S1–S3), which were collected from China, America, Canada, Korea, Belgium, the Netherlands, and the Czech Republic. The similarities of nucleotides and amino acids among the obtained sequences and reference sequences were analyzed using Clustal W algorithm of Bioedit software.3 The best DNA/protein models of S, M, and N genes were found using MEGA.X software.4 According to the optimal nucleotide models, the phylogenetic trees of S, M, and N genes were constructed using MEGA.X based on the maximum likelihood (ML) method, and then optimized through the online website Interactive Tree of Life (iTOL)5 ().

2.5 Bayesian temporal dynamics analysis of S gene

A total of 101 S gene sequences, including 50 sequences obtained in this study and 51 sequences downloaded from NCBI (Supplementary Table S1), were aligned using the MEGA.X software (see text footnote 4) The root-to-peak genetic distances of these sequences were determined using the TempEst v1.6 in BEAST v1.10.4 software6 () to determine the temporal structure (). The divergence times of PHEV strains in BEAST v1.10.4 software (see text footnote 6) were derived using Bayesian Markov chain Monte Carlo (MCMC) approach (with the strict clock), Bayesian skyline coalescent, and the optimal nucleotide substitution model (; ). Then, the MCMC was run in parallel on 3 chains with 200 million steps per chain and a burn-in of 10%. Convergence was visually confirmed for all parameters (ESS > 200) by Tracer v1.6 in BEAST v1.10.4 software (see text footnote 6) (). The maximum clade credibility (MCC) tree was obtained using Tree Annotator in BEAST v1.10.4 software (see text footnote 6), and visualized through Figtree v1.4.4 (see text footnote 6) ().

2.6 Genome recombination events analysis

The S amino acid sequences of 50 PHEV strains obtained in this study were compared with those of the reference strains using BioEdit software (see text footnote 3). Then the recombination events analysis of S gene was performed on Recombination Detection Program (RDP4) software,7 with a window size of 500 bp and a p-value of 0.05. According to the manual of RDP4, seven algorithms in the RDP4 software, including RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan, and 3Seq, were selected and analyzed for the recombination event of all S gene sequences. Sequences were considered to be potentially recombinant only when at least 6 algorithms supported them, and the putative recombination events were also verified using the SimPlot software.8

3 Results

3.1 Detection results of clinical samples

The 6,986 clinical samples (4,246 tissue samples and 2,740 nasopharyngeal swabs) collected from 14 regions in Guangxi province during 2021–2024 were tested for PHEV using a quadruplex RT-qPCR (). The PHEV positivity rate in clinical samples was 2.81% (196/6,986), of which tissue samples and nasopharyngeal swabs had 2.05% (87/4,246) and 3.98% (109/2,740) positivity rates, respectively (Supplementary Table S4). Of 14 regions in Guangxi province, Laibin had the highest positivity rate of 13.18%, while no positive sample was found in samples from 5 regions, i.e., Guilin, Liuzhou, Wuzhou, Qinzhou, and Beihai. The distribution of the positive samples in Guangxi province is shown in Figure 1.

Figure 1

3.2 Amplification and sequencing of S, M, and N genes

Of the 196 PHEV positive samples, 50 samples were selected basing on sampling site, sampling date, and Ct values, and used for gene amplification, and sequence analysis. The target fragments of S, M, and N genes were amplified using the specific primers (Table 1). After purification, ligation, transformation, sequencing, and splicing, 50 S, 50 M, and 50 N gene sequences of PHEV strains were obtained. The gene sequences were uploaded to NCBI GenBank under the accession numbers: PP646298-PP646347 for S gene, PP646348-PP646397 for M gene, and PP646398-PP646447 for N gene. The information on these gene sequences is shown in Supplementary Tables S1–S3.

3.3 Similarity analysis of S, M, and N genes

The S gene nucleotide and amino acid sequences obtained in this study and reference strains were analyzed using Clustal W algorithm of BioEdit software. The results revealed that the nucleotide and amino acid similarities of S, M, and N genes among 50 PHEV strains obtained in the study were 94.5–99.8% and 92.5–99.6%, 94.6–100.0% and 93.4–100.0%, and 96.8–100% and 95.9–100.0%, respectively. The nucleotide and amino acid similarities among 50 strains and reference strains of 51 S, 48 M, and 54 N genes were 94.3–99.3% and 92.3–99.2%, 95.0–99.7% and 94.7–100.0%, and 94.0–99.5% and 93.5–99.3%, respectively (Table 2).

Table 2

GeneSimilarity among the strains obtained in this studySimilarity among the strains obtained in this study and the reference strains
Nucleotide (%)Amino acid (%)Nucleotide (%)Amino acid (%)
S94.5–99.892.5–99.694.3–99.392.3–99.2
M94.6–100.093.4–100.095.0–99.794.7–100.0
N96.8–100.095.9–100.094.0–99.593.5–99.3

The similarity analysis of S, M, and N gene sequences.

3.4 Phylogenetic analysis of S, M, and N genes

3.4.1 Phylogenetic analysis based on S gene sequences

Basing on the best nucleotide substitution model: TN93 + G + I, a phylogenetic tree was generated based on S gene sequences of 50 PHEV strains obtained in this study and 51 reference PHEV strains downloaded from NCBI, which was constructed using maximum likelihood (ML) after 1,000 bootstrap tests (Figure 2). The phylogenetic tree indicated that PHEV strains were classified into two groups. The first group included the strains obtained in this study (including 18 strains from Nanning, 1 strain from Chongzuo, 1 strain from Hezhou, 6 strains from Yulin), and other 17 strains collected from other several provinces in China. The second group included the strains from the United States (12 strains), China (18 strains), Canada (1 strain), Belgium (1 strain), Korea (1 strain), the Netherlands (1 strain), and 24 strains obtained in this study.

Figure 2

3.4.2 Phylogenetic analysis based on M gene sequences

Basing on the best nucleotide substitution model: TN93 + G, a phylogenetic tree was generated based on M gene sequences of 50 PHEV strains obtained in this study and 48 reference PHEV strains downloaded from NCBI, which was constructed by ML after 1,000 bootstrap tests (Figure 3). The phylogenetic tree revealed that all PHEV strains were divided into two groups. The first group included the strains from China (15 strains), Korea (1 strain), and 39 strains obtained in this study, including those from Nanning (21 strains), Chongzuo (2 strains), Hezhou (5 strains), Yulin (7 strains), and Laibin (4 strains). The second group contained the other 11 strains obtained in this study, 12 strains from the United States, 18 strains from other provinces in China, 1 strain from Canada, and 1 strain from Belgium.

Figure 3

3.4.3 Phylogenetic analysis based on N gene sequences

Basing on the best nucleotide substitution model: GTR + G + I, a phylogenetic tree was generated based on N gene of 50 PHEV strains obtained in this study and 54 reference PHEV strains downloaded from NCBI, which was constructed by ML after 1,000 bootstrap tests (Figure 4). The phylogenetic tree indicated that all PHEV strains were divided into two groups. The first group included all 50 strains obtained in this study, and 25 strains from other provinces of China, 10 strains from the United States, 1 strain from Canada, 1 strain from Korea. The second group included strains obtained from China (5 strains), the United States (2 strains), the Czech Republic (9 strains), and Belgium (1 strain).

Figure 4

3.5 Analysis of S gene amino acid sequences

To further analyze genetic characteristics of PHEV, the S gene amino acid sequences of 50 PHEV strains obtained in this study were compared with those of the reference strains downloaded from NCBI using BioEdit software. The earliest PHEV strain 67 N (GenBank accession no. AY078417) was used as the prototype reference strain. The results showed that the 50 PHEV strains obtained in this study had multiple mutations compared with the reference strain (Table 3). Almost all of the 50 PHEV strains obtained in this study had amino acid mutations at positions 22, 169, 253, 512, 611, 804, 1,013, 1,189, and 1,332 (Supplementary Figure S1). Some of the 50 PHEV strains obtained in this study had amino acid mutations at sites 8, 25, 73, 78, 98, 101, 111, 141, 154, 352, 407, 410, 416, 552, 557, 608, 703, 705, 756, 770, 884, 959, 1,034, 1,066, 1,167, 1,198, and 1,252.

Table 3

PositionMutationPositionMutationPositionMutation
8S → T/F352I → T770A → S/V
22T → N407V → L804R → S
25L → S410S → F884P → S
73A → S416F → S959L → S
78M → V512K → N1,013A → S
98P → S552G → A1,034A → S/L
101D → H557D → E1,066A → V
111R → K608G → S1,167I → M/T/L
141E → K/D611I → N1,189S → G
154L → F703I → V/A1,198Q → R
169H → N/Q705R → G1,252I → T/N
253N → D756F → V1,332C → F

Mutations of S gene amino acid sequences of PHEV strains obtained in this study.

3.6 Bayesian time dynamic analysis of S gene

Based on PHEV S gene sequences, the temporal scale MCC tree was constructed using BEAST v1.10.4 software and Figtree v1.4.4 (Figure 5). The results showed that PHEV strains were divided into two groups (Group 1 and Group 2), while Group 1 could be further divided into three subgroups, i.e., Group 1a, Group 1b, and Group 1c, and Group 2 could be further divided into two subgroups, i.e., Group 2a, and Group 2b. The PHEV strains obtained in this study were located in two subgroups, i.e., Group 1c and Group 2b, and they distributed in different clades, which was consistent with the phylogenetic tree constructed using MEGA.X software (Figure 2). The Bayesian skyline (Figure 6) showed the adequate population size of PHEV transmission, which has been in a relatively stable state since its discovery until it expanded sharply around 2015. On the whole, the effective population size of PHEV has been on the rise.

Figure 5

Figure 6

3.7 Genetic evolution rates of S, M, and N genes

The genetic evolution rates of PHEV S, M, and N genes were analyzed using BEAST v1.10.4 software. The results showed that the genetic evolution rates of S, M, and N genes were 2.655 × 10−4, 5.436 × 10−4, and 3.106 × 10−4 (substitution/site/year), respectively (Table 4). The results indicated that M, and N genes were more conservative than S gene, but there was no significant difference among the genetic evolution rates of S, M, and N genes.

Table 4

GeneMean evolutionary rate (substitution/site/year)95% HPD (substitution/site/year)
S2.655 × 10−42.187 × 10−4- 3.141 × 10−4
M5.436 × 10−43.322 × 10−4- 7.556 × 10−4
N3.106 × 10−42.273 × 10−4- 4.006 × 10−4

Estimation of evolution rates of S, M, and N genes.

3.8 Recombination analysis of S gene sequences

The recombination analysis of PHEV S gene was analyzed using RDP4.0 software, and the results were further confirmed using SimPlot analysis. The results indicated that two PHEV strains showed potential recombination events. The GXNN2023-04 strain derived from recombination between GXNN2023-05 and OQ305205.1: PHEV/GD/2017 strains, and the breakpoints for the recombination were found in 852 nt-2673 nt. The GXNN2024-02 strain derived from recombination between GXYL2023-03 and GXNN2023-05 strains, and the breakpoints for the recombination were found in 2621 nt-3549 nt (Figure 7).

Figure 7

4 Discussion

Six coronaviruses are known to infect pigs, including PHEV, transmissible gastroenteritis virus (TGEV), porcine respiratory coronavirus (PRCoV), porcine epidemic diarrhea virus (PEDV), swine acute diarrhea syndrome coronavirus (SADS-CoV), and porcine deltacoronavirus (PDCoV) (). In addition, the recombinant coronavirus derived from TGEV and PEDV recombinant was reported, which need to pay more attention and do further study (). Since the PHEV infected adult pigs are usually subclinical, the economic loss of this disease has usually been ignored. PHEV was first discovered in Canada in 1957, and it has been reported in Europe, America, and Asia (; ; ; ; ; ; ; ). In China, and reported the epidemic of encephalitis in PHEV-infected piglets. The pigs at an exhibition in Michigan in 2015 showed influenza-like diseases, and were confirmed to be infected with PHEV. The screening of all samples showed that the positivity rate of PHEV was as high as 38.7%. In addition, variants of PHEV were also found, and 10 full sequences and one partial sequence were obtained (). After that, there was an acute outbreak of diarrheal disease in newborn piglets in a farm in Seoul, Korea in 2021, and the mortality rate of piglets reached 40%. It was confirmed that these diarrhea piglets were infected with PHEV (; ). In recent years, respiratory phenotypic variants of PHEV have also been found in China. confirmed the prevalence of PHEV in at least eight provinces in southeastern China through large-scale epidemiological surveillance. Twenty-four PHEV strains were analyzed, and there was extensive recombination between these respiratory phenotypic PHEV and classical PHEV and previous respiratory variants. These results indicated that PHEV has been prevalent in many countries around the world, and showed variant in pig herds.

The 6,896 clinical tissue samples and nasopharyngeal swabs from Guangxi province during 2021–2024 were detected for PHEV using a multiplex RT-qPCR (). Fifty PHEV-positive samples were selected for amplification and sequencing S, M, and N genes, and these gene sequences were compared with the reference strains downloaded from NCBI. The nucleotide and amino acid similarities between S, M, and N genes of 50 PHEV strains obtained in this study were 94.5–99.8% and 92.5–99.6%, 94.6–100.0% and 93.4–100.0%, 96.8–100.0% and 95.9–100.0%, respectively, indicating there were genetic differences among prevalent strains. The nucleotide and amino acid similarities of S, M, and N genes between the strains obtained in this study and the reference strains were 94.3–99.3% and 92.3–99.2%, 95.0–99.7% and 94.7–100.0%, 94.0–99.5% and 93.5–99.3%, respectively, indicating significant differences between Guangxi’s strains and other domestic and abroad strains. Of the phylogenetic tree based on S gene sequences, PHEV strains were divided into two groups. Twenty-six strains of 50 PHEV strains obtained in this study had high homology with SC and GD strains isolated by and some Chinese respiratory variant PHEV (rvPHEV) strains newly found by . The other 24 PHEV strains had high homology with 67 N strain which was first found and isolated in the United States, 10 respiratory phenotypic PHEV strains isolated in North America in 2015, Korean, Belgian and Dutch strains, and some Chinese rvPHEV strains found by . The PHEV strains in the phylogenetic trees based on M and N genes were also divided into two groups, and 50 PHEV strains obtained in this study were located in two groups. Several other reports also showed that the prevalent PHEV strains could be divided in two groups based on complete genome sequence, and the phylogenetic tree based on S gene sequences could also divided into two groups and showed similar topology with those based on complete genome sequence (; ; ; ). It is noteworthy that the newly identified respiratory variant PHEV (rvPHEV) strains were discovered to cause exclusively respiratory symptoms (), and the PHEV strains obtained in this study distributed in G1c and G2b, which were corresponded to rvPHEV-L-2 and rvPHEV-L-1 reported by , indicating that all the strains obtained in Guangxi province belonged to rvPHEV clades. The effect of these mutations on viral virulence and pathogenesis needs further study. To sum up, the Chinese PHEV strains from other provinces and the 50 PHEV strains obtained in this study are distributed in two subgroups basing on S, M, and N gene sequences, which indicated that the PHEV strains obtained in this study has complex evolutionary trajectories and high genetic diversity.

The Bayesian skyline analysis showed that the effective population size of PHEV has been in a relatively stable state since its discovery, until it expanded sharply around 2015, and then stabilized again, but it is generally higher than the adequate population size before 2015. Unlike PHEV, other porcine coronaviruses, including PEDV and PDCoV, maintained a stable trend in Guangxi province in recent years (; ; ). The accelerated mutation of classical PHEV strains and the emergence of new variants that cause respiratory and diarrhea symptoms are new situations that deserve our high attention (; ; ; ). In this study, the genetic evolution rates of S, M, and N genes were 2.655 × 10−4, 5.436 × 10−4 and 3.106 × 10−4 (substitution/site/year), respectively, indicating M and N genes were more conservative than S gene. In addition, recombination analysis of S gene showed that two PHEV strains existed potential recombination events, indicating genetic diversity of PHEV strains in Guangxi province. Since the relative conservation of M and N gene, and the high diversity of S gene of PHEV (Tables 2, 4), this study focused on the Bayesian time dynamic analysis, amino acid mutation, and recombinant analysis of S gene, but not M and N genes.

Since PHEV was first discovered in Canada in 1957, it has been reported in America, Europe, and Asia (; ; ; ; ; ; ; ). PHEV is prevalent all over the world. However, PHEV can only cause encephalitis in piglets, and are subclinical to infected adult pigs. Therefore, PHEV has a relatively small impact on pig herds compared with other pathogenic coronaviruses, so it has not attracted academic attention for a long time. Since the beginning of this century, PHEV has been found and isolated in growing pigs or adult pigs with respiratory and digestive symptoms (; ; ), so it has been taken more attention recently. The molecular epidemiological study of PHEV in different countries showed that there was great variation in PHEV (; ; ; ). Especially, the emergence of rvPHEV is a new phenomenon and might cause serious harm to pig industry, which needs to further study (). At present, most of the prevalent PHEVs are variants of the original PHEV strain, and there is no specific drug or vaccine for PHEV (; ; ). The real epidemic situations of PHEV need to be further studied, and the harms of PHEV to pig industry need to be further estimated. Therefore, the surveillance of PHEV, and the genetic and evolutionary analysis were performed in this study, and the results indicated that the prevalent PHEV strains in Guangxi province showed high genetic diversity, which will help to make effective prevention and control measures to reduce losses of this pathogen. To the best of our knowledge, this is the first report on the genetic and evolutionary characteristics of PHEV in southern China.

5 Conclusion

Fifty PHEV S, M, and N gene sequences were amplified and sequenced from clinical samples collected from Guangxi province in southern China during 2021–2024. The phylogenetic trees based on PHEV S, M, and N gene sequences revealed that the PHEV strains from different countries could be divided into two groups G1 and G2, and the 50 PHEV strains obtained in this study distributed in subgroup G1c and G2b. The PHEV strains existed variation of mutation, and recombination. The population size of PHEV has been in a relatively stable state since its discovery, until it expanded sharply around 2015, and then stabilized again. The epidemic strains from Guangxi province, southern China showed high genetic diversity.

Statements

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary material.

Ethics statement

The animal studies were approved by Guangxi Center for Animal Disease Control and Prevention, China. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.

Author contributions

KS: Writing – review & editing, Writing – original draft, Funding acquisition. XH: Writing – original draft, Methodology. FL: Writing – original draft, Supervision, Investigation. YS: Writing – original draft, Supervision, Methodology, Data curation. YP: Writing – original draft, Validation, Software. SF: Writing – original draft, Supervision, Software. ZL: Writing – review & editing, Writing – original draft. YY: Writing – review & editing, Supervision, Methodology, Data curation.

Funding

The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by the Key Research and Development Program (No. AB21238003) of Guangxi Science and Technology Bureau, China.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2024.1474552/full#supplementary-material

References

Summary

Keywords

coronavirus, porcine hemagglutinating encephalomyelitis virus, phylogenetic analysis, genetic evolution, recombination

Citation

Shi K, Hu X, Long F, Shi Y, Pan Y, Feng S, Li Z and Yin Y (2024) Genetic diversity and evolution of porcine hemagglutinating encephalomyelitis virus in Guangxi province of China during 2021–2024. Front. Microbiol. 15:1474552. doi: 10.3389/fmicb.2024.1474552

Received

01 August 2024

Accepted

25 September 2024

Published

09 October 2024

Volume

15 - 2024

Edited by

Zhixun Xie, Guangxi Veterinary Research Institute, China

Reviewed by

Shao-Lun Zhai, Guangdong Academy of Agricultural Sciences, China

Tao Song, Hebei Normal University of Science and Technology, China

Updates

Copyright

*Correspondence: Kaichuang Shi, ; Yanwen Yin,

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics