Your new experience awaits. Try the new design now and help us make it even better

ORIGINAL RESEARCH article

Front. Microbiol., 17 December 2025

Sec. Microbe and Virus Interactions with Plants

Volume 16 - 2025 | https://doi.org/10.3389/fmicb.2025.1717984

This article is part of the Research TopicAdvancing Microbial Consortia for Sustainable Disease Management and Plant Growth PromotionView all 8 articles

Screening, isolation and characterization of endophytic bacteria from upland Rice for antagonism against Fusarium graminearum

  • 1National Engineering Research Center of JUNCAO Technology of Fujian Agriculture and Forestry University, Fuzhou, Fujian, China
  • 2National Engineering Research Center of JUNCAO Technology, Fuzhou, China
  • 3Rwanda Agriculture and Animal Resources Developement Board, Kigali, Rwanda

Endophytic bacteria play an important role in inhibiting plant pathogens. This study aimed to screen endophytic bacteria from upland rice with antagonistic activity against Fusarium graminearum, evaluated their antagonistic potential against F. graminearum, assessed their anti-fungal substances, and elucidated the underlying mechanisms. Some methods were performed, including dual-culture antagonism assays, lipopeptide extraction, identification of antifungal compounds via LC-MS and HS-GC-MS, metabolomic analysis, and microscopic observation. Two endophytic bacterial strains, URR1 and URR2, were identified as Pseudomonas sp. and Bacillus subtilis, respectively. Dual-culture antagonism assays demonstrated that both strains exhibited strong inhibitory activity against F. graminearum, with inhibition rates of 69.73% and 76.33%, respectively. In vitro experiments further revealed that bacterial suspensions at approximately 3.3 × 10 8 CFU·mL-1 significantly alleviated stress in upland rice seedlings infected with F. graminearum after 7 days. Both crude lipopeptides and volatile organic compounds (VOCs) markedly suppressed the hyphal growth of the pathogen. The maximum inhibition rate of crude lipopeptides reached 63.86% after 96 hours of treatment, while VOCs showed a peak hyphal inhibition rate of 30.38% after 48 hours of exposure. Antimicrobial lipopeptides, comprising 10 distinct surfactin isoforms and 7 fengycin variants, as well as VOCs such as acetone, ethanol, trichloromethane, pyruvic acid, and propadiene, were identified. After antagonism with lipopeptides extracted from endophytic bacteria URR2, the fungal hyphae of F. graminearum exhibited morphological abnormalities. Notably, treatment with URR2 resulted in the upregulation of metabolites and activation of key metabolic pathways. Metabolomic analysis indicated that the differentially upregulated metabolites encompassed a wide range of classes, including organic acids and derivatives, lipids and lipid-like molecules, organoheterocyclic compounds, organic oxygen compounds, benzenoids, organic nitrogen compounds, nucleosides, nucleotides and analogues, phenylpropanoids and polyketides, as well as lignans and neolignans. The analysis revealed that the associated molecules were significantly concentrated in multiple metabolic pathways, primarily involving ABC transporters, protein digestion and absorption, amino acid biosynthesis, aminoacyl-tRNA biosynthesis, the phosphotransferase system (PTS), starch and sucrose metabolism, among others. These results conclusively demonstrate the strong antifungal activity of strain URR2 against F. graminearum. The antagonistic mechanism of B. subtilis against F. graminearum appears to be multifaceted. Overall, our findings indicate that URR2 has promising potential to be developed as a novel biocontrol agent for the development of sustainable agriculture.

Introduction

Phytopathogens are a major threat to the sustainability of agriculture system. Numerous fungal phytopathogens pose a significant challenge to conventional control methods due to their broad host range and soilborne nature (Summerell et al., 2003). Fusarium graminearum is a pathogen with a high frequnecy of wheat colonization and can cause Fusarium head blight (FHB) disease in wheat, causing serious harm to crop production worldwide (Khanal et al., 2021). F. graminearum exhibits strong pathogenicity, which relies on sophisticated infection mechanisms and remarkable environmental adaptability (Shang et al., 2024). During host invasion, the fungus secretes various extracellular enzymes to disrupt plant cell integrity (Voigt et al., 2005). As the infection progresses, it produces highly toxic secondary metabolites, such as deoxynivalenol, that not only aggravate crop disease but also compromise grain quality (Luo et al., 2025). The pathogen overwinters mainly in the form of mycelia and spores within crop residues and soil in temperate and humid regions. Surviving populations on infected debris produce ascospores, which are then dispersed by wind and rain to initiate primary infection (Leplat et al., 2016; Li et al., 2025).

Chemical fungicides are widely used in agriculture to control plant diseases. However, increasing use of chemical fungicides with high toxicity had a considerable negative impact on the sustainability of agricultural production, posing risks to the environment and human health. Biocontrol as a environment-friendly control, using antagonistic microorganisms instead of chemicals, demonstrated strong antifungal effects and harmlessness to the environment, are a practical approach to managing plant disease (Maral-Gül and Eltem, 2025). Consequently, researching and developing multifunctional biological agents—specifically those with dual functions of growth promotion and antagonism—has emerged as a pivotal area of research in sustainable agriculture. Microbial endophytes are at the forefront of sustainable agricultural practices, producing a range of bioactive compounds helping plant host respond to biotic and abiotic stress (Muhammad et al., 2024; Munakata et al., 2022; Penha et al., 2020).

Within this landscape, Bacillus and Pseudomonas are notably prominent beneficial bacteria, renowned for their plant growth-promoting properties (Baysal et al., 2024; Cueva-Yesquén et al., 2024). Both genera are capable of producing a diverse array of secondary metabolites that exhibit potent antimicrobial activities (Wang et al., 2024). Species of the genus Bacillus are widely marketed and utilized in modern agricultural systems. As microbial biocontrol agents, they contribute to plant health by promoting growth and suppressing various phytopathogens (Fatima et al., 2023). This approach represents a promising strategy for sustainable agriculture, as it helps eliminate the adverse environmental and human health impacts associated with chemical pesticides and fertilizers (Fessia et al., 2022; De Nunes et al., 2023; Liu et al., 2023). Generally, the genus Bacillus employ synergistic strategies such as biofilm formation, induced systemic resistance (ISR), and metabolic production to enhance plant resilience (Mahapatra et al., 2022). The suppressive activity of Bacillus species is primarily attributed to their production of a broad spectrum of antimicrobial agents, including hydrolytic enzymes, antibiotics, lipopeptides (LPs), and volatile metabolites (Farzand et al., 2020). Bacillus velezensis JCK-7158, isolated from rice, produces iturin A, surfactin, and volatile compounds as key antifungal agents. This strain serves as an eco-friendly alternative to chemical fungicides for the control of Fusarium head blight (Yeo et al., 2024).

As a preeminent producer of antifungal lipopeptides (e.g., surfactin, iturin, fengycin), Bacillus spp. exhibit potent antagonistic activity against phytopathogens such as F. graminearum that poses a significant threat to crops (Zalila-Kolsi et al., 2016; Palazzini et al., 2016; Iqbal et al., 2023). Among the lipopeptides, iturin and fengycin have demonstrated significant antifungal activity (Romero et al., 2007), while surfactin exhibits no marked fungitoxicity (Ongena and Jacques, 2008). Fengycin may induce pathogen cell death through mechanisms associated with membrane interaction and alterations in cell permeability (Zhang and Sun, 2018). Volatile organic compounds (VOCs) have been well investigated for their biocontrol applications (Grahovac et al., 2023). Endophytic bacteria are known to produce VOCs that can inhibit phytopathogenic fungi (Khare et al., 2018). The VOCs produced by an endophytic strain identified as Bacillus subtilis KRS015 exhibited significant antagonistic activity against a range of pathogenic fungi (Song et al., 2024). For instance, Bacillus subtilis strain DZSY21, isolated from Eucommia ulmoides leaves, has been shown to suppress Curvularia lunata through the emission of VOCs such as isopentyl acetate and 2-heptanone (Xie et al., 2020). Similarly, VOCs produced by B. velezensis ZSY-1 exhibited strong antifungal activity against F. oxysporum (Gao et al., 2017). The VOCs emitted by Bacillus thuringiensis G-5 exhibited significant inhibitory effects against two major postharvest pathogens of Codonopsis pilosula: F. oxysporum F-3 and Penicillium oxalicum F-5. These VOCs were found to markedly alter the morphology and ultrastructure of mycelia and spores, as well as compromise the integrity of the cell membranes (Mo et al., 2025).

Bacillus species exhibit a wide range of beneficial traits. Notably, the application of bio-fertilizers formulated with Bacillus bioactivators has been demonstrated to enhance the growth of upland rice (Hapsoh et al., 2021). Here, the present study aimed to isolate and evaluate endophytic bacteria from upland rice for their biocontrol potential against F. graminearum. Two bacterial endophytes were isolated from the roots of upland rice. Their antagonistic effects were rigorously assessed through a series of in vitro and in vivo experiments, including dual-culture antagonism assays, analyses of antifungal metabolites, evaluation of their protective efficacy in rice plants. The successful identification of effective antagonistic strains from this study could offer a sustainable and eco-friendly strategy for managing Fusarium head blight.

Materials and methods

Preparation of samples from upland rice and isolation of antagonistic bacteria

Samples were collected from upland rice field in flowering stage located in Biqiao Village, Linfang Township, Liancheng County, Longyan City, Fujian Province (longitude and latitude:116°43′52″E, 25°41′23”N). A total of 10 clusters of upland rice plants were sampled. The samples were placed in an insulated box containing ice cubes and quickly transported to the laboratory. Only roots were rinsed clean with tap water, pooled together, cut into small segments with sterile scissors, placed in sterile culture dishes, soaked in 70% alcohol for 30 s, and disinfected with a 5% (v/v) aqueous solution of sodium hypochlorite for 5 min. Finally, the samples were rinsed three times with sterile water, and the final rinsed sterile water was inoculated onto the culture medium LB plate and incubated at 30 °C for 3–5 days to check whether the sterilization was complete (Younas et al., 2023). The absence of colonies indicates that the samples were thoroughly disinfected. In a sterile mortar, 1 g of the sample were ground together with an appropriate amount of sterile quartz sand and sterile water. After grinding, the samples were transferred to a sterile test tube and made to 10 mL. The sample was shaken at 120 rpm for 30 min to obtain a sample suspension, which was sequentially diluted to prepare sample suspensions with different dilutions of 10−1 to 10−6. 100 μL of each dilution sample from 10−3 to 10−6 was taken onto the combined nitrogen fixation solid culture medium, 3 repeats for each sample. The plates were cultured upside down in incubator at 30 °C for 24–72 h. A plate with a suitable number of colonies was used to select a single colony. The strain was purified on NA (Nutrient Agar) solid culture medium using parallel streaking method with three times continuously to confirm the purified strain.

Microorganism and culture medium

To investigate the antifungal effect, Fusarium graminearum PH-1 was obtained from the laboratory of the Ecological Application Research Institute of Fujian Agriculture and Forestry University. Some mediums such as LB (Luria-Bertani) medium, PDA (Potato Dextrose Agar) medium, Combined nitrogen-fixing culture medium, NA medium, Solid soybean culture medium, and MS (Murashige and Skoog) medium we used in this study. The soybean solid medium used in this experiment was adapted from the established soybean meal formula for Bacillus subtilis solid-state fermentation (Dai et al., 2017), with some modifications.

Detailed media formulations can be seen Supplementary Table 1. And the medium was sterilized by autoclaving at 121 °C for 20 min.

DNA extraction, amplification of 16S rRNA and Lipopeptide biosynthesis genes

After purification on NA medium, the bacterial strain was transferred to an LB liquid medium and incubated at 30 °C with shaking at 180 r/min for 48 h. Bacterial cells were then harvested, and genomic DNA was extracted following the protocol of B518255-0100 Ezup Column Bacterial Genomic DNA Extraction Kit [Sangon Biotech (Shanghai) Co., Ltd.]. The concentration and purity of the extracted DNA were measured using a NanoDrop2000 spectrophotometer. Only DNA samples with an OD₂₆₀/OD280 ratio between 1.8 and 2.0 were used for polymerase chain reaction (PCR) amplification of 16S rDNA gene by specific primer of forward 16SrRNA-8F and reverse 16SrRNA-806R (Smagulova, 2024). PCR was carried out in a reaction mixture comprising bacterial DNA, 10 mM Tris–HCl, 2.5 mM MgCl₂, 50 mM KCl, 1 μM of each primer, 100 μM of each dNTP, and 1.25 U of Taq DNA polymerase. The thermal cycling protocol comprised an initial denaturation at 94 °C for 2 min, followed by 28 cycles of 94 °C for 45 s, 50 °C for 45 s, and 72 °C for 90 s. The lipopeptide biosynthesis genes sfp and FenD were amplified by polymerase chain reaction (PCR) using gene-specific primers. The sfp gene was amplified with the primer pair Sfp-f (5′-ATGAAGATTTACGGAAATTTA-3′) and Sfp-r (5′-TTATAAAAGCTCTTCGTACG-3′) (Hsieh et al., 2004), while the FenD gene was amplified using primers FNDF2 (CTGGGAGGTCAGCCGGTCTG) and FNDR2 (GTGGTCGCCGGTTCACAAAT) (Cao et al., 2012).

The amplified products were quantified using the Qubit dsDNA HS Assay Kit and subjected to Illumina sequencing. The resulting sequences were analyzed for homology using the BLAST program from the National Center for Biotechnology Information (NCBI).1 Endophytic species were identified based on the highest query coverage and BLAST scores (Sampangi-Ramaiah et al., 2020). Phylogenetic analysis was performed using MEGA 11 software, with parameter settings including maximum likelihood statistical method, bootstrap method of phylogeny test, 1,000 for bootstrap replications.

Extraction and component determination of crude lipopeptide from antagonist

Crude extract of lipopeptide

A single purified colony of isolated strain was inoculated into sterile LB liquid medium and incubated at 30 °C with shaking at 200 r/min for 12 h to prepare the seed culture. Subsequently, 1% (v/v) of the seed culture was transferred into fresh LB medium and cultivated under the same conditions (30 °C, 200 r/min) for 48 h. The fermentation broth was centrifuged at 12,000 rpm for 20 min at 4 °C to collect the supernatant. The methods of lipopeptides precipitation and collection are as previously described (Chen et al., 2008), with the following modifications: the supernatant was then acidified to pH 2.0 using 6 mol/L HCl and stored overnight at 4 °C. The resulting mixture was centrifuged at 8,000 r/min for 20 min to collect the precipitate. The precipitate was resuspended in an equal volume of 10% methanol, and the pH was adjusted to 7.0 with 1.0 M NaOH. After further centrifugation at 8,000 r/min for 20 min, the supernatant was collected and filtered through a 0.22 μm microporous membrane to obtain the crude lipopeptide extract.

Determination of crude lipopeptide

A 500 μL aliquot of the crude antimicrobial peptide extract was centrifuged at 13,000 r/min for 10 min, and the resulting supernatant was collected for LC–MS (Liquid Chromatography-Mass Spectrometry) analysis. Separation was performed on an UltiMate 3,000 UHPLC system equipped with a C18 column (1.9 μm, 2.1 mm × 100 mm). The mobile phase consisted of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile (B), with a flow rate of 0.3 mL·min−1 and an injection volume of 10 μL. The gradient elution program used is detailed in Table 1.

Table 1
www.frontiersin.org

Table 1. Mobile phase gradient elution procedure.

Mass spectrometric analysis was performed using a Q-Exactive instrument (Thermo Fisher Scientific, CA, United States) equipped with a HESI ion source. The source temperature was set to 310 °C and the capillary temperature to 320 °C. Sheath gas and auxiliary gas flow rates were maintained at 30 and 10 arbitrary units, respectively. The spray voltage was set to 3.0 kV in positive ion mode and 2.8 kV in negative ion mode. Data were acquired in data-dependent acquisition (DDA) mode with a loop count of 10. HCD fragmentation was performed using stepped normalized collision energies of 10, 28, and 35 eV. Full MS scans were acquired over the m/z range of 80–1,200 with a resolution of 70,000, an AGC target of 3 × 106, and a maximum injection time of 200 ms. MS/MS scans were performed with a resolution of 17,500, an AGC target of 1 × 105, and a maximum injection time of 50 ms. The final identification of the lipopeptide compounds was achieved by comparing the detected peak characteristics with those reported in existing literature (Jemil et al., 2017; Govaerts et al., 2002).

Detection of volatile compounds in endophytic bacteria by headspace gas chromatography–mass spectrometry

Volatile compounds were collected using tedlar bags and analyzed by a pre-concentration system (Entech 7,200, Entech, United States) coupled with gas chromatography–mass spectrometry (7890B-5977A, Agilent Technologies, United States). Specifically, the tedlar bag was connected to the pre-concentration unit, from which a 300 mL sample was drawn. The sample was then concentrated and focused through a three-stage cold trap to remove moisture, nitrogen, and carbon dioxide, before being introduced into the gas chromatograph (GC). Separation of target compounds was achieved using a capillary column with temperature programming, and detection was carried out by mass spectrometry (MS).

The pre-concentration parameters were set as follows: the sample first entered the primary cold trap (−40 °C) for initial trapping of target compounds. The primary trap was then rapidly heated to 10 °C, and the analytes were transferred via helium carrier gas to the secondary cold trap (−40 °C). Subsequently, the secondary trap was flash-heated to 180 °C, and the sample was moved to the tertiary cold trap (−160 °C). Finally, the tertiary trap was rapidly heated to 80 °C to inject the target compounds into the GC. Key GC–MS parameters were detailed in Table 2.

Table 2
www.frontiersin.org

Table 2. Key GC–MS parameters.

Antagonistic experiment

Dual-culture antagonism

Fusarium graminearum was cultured on PDA solid medium and incubated at 28 °C for 48 h in a constant temperature incubator. Samples were taken when the mycelium had nearly covered the agar plate. Each tested bacterial strain was activated in LB liquid medium and incubated in a shaker at 30 °C and 180 r/min for 24 h before sampling. Using a pipette, 10 microliters of the bacterial suspension were spotted onto LB solid medium. A 5 mm diameter agar plug of F. graminearum was then inoculated 2 centimeters away from the bacterial spot to initiate the confrontation assay. All plates were incubated at 28 °C for 72 h. The antagonistic activity of each bacterial strain was observed and recorded. The inhibition ratios of mycelium growth of F. graminearum D187 were calculated with the following formula (Zhou et al., 2011). Inhibition ratio (%) = (C - T)/C × 100%, where C is the diameter of the control colony and T is the diameter of the treatment colonies.

Determination of the antagonistic effects of crude lipopeptide extracts on Fusarium graminearum

Antagonism test

A 100 mL aliquot of PDA medium was prepared and sterilized. Once the medium had cooled to 50–60 °C, 1 mL of sterile crude lipopeptide extract was added and mixed thoroughly to prepare a PDA plate containing 1% (v/v) crude lipopeptide extract. After solidification, a 5 mm diameter agar plug of F. graminearum was inoculated at the center of the plate. A control plate was prepared similarly using PDA medium without the lipopeptide extract and inoculated with an identically sized fungal plug. Each treatment was triplicate. All plates were incubated at 28 °C, and hyphal growth of F. graminearum was recorded at 24 h, 48 h, 72 h, and 96 h.

Microscopic observation of Fusarium graminearum hyphae

A fungal plug of F. graminearum was inoculated at the center of a PDA plate. Then, 20 μL of crude lipopeptide extract was applied to multiple points 2 cm away from the fungal plug. As a control, 20 μL of sterile LB solution was applied in the same manner at separate locations. The plate was sealed and incubated at 28 °C for 2 days. After incubation, the mycelium of pathogenic fungi were collectedd, and the hyphae were moistened with sterile water on a glass slide. The morphology of the hyphae was then examined under a microscope.

Determination of the antagonistic effects of volatile compounds on Fusarium graminearum

Two PDA plates were prepared for co-cultivation. On one plate, 200 μL of the bacterial suspension was inoculated and evenly spread. On the other plate, a 5 mm diameter agar plug of F. graminearum was placed with the mycelial side facing downward. The two plates were then sealed together and incubated at 28 °C for 48 h. A control group was set up using 200 μL of germ-free LB liquid instead of the bacterial suspension. Each treatment was replicated three times. The hyphal growth diameter was measured and recorded at 24 h, 48 h, 72 h, and 96 h.

Antagonistic effects in vitro against Fusarium graminearum infection in upland rice seedlings

Strains URR1 and URR2 were pre-activated by inoculating 1 mL of each bacterial culture into 100 mL of fresh sterile LB liquid medium, followed by incubation in a shaker at 30 °C and 180 rpm for 24 h. The bacterial cultures were then mixed in a 1:1 ratio (3 mL URR1 + 3 mL URR2). From this mixture, 3 mL was taken and diluted with sterile water to prepare a 3% (v/v) mixed bacterial suspension (approximately 3.3 × 108 cfu·mL−1), which served as the treatment group. A control group was established using sterile water.

For upland rice seed germination, seeds were soaked in water for 2 days, surface-sterilized with sodium hypochlorite and 75% ethanol, and placed in sterile glass culture dishes. The treatment group received 20 mL of the mixed bacterial suspension, while the control group received an equal volume of sterile water. All dishes were kept in a laminar flow hood under a 12-h light/dark cycle at 25 °C. Each treatment was triplicate. After 17 days of germination, 30 seedlings per treatment were selected for the infection assay. The root length of each seedling was measured prior to infection. Seedlings were then transferred to sterile culture dishes, with 10 seedlings per dish. Each dish received 15 mL of sterilized MS (Murashige and Skoog) liquid medium, one 5 mm agar block of F. graminearum, and 3 mL of F. graminearum spore suspension. The preparation of fungal spore suspension follows protocol: After the mycelium of F. graminearum had fully colonized the PDA medium, nine mycelial plugs (approximately 0.5 cm in diameter) were obtained using a cork borer and transferred into potato dextrose broth (PDB). The cultures were then incubated in a shaking incubator at 25 °C and 170 rpm for 5 days to promote the production of macroconidia. The resulting culture was filtered through a double layer of sterile gauze to remove mycelial debris, and the filtrate was centrifuged at 4 °C and 5,000 × g for 15 min to collect the spores. After discarding the supernatant, the spore pellet was resuspended in half-strength potato dextrose broth (½ PDB). The spore concentration was determined using a hemocytometer under a microscope and adjusted to a final density of 1.25 × 104 spores·mL−1 with ½ PDB. The spore suspension was stored at 4 °C for subsequent use.

The treatment group was supplemented with 3 mL of the 3% mixed bacterial suspension, while the control received 3 mL of sterile water. All dishes were incubated in a laminar flow hood at room temperature for 7 days. An additional 15 mL of MS nutrient solution was added once during this period. After incubation, the main and lateral root lengths of each upland rice seedling were measured again.

Metabolomic analysis of endophytic bacteria antagonizing Fusarium graminearum

Samples collection and preparation

A 100 μL aliquot of the URR2 bacterial suspension was evenly spread on an solid soybean culture medium plate and incubated at 30 °C until full growth was achieved. A sterile scalpel was used to excise a strip of bacterial lawn measuring 2 mm in width and 6 cm in length, which was then placed in the center of a soybean medium plate. Pre-grown F. graminearum strips of the same dimensions were placed on both sides of the bacterial strip, positioned 2 cm from the center with the mycelial side facing downward, to initiate confrontation culture. A control was prepared using blank LB medium strips under the same conditions.

The plates were incubated at 28 °C for 5 days, after which samples were collected. The treatment group sample was designated as URR2 and the control as CK, respectively (refer to Figure 1). For sampling, a sterile, enzyme-free 1.5 mL centrifuge tube was pre-cooled in liquid nitrogen. Bacterial cells of URR2 were quickly scraped from the solid medium using a sterile inoculation loop and transferred into the pre-cooled tube. The tube was immediately wrapped in aluminum foil, flash-frozen in liquid nitrogen, and stored at −80 °C until further analysis.

Figure 1
Two petri dishes are shown side by side. The left dish, labeled

Figure 1. Samples’ preparation.

The culture medium was aspirated from the samples using a pipette. The cells were then washed with pre-warmed PBS (37 °C), after which the PBS was removed. To precipitate proteins and extract metabolites, 800 μL of cold methanol/acetonitrile (1:1, v/v) was added. The mixture was transferred to a new centrifuge tube and centrifuged at 14,000 g for 20 min. The resulting supernatant was collected and dried in a vacuum centrifuge. For LC – MS analysis, the dried samples were reconstituted in 100 μL of acetonitrile/water (1,1, v/v), followed by centrifugation at 14,000 g and 4 °C for 15 min. The final supernatant was injected into the LC – MS system.

LC–MS/MS analysis

Thw analysis was performed using a UHPLC system (Agilent 1,290 Infinity LC) coupled with a quadrupole time-of-flight mass spectrometer (AB Sciex TripleTOF 6,600). Chromatographic separation was carried out on a HILIC column (ACQUITY UPLC BEH Amide, 2.1 × 100 mm, 1.7 μm) with a gradient of acetonitrile and ammonium acetate/ammonium hydroxide solution at 0.5 mL/min. Electrospray ionization was operated in both positive and negative modes. Full-scan MS data were collected from m/z 60–1,000, and auto MS/MS fragmentation was triggered by information-dependent acquisition using a collision energy of 35 ± 15 eV. Compound identification was confirmed by comparing retention times and fragmentation patterns with those of authentic standards or literature spectra.

Data statistical analysis

Data processing was conducted using IBM SPSS Statistics 26 and Origin 2021 software. A p-value of ≤ 0.05 was considered statistically significant. Student’s t test was applied to determine the significance of differences between two groups of independent samples. Significantly altered metabolites were identified based on a variable importance in the projection (VIP) value greater than 1 and a p-value less than 0.05. Additionally, Pearson’s correlation analysis was conducted to assess the relationship between two variables. Experiments were conducted in triplicate for each variant.

Results

Isolation, identification of Fusarium graminearum-antagonistic endophytic bacteria and dual-culture antagonism

In this study, two endophytic bacterial strains, designated URR1 and URR2, were isolated from the root tissues of upland rice. Based on phylogenetic analysis, URR1 was identified as belonging to the genus Pseudomonas, while URR2 was classified as Bacillus subtilis. The phylogenetic tree illustrating their relationships is presented in Figure 2. Strain URR1 was identified as Gram-negative, exhibiting a purplish-red color after Gram staining, whereas Strain URR2 was Gram-positive, showing a purple color under the same staining conditions. Their colonial morphology and Gram staining results are depicted in Figure 3A. Furthermore, the two strains demonstrated significant antifungal activity (p < 0.01) against F. graminearum (Figures 3B,C, B1,C1,B2,C2). The inhibition rate reached 69.73% for URR1 and 76.33% for strain URR2 (see Figure 4A).

Figure 2
Phylogenetic tree depicting relationships among various bacterial strains. The tree includes Bacillus subtilis strains IAM 12118 and DSM 10, Bacillus pumilus strain SBMP2, Bacillus acidicola strain 105-2, Pseudomonas fluorescens strain NBRC 14160, and Pseudomonas arenae strain VK110. Bootstrap values are indicated, such as 97, 100, and 75. A scale bar of 0.02 is shown.

Figure 2. The phylogenetic tree of URR1 and URR2 was constructed with MEGA11 software using the maximum likelihood method with 1,000 bootstrap replicates.

Figure 3
Panel A shows bacterial colonies on Petri dishes and microscopic views of rod-shaped bacteria. Panel B displays four Petri dishes with various fungal growths, divided into quadrants in the first two. Panel C presents Petri dishes with different fungi, characterized by central coloration and fluffy textures.

Figure 3. Morphology of isolated strains and their antagonistic effects on hyphal growth of F. graminearum. (A1) Colonial morphology of URR1; (A2) Gram staining test of URR1 (the magnification of the microscope is 100x); (A3) colonial morphology of URR2; (A4) Gram staining test of URR2 (the magnification of the microscope is 100x); (B1) antagonistic test of strain URR1 against F. graminearum; (B2) antagonistic test of strain URR2 against F. graminearum; (B3) antagonistic effect of URR2 crude lipopeptide on F. graminearum; (B4) antagonistic effect of URR2 VOCs on F. graminearum; (C1) hyphal growth of F. graminearum without antagonistic effect of URR1; (C2) hyphal growth of F. graminearum without antagonistic effect of URR2; (C3) hyphal growth of F. graminearum without crude lipopeptide of URR2; (C4) hyphal growth of F. graminearum without VOC of strain URR2.

Figure 4
Bar graphs labeled A, B, and C compare the effects of treatments on the mycelial growth of *Fusarium graminearum* HP-1. Graph A shows the impact of URR1 and URR2 treatment after 72 hours, with URR2 showing the highest inhibition. Graph B evaluates the inhibitory effect of lipopeptides over 24, 48, 72, and 96 hours, highlighting increased inhibition over time. Graph C presents the effect of VOC treatment, also showing a time-dependent increase in growth inhibition. Each graph includes error bars and significance markers, with a legend indicating treatment groups and inhibition rates.

Figure 4. Determination of antagonistic effects of endophytic bacteria, its lipopeptide, and VOC on F. graminearum PH-1. (A) Dual-culture antagonism for 72 h among different treatment. (B) Antagonistic effects of crude lipopeptide extracts from URR2 on F. graminearum. (C) Antagonistic effects of VOC from URR2 on F. graminearum.

Endophytic bacteria alleviate the impact of Fusarium graminearum infection on upland rice seedlings

After 7 days of infection with F. graminearum, upland rice seedlings in culture dishes without antagonistic bacterial supplementation exhibited growth inhibition and leaf wilting. In contrast, the addition of a 3% mixed bacterial suspension (approximately 3.3 × 108 CFU·mL−1) significantly antagonized the pathogen, and the plants displayed normal growth (Figure 5). Specifically, the axial root length and secondary root length of plants in the treatment group reached 90.50 mm and 48.42 mm, respectively, whereas those in the control group were only 60.60 mm and 23.93 mm. The differences in both axial and secondary root lengths between the treatment and control groups were highly significant (p < 0.01). Furthermore, the average increases in axial and secondary root lengths in the treatment group after infection were 10.37 mm and 9.27 mm, respectively. In the control group, the axial root showed an average increase of 5.22 mm, while the secondary root length decreased by an average of 2.36 mm. This negative change was attributed to the breakage of secondary roots caused by the pathogen infection.

Figure 5
Two petri dishes containing young green seedlings growing in MS substrate contaminated by fungal phytopathogen mycelium with endophytic bacteria and without endophytic bacteria.

Figure 5. The antagonistic effect of mixed bacterial suspension (left culture dish) and control group (right culture dish) on the growth of upland rice seedlings infected with F. graminearum PH-1.

Results of metabolomic analysis

Metabolite identification and chemical taxonomy

The metabolites were identified by matching their retention times, precise molecular masses (mass error < 10 ppm), and secondary fragmentation spectra against a locally established standard database (in-house database, Shanghai Applied Protein Technology), as previously described (Luo et al., 2017; Gu et al., 2018). In the present study, a total of 1,605 metabolites were identified through integrated analysis of both positive and negative ion modes. Among these, 1,074 metabolites were detected in positive ion mode and 531 in negative ion mode. Based on chemical taxonomy, these metabolites were classified into 10 distinct superclasses: organic acids and derivatives (32.897%), lipids and lipid-like molecules (25.047%), organoheterocyclic compounds (9.595%), organic oxygen compounds (6.293%), benzenoids (5.421%), nucleosides, nucleotides and analogs (2.928%), phenylpropanoids and polyketides (2.866%), organic nitrogen compounds (1.62%), alkaloids and derivatives (0.685%), and lignans, neolignans and related compounds (0.187%). Notably, organic acids and derivatives together with lipids and lipid-like molecules represented the majority of the identified metabolites, collectively accounting for 57.95% of the total (Figure 6). Furthermore, the top 15 most abundant metabolite classes were identified as: carboxylic acids and derivatives, prenol lipids, organooxygen compounds, fatty acyls, steroids and steroid derivatives, glycerophospholipids, benzene and substituted derivatives, indoles and derivatives, peptidomimetics, organonitrogen compounds, flavonoids, imidazopyrimidines, benzopyrans, pyridines and derivatives, and pyrimidine nucleotides.

Figure 6
Pie chart displaying the distribution of chemical superclasses. Organic acids and derivatives (32.897%) and lipids and lipid-like molecules (25.047%) are the largest categories. Undefined compounds make up 12.461%. Smaller categories include organoheterocyclic compounds (9.595%), organic oxygen compounds (6.293%), benzenoids (5.421%), and others with decreasing percentages down to lignans and related compounds (0.187%).

Figure 6. The proportion of metabolites identified in each chemical classification. The different color blocks in the figure mean different chemical classification items, and the percentage means the percentage of identified metabolites in a chemical classification item to all identified metabolites. Metabolites without chemical classification are defined as undefined.

Differential metabolite analysis

Common univariate statistical methods for analyzing differences between two sample groups include fold change (FC) analysis and t-tests or non-parametric tests. Differential analysis was conducted on all detected metabolites (including unidentified compounds) in both positive and negative ion modes using the thresholds: FC > 1.5 for upregulation, FC < 0.67 for downregulation, and a p-value < 0.05. Metabolites satisfying these criteria were visualized in volcano plots (Figure 7). The plots showed a greater number of upregulated metabolites (represented by red points) compared to downregulated metabolites (blue points) in both ionization modes. This pattern implies that the antagonistic interaction triggered substantial metabolic upregulation in B. subtilis URR2, possibly as part of a stress response or adaptive mechanism.

Figure 7
Two side-by-side volcano plots labeled A and B show gene expression data. The x-axis represents log2 fold change, and the y-axis shows negative log10 p-values. Points are colored red for upregulated genes, blue for downregulated genes, and black for no significant difference. Plot A and B share this legend on the right, illustrating the overall distribution and significance of gene expression changes.

Figure 7. Volcano diagram of differential metabolite ion. (A) Volcano diagram of negative ion mode (B) volcano diagram of positive ion mode (red represents upregulation, blue represents downregulation, black represents no difference). The value of horizontal axis in the figure is the logarithm of log2 for fold change, and the value of vertical axis is the logarithm of -log10 when p value is less than 0.05. Metabolites significantly upregulated when FC value is more than 1.5 and p value is less than 0.05 are indicated in rose red, while metabolites significantly downregulated when FC value is less than 0.67 and p value is less than 0.05 are indicated in blue. Non significantly different metabolites are indicated in black.

Differential upregulation of metabolites was observed across multiple compound classes in both positive and negative ion modes, with the following distribution: Organic acids and derivatives (94 positive ions, 34 negative ions), Lipids and lipid-like molecules (54 positive ions, 52 negative ions), Organoheterocyclic compounds (22 positive ions, 19 negative ions), Organic oxygen compounds (17 positive ions, 5 negative ions), Benzenoids (10 positive ions, 4 negative ions), Organic nitrogen compounds (7 positive ions, 8 negative ions), Nucleosides, nucleotides, and analogs (7 positive ions, 7 negative ions), Phenylpropanoids and polyketides (3 positive ions, 3 negative ions), and Lignans, neolignans and related compounds (1 positive ion, 1 negative ion).

In the negative ion mode, the significantly upregulated differential metabolites are mainly arctigenin, hederacoside C, fulvestrant 9-sulfone, 1-(9Z,12Z-octadecadienoyl)-2-hydroxy.

-sn-glycero-3-phosphoethanolamine, leukotriene F4, linoleic acid, linolenic acid, 9S-hydroperoxy-10E,12Z-octadecadienoic acid, Lys-Lys, N-acetyl-p-fluoro-DL-phenylalanine, phosphorylcholine, gentiopicroside, D-mannitol, trehalose, sucrose, D-quinovose, perseitol, daidzein 4′-sulfate, genistein, methylophiopogonanone A, muramic acid, etc. In contrast, the significantly downregulated differential metabolites primarily comprise acetyl coenzyme A, nicotinamide adenine dinucleotide (NAD), 2-hydroxyadenine, cyclic adenosine diphosphate ribose, etc (Figure 8A).

Figure 8
Bar charts labeled A and B display log2 fold change of various compounds grouped by superclass, indicated by color. Positive and negative values are represented in red and green, respectively. Superclass legend includes lipids, organic acids, benzenoids, and more.

Figure 8. Analysis of significantly altered metabolites in (A) negative and (B) positive ion modes. The horizontal axis represents the log₂ fold-change (FC) values, indicating the magnitude of abundance changes. The vertical axis lists the significantly differential metabolites. Metabolites highlighted in red and green denote upregulation and downregulation, respectively.

In the positive ion mode, the significantly upregulated differential metabolites primarily consist of tropacocaine, acetylcarnitine, oxobutanoic acid, glycerophosphocholine, isobutyryl-L-carnitine, (2R)-3-hydroxyisovaleroylcarnitine, stachydrine, 4-hydroxy -L-isoleucine, acetylcholine, alpha-mannobiose, N-acetyl-D-galactosaminitol, 3-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-3-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-6-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxyphenyl)-6-methoxychromen-4-one, mexiletine, stearidonic acid, among others. Conversely, the significantly downregulated differential metabolites mainly include acetyl-CoA, NAD+, niacinamide, hexapropylene glycol, pyroglu-val, Tyr-Glu, L-glutamate, frangulin A, etc (Figure 8B).

Enrichment analysis of KEGG metabolic pathway

The results of the metabolic pathway enrichment analysis are summarized in the bubble chart shown in Figure 9. The analysis identified significant enrichment in multiple pathways, including: ABC transporters, protein digestion and absorption, amino acid biosynthesis, aminoacyl-tRNA biosynthesis, the phosphotransferase system (PTS), pyrimidine metabolism, purine metabolism, arginine biosynthesis, mineral absorption, starch and sucrose metabolism, alanine, aspartate and glutamate metabolism, arginine and proline metabolism, phenylalanine metabolism, and lysine degradation. Among these, the ABC transporters pathway demonstrated the highest enrichment significance (p < 0.001).

Figure 9
Scatter plot of top 20 enriched KEGG pathways, showing rich factor on the x-axis and pathways on the y-axis. Dots vary in size by metabolite number, ranging from 5 to 20, and color by p-value, with red indicating higher significance. Prominent pathways include protein digestion and ABC transporters.

Figure 9. KEGG enrichment pathway (bubble chart). Each bubble in the figure means a metabolic pathway (the top 20 pathways selected with the highest significance based on p-value). The horizontal axis where the bubble is located and the size of the bubble means the extent of the impact factor of the pathway in topological analysis. The larger the size, the greater the impact factor. The color of the bubble indicates the p-value of enrichment analysis (using -log10 p-value) along the vertical axis. The brighter the color, the smaller the p-value, and the more remarkable the enrichment level.

Metabolic pathway alterations were assessed using the Differential Abundance Score (DAS) method, which captures the overall directional change and average abundance shift of all metabolites within a given pathway. The DAS values for all enriched pathways are presented in Figure 10. The analysis revealed upregulation in several key pathways:

1. Amino acid metabolism: lysine degradation; arginine and proline metabolism; phenylalanine,tyrosine, and tryptophan biosynthesis.

2. Carbohydrate metabolism: galactose metabolism, starch and sucrose metabolism.

3. Global and Overview maps: amino acid biosynthesis and 2-oxocarboxylic acid metabolism.

4. Membrane transport: ABC transporters and the phosphotransferase system (PTS).

5. Nucleotide metabolism: pyrimidine metabolism and purine metabolism.

6. Signal transduction: cAMP signaling pathway.

7. Translation: aminoacyl-tRNA biosynthesis.

Figure 10
Bar chart depicting various biological pathways against their differential abundance scores, ranging from -1.0 to 1.0. Pathways are color-coded by hierarchy, with bubble size indicating pathway size. A color gradient represents scores from blue (-1.0) to red (1.0).

Figure 10. Differential abundance scores of all enriched metabolic pathways (classified according to pathway-hierarchy). The Y coordinate axis in the figure indicates the names of metabolic pathways, and the X coordinate axis coordinate indicates the differential abundance score (DA score). The DA score represents the overall change of all metabolites in pathway. A DA score of 1 means an upregulation of identified metabolites in this pathway, while a DA score of −1 means a downregulation of identified metabolites in this pathway. The length of the line segment indicates the absolute value of the DA score, and the size of the dots at the endpoints of the line segment indicates the number of metabolites in the pathway. The larger the dots, the more the number of metabolites. The length of line segments and the color of dots are proportional to the DA score value. The brighter the red color, the more likely the pathway is to be upregulated, and the bluer the color, the more likely the pathway is to be downregulated.

The antagonistic effects of crude lipopeptide extracts and volatile compounds on Fusarium graminearum

Comparative analysis showed that the experimental group—treated with a crude lipopeptide extract from strain URR2—significantly suppressed the hyphal expansion of F. graminearum compared to the control during different phase of treatment. As time goes on, the inhibition of crude lipopeptides on the growth of F. graminearum hyphae becomes more significant. The maximum inhibition rate reached 63.86% after 96 h of antagonistic interaction (Figure 4B). Additionally, volatile compounds released by strain URR2 in liquid culture also inhibited the hyphal growth of F. graminearum. A statistically significant difference (p < 0.01) was observed relative to the control, with a peak hyphal inhibition rate of 30.38% after 48 h of exposure (Figure 4C).

Microscopic observation of crude lipopeptide extract on the mycelial growth of Fusarium graminearum

Lipopeptides extracted from strain URR2 were applied to the periphery of F. graminearum PH-1 colonies and co-cultured for 48 h. The treatment resulted in significant inhibition of fungal growth, characterized by reduced mycelial density and structural degradation. Fluorescence microscopy revealed marked morphological abnormalities in the treated hyphae including swollen hyphal junctions, fragmentation of hyphal strands, yellowing and necrosis of hyphal tissue, and complete cessation of normal growth. In contrast, control group hyphae maintained intact morphology and typical growth patterns (Figure 11). These findings conclusively demonstrate the potent antifungal activity of strainURR2-derived lipopeptides against F. graminearum PH-1.

Figure 11
Two sets of microscope images labeled

Figure 11. Morphological observation of F. graminearum PH-1 hyphae under different treatments. (A) Abnormal F. graminearum PH-1 hyphae (treatment group); (B) Normal F. graminearum PH-1 hyphae (control group). The red arrow indicates the rupture and enlargement of F. graminearum hyphae.

Identification of antimicrobial lipopeptides

Crude lipopeptide extracts from strain URR2 were subjected to mass spectrometry analysis. Spectral profiles were cross-referenced with published literature to identify the presence of surfactin and fengycin lipopeptide families (Figures 12A,B). Quantification revealed 10 distinct surfactin isoforms and 7 fengycin variants, with detailed molecular characteristics summarized in Table 3. Furthermore, to confirm the presence of genes involved in the biosynthesis of the antifungal lipopeptides surfactin (sfp) and fengycin (FenD), PCR amplification was performed on the URR2 genomic DNA with the selected primer pairs, which yielded the expected specific bands (Figure 12C).

Figure 12
Panel A displays a chromatogram with a prominent peak at 6.89 minutes. Panel B shows a different chromatogram with multiple peaks between 10 to 19 minutes. Panel C is a gel image with DNA bands labeled 675 and 216 base pairs alongside a molecular weight marker.

Figure 12. Peak chromatogram of crude extract of lipopeptide in positive ion mode (A) and in negative ion mode (B), and detection of the lipopeptide biosynthesis genes in URR2 (C).

Table 3
www.frontiersin.org

Table 3. Chemical composition of lipopeptide substances from strain URR2.

Identification of volatile organic compounds

Volatile organic compounds (VOCs) produced by strain URR2 were analyzed using headspace-gas chromatography-ion mobility spectrometry (HS-GC-IMS). Ten major VOCs were identified, including acetone, ethanol, trichloromethane, pyruvic acid, propadiene, hydrogen azide, 3-chlorobenzoyl acetonitrile, ammonium chloride, thioacetic acid, and 2-methyl-4- (2-methylpropyl) phenylacetic acid. The total proportion of acetone and ethanol content is 94.09%, with acetone having the highest proportion at 56.69%, followed by ethanol at 37.4% (Table 4).

Table 4
www.frontiersin.org

Table 4. Top VOCs determination by HS-GC-IMS.

Discussion

Endophytic bacteria represent a vast reservoir of diverse antimicrobial compounds (Ali et al., 2024). In recent years, endophytic bacteria have garnered increasing interest among researchers due to their plant growth-promoting properties and antagonistic activities (Patel et al., 2024). The deployment of endophytic bacteria as biocontrol agents presents an economically and environmentally viable alternative for phytopathogen management, reducing reliance on chemical pesticides. Bacillus spp. is a type of Gram-positive bacteria inhabiting a large number of different habitats with many characteristics, such as promoting plant growth through nitrogen fixation and secretion of auxin, reducing the amount of heavy metal in the environment, and increasing plant resistance against pathogens (Yousuf et al., 2017; Wróbel et al., 2023; Jeżewska-Frąckowiak et al., 2018). Bacteria of the genus Bacillus are promising biocontrol agents against phytopathogenic fungi, owing to their ability to synthesize a wide array of antimicrobial substances, which play important roles in stimulating defense mechanisms of plants (Mohammed et al., 2014; Fira et al., 2018; Gu et al., 2017; Yu et al., 2021; An et al., 2024). In this study, two endophytic bacterial strains, URR1 and URR2, were isolated from upland rice roots and identified as Pseudomonas sp. and Bacillus subtilis, respectively. Both strains demonstrated strong in vitro antagonistic activity against F. graminearum. Elucidating the antagonistic mechanisms of B. subtilis against F. graminearum is essential for its effective use as a biocontrol agent. Previous studies have reported that various B. subtilis strains exhibit biocontrol potential against F. graminearum. This antagonistic activity is primarily mediated through the production of diverse secondary metabolites and broad-spectrum antimicrobial compounds, such as lipopeptides and chitinase (Zhao et al., 2014). Bacterial endophytes belonging to Bacillus spp. were isolated from maize seeds and demonstrated antifungal activity against Fusarium moniliforme, exhibiting an inhibition zone at a concentration of 500 μg per disk. Antifungal compounds, including iturin A, fengycin, and bacillomycin, were identified in the isolates using MALDI-TOF mass spectrometry (Gond et al., 2015). Lipopeptides are amphiphilic, membrane-active peptide antibiotic with high activity against phytopathogens in small doses, causing damage and deformation of the filamentous membrane and cell wall of F. graminearum (Harish et al., 2023; Hanif et al., 2019). In vitro antagonistic assays confirmed the inhibitory efficacy of lipopeptides from B. subtilis strain Y17B against Alternaria alternata (Ahmad et al., 2023). Our findings demonstrate that B. subtilis URR2 primarily suppresses F. graminearum through the secretion of lipopeptides. Even at low concentrations (v/v 1%), the lipopeptides exhibited significant inhibitory effects on the hyphal growth of F. graminearum.

Bacillus subtilis likely compromises fungal cell membrane integrity through the secretion of these lipopeptides, resulting in the leakage of cellular contents (Wang et al., 2024). Consistent with this, our antagonistic assays demonstrated visible hyphal breakage and growth inhibition in F. graminearum following lipopeptide treatment. The lipopeptide profile of strain URR2 was analyzed in this study, revealing surfactins and fengycins as its major products. The sfp and fenD genes, which are responsible for the biosynthesis of the lipopeptides surfactin and fengycin, respectively, were successfully validated in the present work. Fengycins, which are cyclic lipodecapeptides, have been recognized as key antifungal lipopeptides in other B. subtilis strains effective against F. graminearum (Ramarathnam et al., 2007; Romanenko et al., 2008; Kim et al., 2017). Surfactins are known to synergistically enhance the antifungal activity of other lipopeptides (Hiraoka et al., 1992). Therefore, the co-production of both fengycins and surfactins likely contributes significantly to the efficacy of strain URR2 in controlling F. graminearum. Furthermore, Antagonistic experiments conducted in this study revealed that volatile organic compounds exhibit significant inhibitory effects. In previous studies, volatile organic compounds (VOCs), such as ketones, aromatic compounds, furan, pyrazine, alcohols, and ester, emitted by Bacillus species have been shown to exhibit antifungal activity against F. oxysporum and F. graminearum (Al-Mutar et al., 2023; Zhang et al., 2020; Yuan et al., 2012). Moreover, several volatiles produced by Bacillus strains, including acetophenone, 2-nonanone, m-tolunitrile, 2-ethylhexanol, 2-heptanone, benzylacetone, 6-methyl-2-heptanone, benzothiazole, 5-methyl-2-hexanone, dimethyl disulfide, dimethyl trisulfide, 1-undecene, benzaldehyde, cyclohexanol, and 2-ethyl-1-hexanol, have been demonstrated to inhibit fungal growth (Zhang et al., 2020; Kai et al., 2009).

Headspace with Gas Chromatography–Mass Spectrometry (HS-GC–MS) analysis is well applied in determination of volatile organic compounds (VOCs) (Castell et al., 2023). A range of volatile organic compounds such as acetone, ethanol, bromochloromethane, pyruvic acid, and propadiene were detected using HS-GC–MS in the present work. Some reports showed that VOCs poduced by B. megaterium significantly inhibited the mycelial growth of F. graminearum PH-1 (Keyfoğlu et al., 2023). A total of 21 high-concentration volatile organic compounds (VOCs) emitted by B. thuringiensis G-5 were identified using headspace gas chromatography–ion mobility spectrometry (HS-GC-IMS). Among these, 3-hepten-2-one was determined to be the primary antifungal component (Mo et al., 2025). Many of potential antifungal VOCs, comprising alcohols, ketones, pyrazines, esters, acids, phenols, amines, and hydrocarbons, were identified during the fermentation process. The composition and abundance of these VOCs varied across different fermentation time points (Gao et al., 2018). Our findings align with previous research, as acetone, ethanol, bromochloromethane, and pyruvic acid were identified as the predominant VOCs in this study, demonstrating strong antifungal activity. The strongest antifungal activity was recorded in the 48-h fermentation sample. The antifungal effects of these volatiles are likely mediated through mechanisms such as disruption of fungal cell membrane integrity, structural damage to fungal cells, or interference with key metabolic pathways.

Metabolomic analysis revealed that the differentially upregulated metabolites were primarily distributed in lipids and lipid-like molecules, benzenoids, organic acids and derivatives, organic oxygen compounds, organoheterocyclic compounds, organic nitrogen compounds, nucleosides, nucleotides and analogs, lignans and neolignans and related compounds, as well as phenylpropanoids and polyketides. Among them, organic acids and lipids were represented in a high proportion. This high abundance may be a key factor contributing to the strong antagonistic activity of the URR2 strain against pathogenic fungi. It is well-documented that organic acids demonstrate strong anti-fungal activity (Barbero-López et al., 2020). Fatty acids and amino acids serve as essential precursors for lipopeptide biosynthesis (Wang et al., 2024). Under specific conditions, B. subtilis URR2 may enhance lipopeptide production by upregulating key metabolic pathways involved in fatty acid ester synthesis and amino acid metabolism. Polyketides, including bacillaene, difficidin, macrolactin, and amicoumacin, represent another major group of antimicrobial metabolites produced by Bacillus species (Wang et al., 2024). Strain URR2 may produce more polyketides through upregulating phenylpropanoids and polyketides metabolism to inhibit F. graminearum. In addition, enrichment analysis of metabolic pathways indicated upregulation in membrane transport systems, specifically ABC transporters and the phosphotransferase system (PTS). ABC transporters may play a key role in bacterial adaptation to biotic stress. Endophytic bacteria upregulate the expression of ABC transporters to enhance carbon source uptake and thereby support their own survival. Additionally, these transporters can facilitate the secretion of antimicrobial peptides that antagonize fungal pathogens. For example, in Bacillus species, ABC transporters mediate the export of secondary metabolites such as antibacterial substances (Ohki et al., 2003).

In summary, the antagonistic mechanism of B. subtilis against F. graminearum appears to be multifaceted. Beyond the well-documented roles of lipopeptides and volatile organic compounds, further investigation is required to elucidate the contributions of certain polyketides, antimicrobial proteins, antibiotics, and other metabolites.

Conclusion

In this study, endophytic bactreial strain URR1 and URR2 were identified as effective biocontrol strains against Fusarium head blight (FHB) in upland rice. The endophytic bacterium URR2 was found to produce diverse antifungal compounds, including lipopeptides and volatile organic compounds (VOCs), which exhibited activity against Fusarium graminearum. The antagonistic mechanism appears to involve the upregulation of certain metabolites and the participation of key metabolic pathways such as ABC transporters and the phosphotransferase system (PTS). These results indicate that URR2 holds strong potential as a novel biocontrol agent for the management of FHB in rice. Further research is needed to optimize fermentation conditions for enhanced lipopeptide production, and extensive field trials will be essential to assess the efficacy and practicality of URR2-based microbial pesticides in controlling rice FHB.

Data availability statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary material.

Author contributions

Y-pH: Writing – original draft. G-dL: Writing – review & editing. D-mL: Writing – review & editing. X-sL: Writing – review & editing. H-lL: Writing – review & editing. MH: Writing – review & editing. BL: Supervision, Writing – review & editing. Z-xL: Supervision, Writing – review & editing.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This work was supported by the National Engineering Research Center of JUNCAO Technology, Fujian Agriculture and Forestry University, (No. 271/KH200039A).

Acknowledgments

Authors would like to acknowledge the support provided by the funding program (No. 271/KH200039A), Fujian Agriculture and Forestry University.

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that Generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Supplementary material

The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2025.1717984/full#supplementary-material

Footnotes

References

Ahmad, T., Xing, F., Nie, C., Cao, C., Xiao, Y., Yu, X., et al. (2023). Biocontrol potential of lipopeptides produced by the novel Bacillus subtilis strain Y17B against postharvest Alternaria fruit rot of cherry. Front. Microbiol. 14:1150217. doi: 10.3389/fmicb.2023.1150217,

PubMed Abstract | Crossref Full Text | Google Scholar

Ali, M. A., Ahmed, T., Ibrahim, E., Rizwan, M., Chong, K. P., and Yong, J. W. H. (2024). A review on mechanisms and prospects of endophytic bacteria in biocontrol of plant pathogenic fungi and their plant growth-promoting activities. Heliyon 10:e31573. doi: 10.1016/j.heliyon.2024.e31573,

PubMed Abstract | Crossref Full Text | Google Scholar

Al-Mutar, D. M. K., Noman, M., Alzawar, N. S. A., Qasim, H. H., Li, D., and Song, F. (2023). The extracellular lipopeptides and volatile organic compounds of Bacillus subtilis DHA41 display broad-spectrum antifungal activity against soil-borne phytopathogenic fungi. J. Fungi 9:797. doi: 10.3390/jof9080797,

PubMed Abstract | Crossref Full Text | Google Scholar

An, B., Du, D., Huang, Z., Pu, Z., Lv, J., Zhu, L., et al. (2024). Biocontrol of citrus fungal pathogens by lipopeptides produced by Bacillus velezensis TZ01. Front. Microbiol. 15:1471305. doi: 10.3389/fmicb.2024.1471305,

PubMed Abstract | Crossref Full Text | Google Scholar

Barbero-López, A., Hossain, M. M., and Haapala, A. 2020 Antifungal activity of organic acids and their impact on Wood decay resistance. Wood Fiber Sci, 52:410–418. doi:doi: 10.22382/wfs-2020-039

Crossref Full Text | Google Scholar

Baysal, Ö., Studholme, D. J., Jimenez-Quiros, C., and Tör, M. (2024). Genome sequence of the plant-growth-promoting bacterium Bacillus velezensis EU07. Access Microbiol. 6:000762.v3. doi: 10.1099/acmi.0.000762.v3,

PubMed Abstract | Crossref Full Text | Google Scholar

Cao, Y., Xu, Z., Ning, L., Yuan, Y., Yang, X., Chen, L., et al. (2012). Isolation and identification of lipopeptides produced by B. subtilis SQR9 for suppressing fusarium wilt of cucumber. Sci. Hortic. 135, 32–39. doi: 10.1016/j.scienta.2011.12.002

Crossref Full Text | Google Scholar

Castell, A., Arroyo-Manzanares, N., Guerrero-Núñez, Y., Campillo, N., and Viñas, P. (2023). Headspace with gas chromatography-mass spectrometry for the use of volatile organic compound profile in botanical origin authentication of honey. Molecules 28:4297. doi: 10.3390/molecules28114297,

PubMed Abstract | Crossref Full Text | Google Scholar

Chen, H., Wang, L., Su, C. X., Gong, G. H., Wang, P., and Yu, Z. L. (2008). Isolation and characterization of lipopeptide antibiotics produced by Bacillus subtilis. Lett. Appl. Microbiol. 47, 180–186. doi: 10.1111/j.1472-765X.2008.02412.x

Crossref Full Text | Google Scholar

Cueva-Yesquén, L. G., Sartoratto, A., Da Silva Santos, A., de Melo, I. S., and Fantinatti-Garboggini, F. (2024). Pseudomonas flavocrustae sp. nov., an endophyte with plant growth promoting traits isolated from Passiflora incarnata. Sci. Rep. 14:14285. doi: 10.1038/s41598-024-64349-1,

PubMed Abstract | Crossref Full Text | Google Scholar

Dai, C., Ma, H., He, R., Huang, L., Zhu, S., Ding, Q., et al. (2017). Improvement of nutritional value and bioactivity of soybean meal by solid-state fermentation with Bacillus subtilis. LWT 86, 1–7. doi: 10.1016/j.lwt.2017.07.041

Crossref Full Text | Google Scholar

De Nunes, P. S., De Medeiros, F. H., De Oliveira, T. S., de Almeida Zago, J. R., and Bettiol, W. (2023). Bacillus subtilis and Bacillus licheniformis promote tomato growth. Braz. J. Microbiol. 54, 397–406. doi: 10.1007/s42770-022-00874-3

Crossref Full Text | Google Scholar

Farzand, A., Moosa, A., Zubair, M., Khan, A. R., Ayaz, M., Massawe, V. C., et al. (2020). Transcriptional profiling of diffusible lipopeptides and fungal virulence genes during Bacillus amyloliquefaciens EZ1509-mediated suppression of Sclerotinia sclerotiorum. Phytopathology 110, 317–326. doi: 10.1094/PHYTO-05-19-0156-R

Crossref Full Text | Google Scholar

Fatima, R., Mahmood, T., Moosa, A., Aslam, M. N., Shakeel, M. T., Maqsood, A., et al. (2023). Bacillus thuringiensis CHGP12 uses a multifaceted approach for the suppression of Fusarium oxysporum f. sp. ciceris and to enhance the biomass of chickpea plants. Pest Manag. Sci. 79, 336–348. doi: 10.1002/ps.7203,

PubMed Abstract | Crossref Full Text | Google Scholar

Fessia, A., Barra, P., Barros, G., and Nesci, A. (2022). Could Bacillus biofilms enhance the effectivity of biocontrol strategies in the phyllosphere? J. Appl. Microbiol. 133, 2148–2166. doi: 10.1111/jam.15596,

PubMed Abstract | Crossref Full Text | Google Scholar

Fira, D., Dimkić, I., Berić, T., Lozo, J., and Stanković, S. (2018). Biological control of plant pathogens by Bacillus species. J. Biotechnol. 285, 44–55. doi: 10.1016/j.jbiotec.2018.07.044,

PubMed Abstract | Crossref Full Text | Google Scholar

Gao, H., Li, P., Xu, X., Zeng, Q., and Guan, W. (2018). Research on volatile organic compounds from Bacillus subtilis CF-3: biocontrol effects on fruit fungal pathogens and dynamic changes during fermentation. Front. Microbiol. 9:456. doi: 10.3389/fmicb.2018.00456,

PubMed Abstract | Crossref Full Text | Google Scholar

Gao, Z., Zhang, B., Liu, H., Han, J., and Zhang, Y. (2017). Identification of endophytic Bacillus velezensis ZSY-1 strain and antifungal activity of its volatile compounds against Alternaria solani and Botrytis cinerea. Biol. Control 105, 27–39. doi: 10.1016/j.biocontrol.2016.11.007,

PubMed Abstract | Crossref Full Text | Google Scholar

Gond, S. K., Bergen, M. S., Torres, M. S., and White Jr, J. F. (2015). Endophytic Bacillus spp. produce antifungal lipopeptides and induce host defence gene expression in maize. Microbiol. Res. 172, 79–87. doi: 10.1016/j.micres.2014.11.004,

PubMed Abstract | Crossref Full Text | Google Scholar

Govaerts, C., Orwa, J., Van Schepdael, A., Schepdael, A., Roets, E., and Hoogmartens, J. (2002). Characterization of polypeptide antibiotics of the polymyxin series by liquid chromatography electrospray ionization ion trap tandem mass spectrometry. J. Pept. Sci. 8, 45–55. doi: 10.1002/psc.367

Crossref Full Text | Google Scholar

Grahovac, J., Pajčin, I., and Vlajkov, V. (2023). Bacillus VOCs in the context of biological control. Antibiotics (Basel). 12:581. doi: 10.3390/antibiotics12030581,

PubMed Abstract | Crossref Full Text | Google Scholar

Gu, Z., Li, L., Tang, S., Liu, C., Fu, X., Shi, Z., et al. (2018). Metabolomics reveals that crossbred dairy buffaloes are more thermotolerant than Holstein cows under chronic heat stress. J. Agric. Food Chem. 66, 12889–12897. doi: 10.1021/acs.jafc.8b02862,

PubMed Abstract | Crossref Full Text | Google Scholar

Gu, Q., Yang, Y., Yuan, Q., Shi, G., Wu, L., Lou, Z., et al. (2017). Bacillomycin D produced by Bacillus amyloliquefaciens is involved in the antagonistic interaction with the plant-pathogenic fungus Fusarium graminearum. Appl. Environ. Microbiol. 83, e01075–e01017. doi: 10.1128/AEM.01075-17,

PubMed Abstract | Crossref Full Text | Google Scholar

Hanif, A., Zhang, F., Li, P., Li, C., Xu, Y., Zubair, M., et al. (2019). Fengycin produced by Bacillus amyloliquefaciens FZB42 inhibits Fusarium graminearum growth and mycotoxins biosynthesis. Toxins (Basel) 11:295. doi: 10.3390/toxins11050295,

PubMed Abstract | Crossref Full Text | Google Scholar

Hapsoh, H., Wawan, W., Dini, I., and Andriani, D. (2021). Biofertilizer formulation with bioactivators Bacillus cereus on the growth and yeild of upland rice (Oryza sativa L.) in peat medium. Asian J. Appl. Sci. 9:666. doi: 10.24203/ajas.v9i3.6666

Crossref Full Text | Google Scholar

Harish, B. N., Nagesha, S. N., Ramesh, B. N., Shyamalamma, S., Nagaraj, M. S., Girish, H. C., et al. (2023). Molecular characterization and antifungal activity of lipopeptides produced from Bacillus subtilis against plant fungal pathogen Alternaria alternata. BMC Microbiol. 23:179. doi: 10.1186/s12866-023-02922-w,

PubMed Abstract | Crossref Full Text | Google Scholar

Hiraoka, H., Asaka, O., Ano, T., Asaka, O. R. I. E., and Shoda, M. A. K. O. T. O. (1992). Characterization of Bacillus subtilis RB14, coproducer of peptide antibiotics iturin A and surfactin. J. Gen. Appl. Microbiol. 38, 635–640. doi: 10.2323/jgam.38.635

Crossref Full Text | Google Scholar

Hsieh, F. C., Li, M. C., Lin, T. C., and Kao, S. S. (2004). Rapid detection and characterization of surfactin-producing Bacillus subtilis and closely related species based on PCR. Curr. Microbiol. 49, 186–191. doi: 10.1007/s00284-004-4314-7,

PubMed Abstract | Crossref Full Text | Google Scholar

Iqbal, S., Begum, F., Rabaan, A. A., Aljeldah, M., al Shammari, B. R., Alawfi, A., et al. (2023). Classification and multifaceted potential of secondary metabolites produced by Bacillus subtilis group: A comprehensive review. Molecules 28:927. doi: 10.3390/molecules28030927,

PubMed Abstract | Crossref Full Text | Google Scholar

Jemil, N., Manresa, A., Rabanal, F., Ben Ayed, H., Hmidet, N., and Nasri, M. (2017). Structural characterization and identification of cyclic lipopeptides produced by Bacillus methylotrophicus DCS1 strain. J. Chromatogr. B 1060, 374–386. doi: 10.1016/j.jchromb.2017.06.013

Crossref Full Text | Google Scholar

Jeżewska-Frąckowiak, J., Seroczyńska, K., Banaszczyk, J., Jedrzejczak, G., Żylicz-Stachula, A., and Skowron, P. M. (2018). The promises and risks of probiotic Bacillus species. Acta Biochim. Pol. 65, 509–519. doi: 10.18388/abp.2018_2652

Crossref Full Text | Google Scholar

Kai, M., Haustein, M., Molina, F., Petri, A., Scholz, B., and Piechulla, B. (2009). Bacterial volatiles and their action potential. Appl. Microbiol. Biotechnol. 81, 1001–1012. doi: 10.1007/s00253-008-1760-3,

PubMed Abstract | Crossref Full Text | Google Scholar

Keyfoğlu, E. N., Tufan, F., and Yörük, E. (2023). Investigation of the antifungal activity of Bacillus megaterium against Fusarium species. Yuzuncu Yil Univ. J. Agric. Sci. 33, 183–191. doi: 10.29133/yyutbd.1237451

Crossref Full Text | Google Scholar

Khanal, R., Choo, T. M., Xue, A. G., Vigier, B., Savard, M. E., Blackwell, B., et al. (2021). Response of barley genotypes to Fusarium head blight under natural infection and artificial inoculation conditions. Plant Pathol. J. 37, 455–464. doi: 10.5423/PPJ.OA.06.2021.0094,

PubMed Abstract | Crossref Full Text | Google Scholar

Khare, E., Mishra, J., and Arora, N. K. (2018). Multifaceted interactions between endophytes and plant: developments and prospects. Front. Microbiol. 9:2732. doi: 10.3389/fmicb.2018.02732,

PubMed Abstract | Crossref Full Text | Google Scholar

Kim, K., Lee, Y., Ha, A., Kim, J. I., Park, A. R., Yu, N. H., et al. (2017). Chemosensitization of Fusarium graminearum to chemical fungicides using cyclic lipopeptides produced by Bacillus amyloliquefaciens strain JCK-12. Front. Plant Sci. 8:2010. doi: 10.3389/fpls.2017.02010,

PubMed Abstract | Crossref Full Text | Google Scholar

Leplat, J., Heraud, C., Gautheron, E., Mangin, P., Falchetto, L., and Steinberg, C. (2016). Colonization dynamic of various crop residues by Fusarium graminearum monitored through real-time PCR measurements. J. Appl. Microbiol. 121, 1394–1405. doi: 10.1111/jam.13259,

PubMed Abstract | Crossref Full Text | Google Scholar

Li, Z., He, F., Gai, X., Zhu, H., He, S., Xuan, Y. H., et al. (2025). The growth, development and infection process of the plant pathogen Fusarium. Plant Signal. Behav. 20:2573097. doi: 10.1080/15592324.2025.2573097,

PubMed Abstract | Crossref Full Text | Google Scholar

Liu, Y., Yue, Z., Sun, Z., and Li, C. (2023). Harnessing native Bacillus spp. for sustainable wheat production. Appl. Environ. Microbiol. 89:e0124722. doi: 10.1128/aem.01247-22,

PubMed Abstract | Crossref Full Text | Google Scholar

Luo, D., Deng, T., Yuan, W., Deng, H., and Jin, M. (2017). Plasma metabolomic study in Chinese patients with wet age-related macular degeneration. BMC Ophthalmol. 17:165. doi: 10.1186/s12886-017-0555-7,

PubMed Abstract | Crossref Full Text | Google Scholar

Luo, Z., Mao, X., Peng, M., Huang, C., Liang, J., Xiao, Y., et al. (2025). The phenol-2-monooxygenase FgPhm1 regulates DON synthesis, pathogenicity and environmental stress response in Fusarium graminearum. Virulence 16:2563017. doi: 10.1080/21505594.2025.2563017,

PubMed Abstract | Crossref Full Text | Google Scholar

Mahapatra, S., Yadav, R., and Ramakrishna, W. (2022). Bacillus subtilis impact on plant growth, soil health and environment: Dr. Jekyll and Mr. Hyde. J. Appl. Microbiol. 132, 3543–3562. doi: 10.1111/jam.15480,

PubMed Abstract | Crossref Full Text | Google Scholar

Maral-Gül, D., and Eltem, R. (2025). Evaluation of Bacillus isolates as a biological control agents against soilborne phytopathogenic fungi. Int. Microbiol. 28, 75–89. doi: 10.1007/s10123-024-00490-1,

PubMed Abstract | Crossref Full Text | Google Scholar

Mo, R., Feng, L., Kong, F., Jiang, Y., Zhang, W., and Ling, L. (2025). Bacillus thuringiensis G-5 efficiently suppresses Codonopsis pilosula postharvest diseases by generating antifungal volatile organic compounds. Antonie Van Leeuwenhoek 118:145. doi: 10.1007/s10482-025-02158-w,

PubMed Abstract | Crossref Full Text | Google Scholar

Mohammed, A., Aboud, H. M., Saood, H. M., and Shibly, M. K. (2014). Antagonistic activity of some plant growth rhizobacteria to Fusarium graminearum. Int. J. Phytopathol. 3, 49–54. doi: 10.33687/phytopath.003.01.0660

Crossref Full Text | Google Scholar

Muhammad, M., Wahab, A., Waheed, A., Mohamed, H. I., Hakeem, K. R., Li, L., et al. (2024). Harnessing bacterial endophytes for environmental resilience and agricultural sustainability. J. Environ. Manag. 368:122201. doi: 10.1016/j.jenvman.2024.122201,

PubMed Abstract | Crossref Full Text | Google Scholar

Munakata, Y., Heuson, E., Daboudet, T., Deracinois, B., Duban, M., Hehn, A., et al. (2022). Screening of antimicrobial activities and Lipopeptide production of endophytic bacteria isolated from vetiver roots. Microorganisms 10:209. doi: 10.3390/microorganisms10020209,

PubMed Abstract | Crossref Full Text | Google Scholar

Ohki, R., Tateno, K., Okada, Y., Okajima, H., Asai, K., Sadaie, Y., et al. (2003). A bacitracin-resistant Bacillus subtilis gene encodes a homologue of the membrane-spanning subunit of the Bacillus licheniformis ABC transporte. J. Bacteriol. 185, 51–59. doi: 10.1128/JB.185.1.51-59.2003,

PubMed Abstract | Crossref Full Text | Google Scholar

Ongena, M., and Jacques, P. (2008). Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol. 16, 115–125. doi: 10.1016/j.tim.2007.12.009,

PubMed Abstract | Crossref Full Text | Google Scholar

Palazzini, J. M., Dunlap, C. A., Bowman, M. J., and Chulze, S. N. (2016). Bacillus velezensis RC 218 as a biocontrol agent to reduce Fusarium head blight and deoxynivalenol accumulation: genome sequencing and secondary metabolite cluster profiles. Microbiol. Res. 192, 30–36. doi: 10.1016/j.micres.2016.06.002,

PubMed Abstract | Crossref Full Text | Google Scholar

Patel, J. K., Mistry, Y., Soni, R., and Jha, A. (2024). Evaluation of antifungal activity of endophytic Bacillus spp. and identification of secondary metabolites produced against the Phytopathogenic Fungi. Curr. Microbiol. 81:128. doi: 10.1007/s00284-024-03652-6,

PubMed Abstract | Crossref Full Text | Google Scholar

Penha, R. O., Vandenberghe, L. P. S., Faulds, C., Soccol, V. T., and Soccol, C. R. (2020). Bacillus lipopeptides as powerful pest control agents for a more sustainable and healthy agriculture: recent studies and innovations. Planta 251:70. doi: 10.1007/s00425-020-03357-7,

PubMed Abstract | Crossref Full Text | Google Scholar

Ramarathnam, R., Bo, S., Chen, Y., Fernando, W. G. D., Xuewen, G., and de Kievit, T. (2007). Molecular and biochemical detection of fengycin- and bacillomycin D-producing Bacillus spp., antagonistic to fungal pathogens of canola and wheat. Can. J. Microbiol. 53, 901–911. doi: 10.1139/W07-049,

PubMed Abstract | Crossref Full Text | Google Scholar

Romanenko, L. A., Uchino, M., Kalinovskaya, N. I., and Mikhailov, V. V. (2008). Isolation, phylogenetic analysis and screening of marine mollusc-associated bacteria for antimicrobial, hemolytic and surface activities. Microbiol. Res. 163, 633–644. doi: 10.1016/j.micres.2006.10.001,

PubMed Abstract | Crossref Full Text | Google Scholar

Romero, D., de Vicente, A., Rakotoaly, R. H., Dufour, S. E., Veening, J. W., Arrebola, E., et al. (2007). The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaera fusca. Mol. Plant-Microbe Interact. 20, 430–440. doi: 10.1094/MPMI-20-4-0430,

PubMed Abstract | Crossref Full Text | Google Scholar

Sampangi-Ramaiah, M. H., Dey, P., Jambagi, S., Kumari, M. M., Oelmüller, R., Nataraja, K. N., et al. (2020). An endophyte from salt-adapted Pokkali rice confers salt-tolerance to a salt-sensitive rice variety and targets a unique pattern of genes in its new host. Sci. Rep. 10:3237. doi: 10.1038/s41598-020-59998-x

Crossref Full Text | Google Scholar

Shang, S., He, Y., Hu, Q., Fang, Y., Cheng, S., and Zhang, C. J. (2024). Fusarium graminearum effector FgEC1 targets wheat TaGF14b protein to suppress TaRBOHD-mediated ROS production and promote infection. J. Integr. Plant Biol. 66, 2288–2303. doi: 10.1111/jipb.13752,

PubMed Abstract | Crossref Full Text | Google Scholar

Smagulova, A. M. (2024). Isolation and characterization of Bacillus bacteria with antagonistic properties against the pathogens Alternaria alternata and Fusarium graminearum. J. Biol. Res. 1, 25–30. doi: 10.70264/jbr.v1.2.2024.4

Crossref Full Text | Google Scholar

Song, J., Wang, D., Han, D., Zhang, D.-D., Li, R., Kong, Z.-Q., et al. (2024). Characterization of the endophytic Bacillus subtilis KRS015 strain for its biocontrol efficacy against Verticillium dahliae. Phytopathology 114, 61–72. doi: 10.1094/PHYTO-04-23-0142-R,

PubMed Abstract | Crossref Full Text | Google Scholar

Summerell, B. A., Salleh, B., and Leslie, J. F. (2003). A utilitarian approach to Fusarium identification. Plant Dis. 87, 117–128. doi: 10.1094/PDIS.2003.87.2.117,

PubMed Abstract | Crossref Full Text | Google Scholar

Voigt, C. A., Schfer, W., and Salomon, S. (2005). A secreted lipase of Fusarium graminearum is a virulence factor required for infection of cereals. Plant J. 42, 364–375. doi: 10.1111/j.1365-313X.2005.02377.x,

PubMed Abstract | Crossref Full Text | Google Scholar

Wang, Y., Pei, Y., Wang, X., Dai, X., and Zhu, M. (2024). Antimicrobial metabolites produced by the plant growth-promoting rhizobacteria (PGPR): Bacillus and Pseudomonas. Adv. Agrochem. 3, 206–221. doi: 10.1016/j.aac.2024.07.007

Crossref Full Text | Google Scholar

Wróbel, M., Śliwakowski, W., Kowalczyk, P., Kramkowski, K., and Dobrzyński, J. (2023). Bioremediation of heavy metals by the genus Bacillus. Int. J. Environ. Res. Public Health 20:4964. doi: 10.3390/ijerph20064964,

PubMed Abstract | Crossref Full Text | Google Scholar

Xie, S., Liu, J., Gu, S., Chen, X., Jiang, H., and Ding, T. (2020). Antifungal activity of volatile compounds produced by endophytic Bacillus subtilis DZSY21 against Curvularia lunata. Ann. Microbiol. 70, 1–10. doi: 10.1186/s13213-020-01553-0

Crossref Full Text | Google Scholar

Yeo, Y. J., Park, A. R., Vuong, B. S., and Kim, J.-C. (2024). Biocontrol of Fusarium head blight in rice using Bacillus velezensis jck-7158. Front. Microbiol. 15:1358689. doi: 10.3389/fmicb.2024.1358689,

PubMed Abstract | Crossref Full Text | Google Scholar

Younas, H., Nazir, A., Bareen, F. E., and Thies, J. E. (2023). Metabolic profile and molecular characterization of endophytic bacteria isolated from Pinus sylvestris L. with growth-promoting effect on sunflower. Environ. Sci. Pollut. Res. Int. 30, 40147–40161. doi: 10.1007/s11356-022-25118-7,

PubMed Abstract | Crossref Full Text | Google Scholar

Yousuf, J., Thajudeen, J., Rahiman, M., Krishnankutty, S., Alikunj, A. P., and Abdulla, M. H. A. (2017). Nitrogen fixing potential of various heterotrophic Bacillus strains from a tropical estuary and adjacent coastal regions. J. Basic Microbiol. 57, 922–932. doi: 10.1002/jobm.201700072,

PubMed Abstract | Crossref Full Text | Google Scholar

Yu, C., Liu, X., Zhang, X., Zhang, M., Gu, Y., Ali, Q., et al. (2021). Mycosubtilin produced by Bacillus subtilis ATCC6633 inhibits growth and mycotoxin biosynthesis of Fusarium graminearum and Fusarium verticillioides. Toxins (Basel). 13:791. doi: 10.3390/toxins13110791,

PubMed Abstract | Crossref Full Text | Google Scholar

Yuan, J., Raza, W., Shen, Q., and Huang, Q. (2012). Antifungal activity of Bacillus amyloliquefaciens NJN-6 volatile compounds against Fusarium oxysporum f. sp. cubense. Appl. Environ. Microbiol. 78, 5942–5944. doi: 10.1128/AEM.01357-12,

PubMed Abstract | Crossref Full Text | Google Scholar

Zalila-Kolsi, I., Ben Mahmoud, A., Ali, H., Sellami, S., Nasfi, Z., Tounsi, S., et al. (2016). Antagonist effects of Bacillus spp. strains against Fusarium graminearum for protection of durum wheat (Triticum turgidum L. subsp. durum). Microbiol. Res. 192, 148–158. doi: 10.1016/j.micres.2016.06.012,

PubMed Abstract | Crossref Full Text | Google Scholar

Zhang, L., and Sun, C. (2018). Fengycins, cyclic Lipopeptides from marine Bacillus subtilis strains, kill the plant-pathogenic fungus Magnaporthe grisea by inducing reactive oxygen species production and chromatin condensation. Appl. Environ. Microbiol. 84, e00445–e00418. doi: 10.1128/AEM.00445-18,

PubMed Abstract | Crossref Full Text | Google Scholar

Zhang, D., Yu, S., Yang, Y., Zhang, J., Zhao, D., Pan, Y., et al. (2020). Antifungal effects of volatiles produced by Bacillus subtilis against Alternaria solani in potato. Front. Microbiol. 11:1196. doi: 10.3389/fmicb.2020.01196,

PubMed Abstract | Crossref Full Text | Google Scholar

Zhao, Y., Selvaraj, J. N., Xing, F., Zhou, L., Wang, Y., Song, H., et al. (2014). Antagonistic action of Bacillus subtilis strain SG6 on Fusarium graminearum. PLoS One 9:e92486. doi: 10.1371/journal.pone.0092486,

PubMed Abstract | Crossref Full Text | Google Scholar

Zhou, X., Lu, Z., Lv, F., Zhao, H., Wang, Y., and Bie, X. (2011). Antagonistic action of Bacillus subtilis strain fmbj on the postharvest pathogen Rhizopus stolonifer. J. Food Sci. 76, M254–M259. doi: 10.1111/j.1750-3841.2011.02160.x,

PubMed Abstract | Crossref Full Text | Google Scholar

Keywords: endophytes, antifungal activity, lipopeptides, volatile organic compounds, antagonisticmechanism

Citation: Hu Y-p, Lu G-d, Lin D-m, Lin X-s, Luo H-l, Hatungimana M, Liu B and Lin Z-x (2025) Screening, isolation and characterization of endophytic bacteria from upland Rice for antagonism against Fusarium graminearum. Front. Microbiol. 16:1717984. doi: 10.3389/fmicb.2025.1717984

Received: 03 October 2025; Revised: 09 November 2025; Accepted: 02 December 2025;
Published: 17 December 2025.

Edited by:

Arjun Singh, Central Soil Salinity Research Institute (ICAR), India

Reviewed by:

Laith Khalil Tawfeeq Al-Ani, Universiti Sains Malaysia, Malaysia
Ruqiya S., University of Agricultural Sciences, Bangalore, India

Copyright © 2025 Hu, Lu, Lin, Lin, Luo, Hatungimana, Liu and Lin. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Bin Liu, bGl1YmluNjE4QGhvdG1haWwuY29t; Zhan-xi Lin, bHp4anVuY2FvQDE2My5jb20=

Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.