Zhige Tian
Sirong Luo
Jiayi Li
Xiaoliang Hu- Faculty of Agriculture, Forestry and Food Engineering, Yibin University, Yibin, China
Introduction: Circoviruses within the family Circoviridae have been identified across diverse vertebrate taxa, including mammals, birds, and reptiles.
Methods: This study investigated the oral cavity of the Asian pit viper (Gloydius strauchi) in southwestern China using PCR assay. The presence of Circovirus strain GsCV1 in oral samples was confirmed using PCR with consensus primers.
Results and discussion: In this study, a recombinant Circovirus strain (GsCV1) was detected in the oral cavity of the Asian pit viper (Gloydius strauchi), a high-altitude species endemic to the plateaus (1,500–4,500 m) of Sichuan Province, China. Complete genome sequencing revealed a 1,811-bp circular DNA genome encoding two principal open reading frames for the replication-associated (Rep) and capsid (Cap) proteins, along with a conserved 9-bp nucleotide nonamer motif located at the apex of the stem-loop structure. Phylogenetic analysis indicated that the Rep sequence of GsCV1 clustered with mammalian circoviruses, whereas the Cap sequence was more closely related to avian strains. Recombination analysis suggested that GsCV1 emerged from interspecies recombination events involving bat-associated circovirus 3 (BatACV3), swan circovirus (SwCV), and zebra finch circovirus (ZfiCV). These findings expand the known host range and evolutionary complexity of circoviruses and raise the possibility that ecological behaviors and habitat-specific pressures in snakes may influence circoviral diversification. Further investigation is required to elucidate the prevalence, pathogenic potential, and ecological significance of circoviruses in reptilian hosts.
1 Introduction
Members of the family Circoviridae, comprising the genera Circovirus and Cyclovirus (Rosario et al., 2017), possess the smallest known non-enveloped single-stranded DNA (ssDNA) genomes among viruses, typically ranging from 1.7 to 2.1 kb in length. These compact circular genomes encode two major proteins, including the replication-associated (Rep) and capsid (Cap) proteins (Rosario et al., 2017). Circoviruses have been identified in over 76 vertebrate and invertebrate host species, including pigs (Allan et al., 2012), birds (Todd, 2000), canines (Anderson et al., 2017), minks (Lian et al., 2014), fish, bats, humans, and other mammals (Breitbart et al., 2017). To date, viruses from more than 11 families have been reported in reptiles, including Iridoviridae (Grosset et al., 2014; Papp and Marschang, 2019; Stöhr et al., 2013; Tamukai et al., 2016), Adenoviridae (Benge et al., 2019; Kim et al., 2002; Liu et al., 2023), Parvoviridae (Pénzes et al., 2015), Paramyxoviridae (Abbas et al., 2012), and Papillomaviridae (Herbst et al., 2009; Liu et al., 2023). Circoviruses have been detected in various reptilian hosts, such as turtles (black-breasted leaf turtle, Hermann’s tortoise, and common box turtle) (Tóth et al., 2024), snakes (black-headed python, speckled rattlesnake) (Altan et al., 2019; Gilbert et al., 2014), and lizards (e.g., Pogona vitticeps) (Chang et al., 2020). Our research team previously reported the presence of Circovirus in the oral cavity of Gloydius angusticeps from Sichuan province (Liu et al., 2023), raising the possibility of long-term adaptation and coevolution of circoviruses within ophidian hosts.
Circoviruses are recognized for their immunosuppressive effects, often predisposing infected hosts to secondary infections and compromising lymphoid organ integrity (Mankertz et al., 2004). For example, porcine circovirus 2 (PCV2) has been implicated in multiple disease syndromes in pigs, including post-weaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephropathy syndrome (PDNS), proliferative and necrotizing pneumonia (PNP), reproductive failure, and enteritis (Landrau-Giovannetti et al., 2020). In aquatic systems, European catfish circovirus (EcatfishCV) has been associated with mass mortality events in Hungary (Lőrincz et al., 2012). Although the pathogenicity of circoviruses in snakes remains unclear, the potential for subclinical or immunosuppressive effects warrants further investigation.
Gloydius strauchi, commonly referred to as the alpine pit viper, is a high-altitude species within the family Viperidae, endemic to the plateau regions of central and western China, including Sichuan, Yunnan, Xizang, Shaanxi, Gansu, Qinghai, and Ningxia. This species usually occupies rocky habitats and primarily preys on rodents. Despite its broad distribution and ecological specialization, no viral pathogens have been formally documented in the alpine pit viper.
This study identified and characterized the complete genome of a novel Circovirus isolated from the oral cavity of wild G. strauchi. Phylogenetic and recombination analyses demonstrated that the virus was closely related to Circovirus strains of mammalian and avian origin, indicating a potential cross-species transmission cycle within the Gloydius lineage.
2 Materials and methods
2.1 Sample collection
In June 2023, a wild Asian pit viper was captured in Shimian County, Sichuan Province, China. Oral samples were collected following previously described procedures (Liu et al., 2023). Swabs were placed in RNase-free tubes and immediately transported on dry ice to the laboratory. The snake was subsequently released back into the wild upon sample collection.
2.2 Detection of Circovirus in oral samples and amplification of complete genome sequences by polymerase chain reaction (PCR)
DNA was extracted from oral swabs using a commercial kit and screened for Circovirus using a primer pair targeting the Rep protein gene (Cir-F: GTTTACCTTGAGATTGGAGAG; Cir-R: TTTCCACGGGGTTTCCAGTATT). To amplify the complete genome, additional primers were used: Cir-F1: AGAGGTCAGACCTGAAGGAA (position 471–490), Cir-R1: CCTGTTTTTCAGATGCCTCATT (position 1761–1782), Cir-F2: GTGAAGGTGAGCCTATCAGAGT (position 1541–1562), and Cir-R2: CAGTCCGTTCAGAACAAAACTT (position 671–692). PCR amplification was performed under the following cycling parameters: initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 62 °C for 30 s, and 72 °C for 2 min, followed by a final extension at 72 °C for 10 min (Hu et al., 2015). PCR products were cloned into the pMD18-T vector (TaKaRa) prior to sequencing. Three independent clones were sequenced using the ABI_3500 platform with universal primers (M13F: AGGGTTTTCCCAGTCACG; M13R: CAGGAAACAGCTATGAC) to confirm sequence integrity.
2.3 Phylogenetic and genetic analyses
Pairwise nucleotide sequence similarity was determined using the Needleman-Wunsch global alignment algorithm1. Phylogenetic trees were constructed based on the complete genome, Rep protein, and Cap protein sequences using MEGA (v7.0) and the maximum-likelihood (ML) approach with the GTR + G + I, LG + G, and WAG + G + F models, respectively. Bootstrap support was estimated from 1,000 replicates. Simplot v3.5.1 was used to compare GsCV1 nucleotide sequences with the reference Circovirus strains. The GsCV1 sequence has been submitted to GenBank database under the accession number PX310168.
3 Results
3.1 Genome architecture and genetic features of GsCV1
The complete genome of strain GsCV1 comprised 1,811 nucleotides and contained two major open reading frames (ORFs): an 867-nucleotide ORF encoding the Rep protein on the virion strand and a 753-nucleotide ORF encoding the Cap protein on the complementary strand. A conserved 9-bp non-anucleotide motif (TAGTATTAC) was identified at the apex of the predicted stem-loop structure (Figure 1A). Three conserved rolling circle replication (RCR) motifs, along with an SH3-like helicase domain, were detected within the Rep protein sequence (Figure 1B). Notably, GsCV1 exhibited an overlapping region between the Rep and Cap coding regions, similar to that observed in WigFec circovirus 1.
Figure 1. Predicted stem-loop structure of GsCV1 (A) and multiple sequence alignment of Rep proteins from representative circoviruses (B). Conserved rolling-circle replication (RCR) motifs I, II, and III are indicated in boxes, along with Walker A, B, and C motifs associated with dNTP binding. Putative RCR initiator and helicase domains are annotated.
Pairwise sequence comparisons revealed that the GsCV1 Rep protein shares over 70% amino acid identity with bat-associated circovirus 1 (BatACV1), mink circovirus (MiCV), and porcine circovirus 4 (PCV4) (Figure 2B), while its nucleotide sequence and Cap protein exhibit less than 60% identity with all recognized Circovirus species (Figures 2A, C). These divergence patterns suggest that GsCV1 may represent a genetically distinct lineage with potentially novel functional attributes requiring further investigation.
Figure 2. Phylogenetic trees constructed using the maximum-likelihood method based on complete genome nucleotide sequences (A), Rep protein amino acid sequences (B), and Cap protein amino acid sequences (C). Percentage pairwise identities relative to GsCV1 are shown next to each taxon name, along with corresponding GenBank accession numbers. “●” represents the strain identified in the present study, “◆” represents the reptiles’ strains.
3.2 Phylogenetic relationships and recombinant analyses of GsCV1
Phylogenetic reconstruction based on the Rep protein positioned GsCV1 within a distinct cluster alongside mammalian-origin circoviruses, including BatACV1, MiCV, and PCV4 (Figure 2B). In contrast, analyses based on the complete genome and Cap protein sequence placed GsCV1 within a clade of avian-derived circoviruses, indicating topological incongruence across genomic regions (Figures 2A, C). Similar discordant clustering patterns were observed in other reptile-derived circoviruses: snake-origin BhPyCV grouped with avian strains, lizard-associated Pogona vitticeps circovirus (PvCV) aligned with mammalian strains, and turtle-origin circoviruses formed a distinct monophyletic lineage.
Recombination analysis indicated that GsCV1 likely originated through interspecies recombination involving BatACV3, swan circovirus (SwCV), and zebra finch circovirus (ZfiCV), highlighting the potential role of host-driven recombination in shaping circovirus evolution (Figure 3).
Figure 3. Recombination analysis of the GsCV1 strain. Crossover region in the GsCV1 genome was detected using Simplot v3.5.1. Y-axis represents the percentage of permuted trees, calculated with a sliding window of 200 nucleotides and step size of 20 nucleotides. Analyses were conducted using the Kimura 2-parameter model, a transition/transversion (Ts/Tv) ratio of 2.0, neighbor-joining tree model, and 1000 bootstrap replicates. Reference strains: BatACV3 (JQ814849), SwCV (EU056309), and ZfiCV (KP793918).
4 Discussion
Members of the family Circoviridae are known to infect a broad range of mammalian and avian hosts, including economically and ecologically significant pathogens such as PCV2 and beak and feather disease virus (BFDV) (Heath et al., 2004; Ma et al., 2007). Phylogenetic analyses of circoviruses derived from reptiles have revealed dispersed affiliations with both mammalian and avian lineages. For example, PvCV shows evolutionary proximity to bat-associated strains, whereas black-headed python circovirus (BhPyCV) clusters with avian-origin strains. In contrast, turtle-derived circoviruses—such as those from common box turtles, tortoises, and leaf turtles—form a distinct clade, suggesting a more lineage-specific evolutionary trajectory. In the present study, the Rep protein of GsCV1 exhibited closest similarity to bat- and mink-associated circoviruses, while its complete nucleotide sequence and Cap protein were more closely related to avian strains. These findings underscore the genetic heterogeneity among reptile-associated circoviruses and suggest that multiple ancestral lineages may be co-circulating within different reptilian taxa. However, due to the limited number of available reptile-derived Circovirus genomes, current evidence remains insufficient to resolve deep evolutionary relationships between reptile-associated and broader wildlife circoviruses.
Previous studies have identified recombination as a key mechanism driving Circovirus diversification and host adaptation (Piewbang et al., 2018). In PCV2, intra- and inter-genotypic recombination events have been documented, particularly in the context of interactions between wild boars and domestic pigs (Cadar et al., 2012; Cai et al., 2012). The present study reports, for the first time, a mammalian-avian recombinant Circovirus strain, suggesting that cross-species recombination may be more widespread than previously recognized. If the Circovirus infects in the new host, local adaption is the first barrier. The mechanism for transmission dynamic and host-virus interaction is ambiguous. In addition, mixed infections likely facilitate such events, with recombination potentially influenced by factors such as origin of replication motifs, local sequence homology, secondary structural features, and discontinuities in replication or transcription dynamics. Further investigation is warranted to elucidate the molecular mechanisms of recombination in circoviruses, particularly in the context of host switching between avian and mammalian reservoirs.
Previous studies have shown that PvCV clusters with bat-associated strains (Chang et al., 2020), raising the possibility of interspecies transmission facilitated by the high mobility of chiropteran hosts. Our previous study identified a Circovirus fragment in G. angusticeps from the eastern part of the Qinghai-Tibet Plateau, representing the first Circovirus detected in Chinese snakes (Liu et al., 2023). Notably, while GsCV1 showed close genetic similarity to this strain, it also clustered with a bat-associated Circovirus detected in Myanmar in 2008 and with Anas diazi Circovirus detected in the United States in 2021, as well as with strains isolated from both domestic animals and wildlife. These findings raise the possibility that GsCV1 may have disseminated into western Sichuan via bat migration, unknown intermediate hosts, or predator-prey transmission pathways involving snakes consuming bats or preying on other infected animals such as rodents. Although zoonotic RNA viruses have received greater attention in surveillance and epidemiological studies, DNA viruses—such as circoviruses—remain underexplored in this context. A deeper understanding of the ecological links, host interactions, and geographical drivers of Circovirus emergence will be critical to identifying latent reservoirs and assessing the risk of future cross-species transmission events.
5 Conclusion
A recombinant Circovirus, GsCV1, was identified in G. strauchi, a high-altitude pit viper species endemic to western Sichuan Province, China. Phylogenetic analysis indicated that GsCV1 exhibits genetic affinities with both mammalian- and avian-associated circoviruses. These findings suggest that snake-associated circoviruses may have originated from multiple ancestral lineages and persist through latent transmission cycles involving mammalian and avian hosts.
Data availability statement
The data presented in this study are deposited in the online repository. The names of the repository/repositories and accession number(s) can be found here: NCBI, accession number PX310168.
Ethics statement
The animal study was approved by Committee on the Animal Ethics Procedures and Guidelines of Experiment Animals Committee affiliated with Yibin University, Yibin, China. The study was conducted in accordance with the local legislation and institutional requirements.
Author contributions
ZT: Investigation, Methodology, Software, Writing – original draft, Writing – review & editing. SL: Methodology, Writing – original draft. JL: Investigation, Methodology, Writing – original draft. XL: Methodology, Software, Writing – review & editing. YH: Data curation, Methodology, Writing – original draft. YF: Data curation, Investigation, Methodology, Software, Writing – original draft. CZ: Data curation, Formal analysis, Methodology, Writing – original draft. PG: Data curation, Investigation, Methodology, Software, Writing – original draft. XH: Supervision, Writing – original draft, Writing – review & editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This work was supported by the Doctor Launch Project of Yibin University (2019QD09 and 2019QD10).
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The reviewer YL declared a past co-authorship with the author XH to the handling editor.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Footnotes
References
Abbas, M., Ball, I., Ruckova, Z., Öfner, S., Stöhr, A., and Marschang, R. (2012). Virological screening of bearded dragons (Pogona vitticeps) and the first detection of paramyxoviruses in this species. J. Herpetol. Med. Surg. 22, 86–90. doi: 10.5818/1529-9651-22.3.86
Allan, G., Krakowka, S., Ellis, J., and Charreyre, C. (2012). Discovery and evolving history of two genetically related but phenotypically different viruses, porcine circoviruses 1 and 2. Virus Res. 164, 4–9. doi: 10.1016/j.virusres.2011.09.013
Altan, E., Kubiski, S., Burchell, J., Bicknese, E., Deng, X., and Delwart, E. (2019). The first reptilian circovirus identified infects gut and liver tissues of black-headed pythons. Vet. Res. 50:35. doi: 10.1186/s13567-019-0653-z
Anderson, A., Hartmann, K., Leutenegger, C., Proksch, A., Mueller, R., and Unterer, S. (2017). Role of canine circovirus in dogs with acute haemorrhagic diarrhoea. Vet. Rec. 180:542. doi: 10.1136/vr.103926
Benge, S., Hyndman, T., Funk, R., Marschang, R., Schneider, R., Childress, A., et al. (2019). Identification of helodermatid adenovirus 2 in a captive central bearded dragon (pogona vitticeps), wild gila monsters (heloderma suspectum), and a death adder (acanthophis antarcticus). J. Zoo Wildlife Med. 50, 238–242. doi: 10.1638/2017-0016
Breitbart, M., Delwart, E., Rosario, K., Segalés, J., and Varsani, A. (2017). ICTV virus taxonomy profile: Circoviridae. J. Gen. Virol. 98, 1997–1998. doi: 10.1099/jgv.0.000871
Cadar, D., Cságola, A., Lorincz, M., Tombácz, K., Spînu, M., and Tuboly, T. (2012). Detection of natural inter- and intra-genotype recombination events revealed by cap gene analysis and decreasing prevalence of PCV2 in wild boars. Infect. Genet. Evol. 12, 420–427. doi: 10.1016/j.meegid.2012.01.014
Cai, L., Ni, J., Xia, Y., Zi, Z., Ning, K., Qiu, P., et al. (2012). Identification of an emerging recombinant cluster in porcine circovirus type 2. Virus Res. 165, 95–102. doi: 10.1016/j.virusres.2012.01.008
Chang, W., Li, C., Hall, J., Eden, J., Hyndman, T., Holmes, E., et al. (2020). Meta-transcriptomic discovery of a divergent circovirus and a chaphamaparvovirus in captive reptiles with proliferative respiratory syndrome. Viruses 12:1073. doi: 10.3390/v12101073
Gilbert, C., Meik, J., Dashevsky, D., Card, D., Castoe, T., and Schaack, S. (2014). Endogenous hepadnaviruses, bornaviruses and circoviruses in snakes. Proc. Biol. Sci. 281:20141122. doi: 10.1098/rspb.2014.1122
Grosset, C., Wellehan, J., Owens, S., McGraw, S., Gaffney, P., Foley, J., et al. (2014). Intraerythrocytic iridovirus in central bearded dragons (Pogona vitticeps). J. Vet. Diagn. Invest. 26, 354–364. doi: 10.1177/1040638714534851
Heath, L., Martin, D., Warburton, L., Perrin, M., Horsfield, W., Kingsley, C., et al. (2004). Evidence of unique genotypes of beak and feather disease virus in southern Africa. J. Virol. 78, 9277–9284. doi: 10.1128/JVI.78.17.9277-9284.2004
Herbst, L., Lenz, J., Van Doorslaer, K., Chen, Z., Stacy, B., Wellehan, J., et al. (2009). Genomic characterization of two novel reptilian papillomaviruses, Chelonia mydas papillomavirus 1 and Caretta caretta papillomavirus 1. Virology 383, 131–135. doi: 10.1016/j.virol.2008.09.022
Hu, X., Li, N., Tian, Z., Yin, X., Qu, L., and Qu, J. (2015). Molecular characterization and phylogenetic analysis of transmissible gastroenteritis virus HX strain isolated from China. BMC Vet. Res. 11:72. doi: 10.1186/s12917-015-0387-8
Kim, D., Mitchell, M., Bauer, R., Poston, R., and Cho, D. (2002). An outbreak of adenoviral infection in inland bearded dragons (Pogona vitticeps) coinfected with dependovirus and coccidial protozoa (Isospora sp.). J. Vet. Diagn. Invest. 14, 332–334. doi: 10.1177/104063870201400411
Landrau-Giovannetti, N., Subramaniam, K., Brown, M., Ng, T., Rotstein, D., West, K., et al. (2020). Genomic characterization of a novel circovirus from a stranded Longman’s beaked whale (Indopacetus pacificus). Virus Res. 277:197826. doi: 10.1016/j.virusres.2019.197826
Lian, H., Liu, Y., Li, N., Wang, Y., Zhang, S., and Hu, R. (2014). Novel circovirus from mink, China. Emerg. Infect. Dis. 20, 1548–1550. doi: 10.3201/eid2009.140015
Liu, A., Tian, Z., Yin, C., Zou, J., Wu, S., Luo, Y., et al. (2023). The analysis of oral and fecal virome detects multiple novel emerging viruses in snakes. Transbound. Emerg. Dis. 2023:4214812. doi: 10.1155/2023/4214812
Lőrincz, M., Dán, A., Láng, M., Csaba, G., Tóth, A., Székely, C., et al. (2012). Novel circovirus in European catfish (Silurus glanis). Arch. Virol. 157, 1173–1176. doi: 10.1007/s00705-012-1291-1
Ma, C., Hon, C., Lam, T., Li, V., Wong, C., de Oliveira, T., et al. (2007). Evidence for recombination in natural populations of porcine circovirus type 2 in Hong Kong and mainland China. J. Gen. Virol. 88, 1733–1737. doi: 10.1099/vir.0.82629-0
Mankertz, A., Caliskan, R., Hattermann, K., Hillenbrand, B., Kurzendoerfer, P., Mueller, B., et al. (2004). Molecular biology of Porcine circovirus: Analyses of gene expression and viral replication. Vet. Microbiol. 98, 81–88. doi: 10.1016/j.vetmic.2003.10.014
Papp, T., and Marschang, R. (2019). Detection and characterization of invertebrate iridoviruses found in reptiles and prey insects in Europe over the past two decades. Viruses 11:600. doi: 10.3390/v11070600
Pénzes, J., Pham, H., Benkö, M., and Tijssen, P. (2015). Novel parvoviruses in reptiles and genome sequence of a lizard parvovirus shed light on Dependoparvovirus genus evolution. J. Gen. Virol. 96, 2769–2779. doi: 10.1099/vir.0.000215
Piewbang, C., Jo, W., Puff, C., van der Vries, E., Kesdangsakonwut, S., Rungsipipat, A., et al. (2018). Novel canine circovirus strains from Thailand: Evidence for genetic recombination. Sci. Rep. 8:7524. doi: 10.1038/s41598-018-25936-1
Rosario, K., Breitbart, M., Harrach, B., Segalés, J., Delwart, E., Biagini, P., et al. (2017). Revisiting the taxonomy of the family Circoviridae: Establishment of the genus Cyclovirus and removal of the genus Gyrovirus. Arch. Virol. 162, 1447–1463. doi: 10.1007/s00705-017-3247-y
Stöhr, A., Blahak, S., Heckers, K., Wiechert, J., Behncke, H., Mathes, K., et al. (2013). Ranavirus infections associated with skin lesions in lizards. Vet. Res. 44:84. doi: 10.1186/1297-9716-44-84
Tamukai, K., Tokiwa, T., Kobayashi, H., and Une, Y. (2016). Ranavirus in an outbreak of dermatophilosis in captive inland bearded dragons (Pogona vitticeps). Vet. Dermatol. 27, 99–105.e28. doi: 10.1111/vde.12288
Todd, D. (2000). Circoviruses: Immunosuppressive threats to avian species: A review. Avian Pathol. 29, 373–394. doi: 10.1080/030794500750047126
Keywords: Circovirus, ecology, Gloydius strauchi, recombination, reptiles
Citation: Tian Z, Luo S, Li J, Liu X, Huang Y, Fan Y, Zhou C, Guo P and Hu X (2026) Novel snake Circovirus from alpine pit viper (Gloydius strauchi) in China: evidence of a mammal-avian genetic recombinant. Front. Microbiol. 16:1725961. doi: 10.3389/fmicb.2025.1725961
Received: 15 October 2025; Revised: 03 December 2025; Accepted: 09 December 2025;
Published: 08 January 2026.
Edited by:
Peng Lin, Bohai University, ChinaReviewed by:
Yan-Dong Tang, Chinese Academy of Agricultural Sciences, ChinaYongxiang Liu, Hebei University of Engineering, China
Copyright © 2026 Tian, Luo, Li, Liu, Huang, Fan, Zhou, Guo and Hu. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Xiaoliang Hu, bGlhbmc2NzlAMTYzLmNvbQ==